Starting /dee2/code/volunteer_pipeline.sh SRR4237625 current disk space = 3051545980928 free memory = 1581653368 SRR4237625 SRAfilesize 6ea48f356509f3f14ff7df202b6c710c SRR4237625.sra SRR4237625.sra file validated SRR4237625 is paired end SRR4237625 is conventional basespace SRR4237625 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237625_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.3355 33.0 32.0 34.0 2.0 34.0 2 32.256 34.0 32.0 34.0 27.0 34.0 3 32.31025 34.0 32.0 34.0 27.0 34.0 4 32.60325 34.0 33.0 34.0 31.0 34.0 5 32.7765 34.0 33.0 34.0 32.0 34.0 6 36.59025 38.0 37.0 38.0 34.0 38.0 7 37.019 38.0 38.0 38.0 35.0 38.0 8 37.1535 38.0 38.0 38.0 36.0 38.0 9 37.068 38.0 38.0 38.0 36.0 38.0 10-14 36.83155 38.0 38.0 38.0 35.2 38.0 15-19 36.929700000000004 38.0 38.0 38.0 35.4 38.0 20-24 36.976150000000004 38.0 38.0 38.0 35.4 38.0 25-29 37.056650000000005 38.0 38.0 38.0 35.8 38.0 30-34 37.044 38.0 38.0 38.0 36.0 38.0 35-39 36.96705000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.91165 38.0 38.0 38.0 35.6 38.0 45-49 36.476800000000004 38.0 37.6 38.0 33.6 38.0 50-54 36.6743 38.0 38.0 38.0 34.4 38.0 55-59 36.753550000000004 38.0 38.0 38.0 34.8 38.0 60-64 36.6177 38.0 38.0 38.0 34.0 38.0 65-69 36.65035 38.0 38.0 38.0 34.4 38.0 70-74 36.0813 38.0 37.2 38.0 31.6 38.0 75-79 36.3562 38.0 37.4 38.0 33.8 38.0 80-84 36.457100000000004 38.0 38.0 38.0 34.0 38.0 85-89 36.43755 38.0 38.0 38.0 34.0 38.0 90-94 36.4367 38.0 38.0 38.0 34.0 38.0 95-99 36.242900000000006 38.0 37.8 38.0 33.6 38.0 100-104 36.06400000000001 38.0 37.0 38.0 33.0 38.0 105-109 36.03855 38.0 37.0 38.0 32.6 38.0 110-114 35.9158 38.0 37.0 38.0 32.6 38.0 115-119 35.7106 38.0 37.0 38.0 31.0 38.0 120-124 35.60255 38.0 36.8 38.0 31.4 38.0 125-129 35.43115 38.0 36.4 38.0 30.4 38.0 130-134 34.61265 38.0 35.0 38.0 25.0 38.0 135-139 34.49145 38.0 35.0 38.0 25.0 38.0 140-144 34.718599999999995 38.0 35.0 38.0 27.8 38.0 145-149 33.9233 38.0 35.0 38.0 23.4 38.0 150 27.6075 34.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 2.0 12 1.0 13 0.0 14 0.0 15 1.0 16 4.0 17 2.0 18 2.0 19 3.0 20 2.0 21 10.0 22 4.0 23 10.0 24 10.0 25 14.0 26 27.0 27 23.0 28 40.0 29 48.0 30 84.0 31 78.0 32 108.0 33 133.0 34 199.0 35 296.0 36 618.0 37 2279.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.367502112081105 12.644325542100818 9.912700647704872 32.075471698113205 2 24.6 15.425 31.85 28.125 3 20.05 22.25 24.85 32.85 4 23.775 28.799999999999997 22.55 24.875 5 22.325 35.025 22.85 19.8 6 17.45 37.35 23.95 21.25 7 12.775 28.000000000000004 41.75 17.474999999999998 8 15.4 28.125 31.7 24.775 9 16.225 25.525 33.5 24.75 10-14 18.91 31.595000000000002 27.025 22.470000000000002 15-19 19.265 30.45 27.744999999999997 22.54 20-24 19.53 30.104999999999997 27.045 23.32 25-29 18.69 31.119999999999997 26.590000000000003 23.599999999999998 30-34 19.259999999999998 30.545 27.185 23.01 35-39 19.175 30.395 26.919999999999998 23.51 40-44 20.0 30.680000000000003 26.685 22.634999999999998 45-49 19.75 30.44 26.66 23.150000000000002 50-54 19.155 30.135 27.185 23.525 55-59 19.81 29.409999999999997 27.689999999999998 23.09 60-64 19.615 29.815 27.29 23.28 65-69 19.45 30.104999999999997 26.825 23.62 70-74 19.759999999999998 30.475 26.27 23.494999999999997 75-79 19.189999999999998 30.294999999999998 27.02 23.494999999999997 80-84 19.835 29.770000000000003 27.395000000000003 23.0 85-89 19.794999999999998 30.375000000000004 26.945000000000004 22.884999999999998 90-94 19.445 29.595 27.279999999999998 23.68 95-99 19.525000000000002 29.15 27.785 23.54 100-104 19.775000000000002 30.255 26.56 23.41 105-109 19.88 29.38 27.150000000000002 23.59 110-114 20.315 29.235 27.034999999999997 23.415 115-119 19.950000000000003 29.604999999999997 26.740000000000002 23.705000000000002 120-124 20.455000000000002 29.085 26.935 23.525 125-129 20.205000000000002 29.060000000000002 26.795 23.94 130-134 20.41 28.845 26.650000000000002 24.095 135-139 20.66 28.384999999999998 27.060000000000002 23.895 140-144 20.119999999999997 29.349999999999998 26.58 23.95 145-149 20.555 28.205000000000002 27.084999999999997 24.154999999999998 150 20.8 29.15 25.674999999999997 24.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.5 23 1.5 24 4.5 25 7.0 26 5.5 27 7.5 28 14.5 29 21.0 30 36.5 31 50.5 32 52.0 33 65.0 34 81.0 35 102.0 36 135.0 37 150.0 38 154.0 39 173.0 40 194.5 41 205.5 42 229.0 43 237.0 44 248.0 45 266.0 46 254.0 47 250.0 48 219.0 49 163.0 50 138.0 51 116.5 52 98.0 53 90.0 54 68.5 55 42.5 56 25.5 57 21.0 58 16.0 59 10.0 60 8.0 61 8.5 62 8.5 63 5.0 64 3.5 65 2.0 66 2.5 67 2.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.48750000000000004 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.3 0.0 0.0 0.0 0.0 114-115 1.5 0.0 0.0 0.0 0.0 116-117 1.825 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.4749999999999996 0.0 0.0 0.0 0.0 122-123 2.7625 0.0 0.0 0.0 0.0 124-125 3.0375 0.0 0.0 0.0 0.0 126-127 3.4375 0.0 0.0 0.0 0.0 128-129 3.925 0.0 0.0 0.0 0.0 130-131 4.4625 0.0 0.0 0.0 0.0 132-133 4.9 0.0 0.0 0.0 0.0 134-135 5.3875 0.0 0.0 0.0 0.0 136-137 5.8875 0.0 0.0 0.0 0.0 138 6.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237625 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237625_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.929 33.0 32.0 34.0 28.0 34.0 2 32.086 33.0 33.0 34.0 30.0 34.0 3 32.03075 33.0 33.0 34.0 30.0 34.0 4 31.99775 33.0 33.0 34.0 31.0 34.0 5 32.031 33.0 33.0 34.0 31.0 34.0 6 36.00325 38.0 38.0 38.0 33.0 38.0 7 35.95675 38.0 38.0 38.0 31.0 38.0 8 36.045 38.0 38.0 38.0 33.0 38.0 9 35.89575 38.0 38.0 38.0 31.0 38.0 10-14 35.89895 38.0 38.0 38.0 31.4 38.0 15-19 35.57575 38.0 37.2 38.0 29.6 38.0 20-24 35.473 38.0 37.2 38.0 29.2 38.0 25-29 35.81654999999999 38.0 37.8 38.0 31.8 38.0 30-34 35.79275 38.0 37.8 38.0 31.6 38.0 35-39 35.82395 38.0 37.8 38.0 32.2 38.0 40-44 35.877950000000006 38.0 38.0 38.0 33.0 38.0 45-49 35.642250000000004 38.0 37.2 38.0 30.6 38.0 50-54 35.78670000000001 38.0 38.0 38.0 32.2 38.0 55-59 35.64855 38.0 37.4 38.0 31.0 38.0 60-64 35.50840000000001 38.0 37.0 38.0 29.8 38.0 65-69 35.5015 38.0 37.0 38.0 29.4 38.0 70-74 35.1827 38.0 36.6 38.0 26.8 38.0 75-79 34.9701 38.0 36.6 38.0 27.4 38.0 80-84 35.133449999999996 38.0 37.0 38.0 28.8 38.0 85-89 35.12985 38.0 37.0 38.0 28.6 38.0 90-94 35.03675 38.0 36.8 38.0 28.2 38.0 95-99 34.901199999999996 38.0 36.8 38.0 27.6 38.0 100-104 34.7265 38.0 36.0 38.0 26.4 38.0 105-109 33.665 37.8 33.8 38.0 22.6 38.0 110-114 34.4546 38.0 35.8 38.0 25.0 38.0 115-119 34.239850000000004 38.0 35.6 38.0 23.6 38.0 120-124 34.065650000000005 38.0 35.0 38.0 23.0 38.0 125-129 33.5318 38.0 34.8 38.0 18.6 38.0 130-134 32.9328 38.0 33.6 38.0 14.8 38.0 135-139 32.68645 38.0 33.2 38.0 14.0 38.0 140-144 32.056200000000004 38.0 32.2 38.0 13.0 38.0 145-149 30.680799999999998 38.0 30.6 38.0 3.8 38.0 150 22.468 29.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 13.0 4 9.0 5 3.0 6 5.0 7 3.0 8 0.0 9 4.0 10 6.0 11 4.0 12 2.0 13 4.0 14 7.0 15 8.0 16 6.0 17 4.0 18 9.0 19 10.0 20 13.0 21 22.0 22 22.0 23 17.0 24 26.0 25 47.0 26 47.0 27 39.0 28 46.0 29 69.0 30 74.0 31 99.0 32 129.0 33 171.0 34 224.0 35 317.0 36 577.0 37 1933.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.375 22.275 13.275 21.075 2 30.475 23.95 28.549999999999997 17.025000000000002 3 21.349999999999998 28.925 31.2 18.525 4 24.4 35.875 22.85 16.875 5 25.525 37.25 21.85 15.375 6 20.775 38.35 23.325000000000003 17.549999999999997 7 21.75 21.3 37.85 19.1 8 22.525000000000002 25.75 27.775 23.95 9 22.125 26.174999999999997 29.775000000000002 21.925 10-14 23.745 28.87 26.68 20.705000000000002 15-19 23.685000000000002 28.23 28.18 19.905 20-24 24.005000000000003 27.644999999999996 28.244999999999997 20.105 25-29 24.63 27.74 27.51 20.119999999999997 30-34 23.305 27.825 28.74 20.13 35-39 23.785 27.715 28.315 20.185 40-44 23.845 27.705000000000002 28.050000000000004 20.4 45-49 23.645 27.715 28.249999999999996 20.39 50-54 23.735 27.700000000000003 28.785 19.78 55-59 23.79 27.52 28.9 19.79 60-64 23.54 27.915 28.599999999999998 19.945 65-69 23.645 28.09 28.794999999999998 19.470000000000002 70-74 23.755000000000003 27.765 28.34 20.14 75-79 23.625 27.584999999999997 28.775000000000002 20.015 80-84 23.895 27.715 27.93 20.46 85-89 23.849999999999998 27.41 28.720000000000002 20.02 90-94 23.115 27.744999999999997 29.330000000000002 19.81 95-99 23.615 27.605 28.825 19.955000000000002 100-104 24.035 28.050000000000004 28.444999999999997 19.470000000000002 105-109 23.45 27.189999999999998 29.185 20.175 110-114 23.575 26.955000000000002 29.14 20.330000000000002 115-119 24.060000000000002 27.224999999999998 28.93 19.785 120-124 23.695 27.250000000000004 28.794999999999998 20.26 125-129 23.94 27.675 28.37 20.015 130-134 24.075 27.37 28.79 19.765 135-139 24.529999999999998 27.32 29.244999999999997 18.905 140-144 24.59 27.41 28.244999999999997 19.755 145-149 24.935 27.065 28.895 19.105 150 24.05 28.075 28.975 18.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 1.5 24 2.0 25 3.5 26 6.5 27 7.0 28 7.5 29 9.5 30 15.5 31 22.5 32 30.5 33 39.0 34 48.5 35 78.5 36 92.5 37 104.0 38 136.0 39 160.5 40 201.5 41 245.0 42 261.0 43 263.5 44 269.5 45 271.5 46 274.5 47 255.0 48 224.5 49 202.0 50 175.5 51 159.0 52 121.0 53 79.0 54 60.0 55 44.0 56 35.5 57 29.5 58 18.5 59 11.5 60 7.5 61 4.0 62 2.0 63 2.0 64 2.5 65 2.5 66 2.0 67 1.5 68 0.5 69 0.0 70 1.5 71 1.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.7875 0.0 0.0 0.0 0.0 108-109 0.9624999999999999 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.325 0.0 0.0 0.0 0.0 114-115 1.5125 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 2.0875 0.0 0.0 0.0 0.0 120-121 2.425 0.0 0.0 0.0 0.0 122-123 2.7125 0.0 0.0 0.0 0.0 124-125 2.95 0.0 0.0 0.0 0.0 126-127 3.35 0.0 0.0 0.0 0.0 128-129 3.75 0.0 0.0 0.0 0.0 130-131 4.2375 0.0 0.0 0.0 0.0 132-133 4.6125 0.0 0.0 0.0 0.0 134-135 5.075 0.0 0.0 0.0 0.0 136-137 5.5875 0.0 0.0 0.0 0.0 138 5.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2976089 spots for SRR4237625.sra Written 2976089 spots for SRR4237625.sra Read 2976089 spots for SRR4237625.sra Written 2976089 spots for SRR4237625.sra Read 2976089 spots for SRR4237625.sra Written 2976089 spots for SRR4237625.sra Read 2976089 spots for SRR4237625.sra Written 2976089 spots for SRR4237625.sra Read 2976091 spots for SRR4237625.sra Written 2976091 spots for SRR4237625.sra Read 2976089 spots for SRR4237625.sra Written 2976089 spots for SRR4237625.sra Read 2976089 spots for SRR4237625.sra Written 2976089 spots for SRR4237625.sra Read 2976089 spots for SRR4237625.sra Written 2976089 spots for SRR4237625.sra Read 2976089 spots for SRR4237625.sra Written 2976089 spots for SRR4237625.sra Read 2976089 spots for SRR4237625.sra Written 2976089 spots for SRR4237625.sra Read 2976089 spots for SRR4237625.sra Written 2976089 spots for SRR4237625.sra Read 2976089 spots for SRR4237625.sra Written 2976089 spots for SRR4237625.sra Read 2976089 spots for SRR4237625.sra Written 2976089 spots for SRR4237625.sra Read 2976089 spots for SRR4237625.sra Written 2976089 spots for SRR4237625.sra Read 2976089 spots for SRR4237625.sra Written 2976089 spots for SRR4237625.sra Read 2976089 spots for SRR4237625.sra Written 2976089 spots for SRR4237625.sra Read 2976089 spots for SRR4237625.sra Written 2976089 spots for SRR4237625.sra Read 2976089 spots for SRR4237625.sra Written 2976089 spots for SRR4237625.sra Read 2976089 spots for SRR4237625.sra Written 2976089 spots for SRR4237625.sra Read 2976089 spots for SRR4237625.sra Written 2976089 spots for SRR4237625.sra SRR ids: ['SRR4237625.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ju92wtff SRR4237625.sra spots: 59521782 blocks: [[1, 2976089], [2976090, 5952178], [5952179, 8928267], [8928268, 11904356], [11904357, 14880445], [14880446, 17856534], [17856535, 20832623], [20832624, 23808712], [23808713, 26784801], [26784802, 29760890], [29760891, 32736979], [32736980, 35713068], [35713069, 38689157], [38689158, 41665246], [41665247, 44641335], [44641336, 47617424], [47617425, 50593513], [50593514, 53569602], [53569603, 56545691], [56545692, 59521782]] SRR4237625 file size 20032025 SRR4237625 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237625 SRR4237625_1.fastq SRR4237625_2.fastq Input file: SRR4237625_1.fastq Paired file: SRR4237625_2.fastq trimmed: SRR4237625-trimmed-pair1.fastq, SRR4237625-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:30:03 2025 >> started Wed Feb 12 18:31:08 2025 >> done (65.192s) 59521782 read pairs processed; of these: 183013 ( 0.31%) short read pairs filtered out after trimming by size control 123919 ( 0.21%) empty read pairs filtered out after trimming by size control 59214850 (99.48%) read pairs available; of these: 23740228 (40.09%) trimmed read pairs available after processing 35474622 (59.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 5 0.00% 20 7 0.00% 21 11 0.00% 22 11 0.00% 23 17 0.00% 24 10 0.00% 25 18 0.00% 26 25 0.00% 27 17 0.00% 28 24 0.00% 29 27 0.00% 30 36 0.00% 31 21 0.00% 32 33 0.00% 33 32 0.00% 34 29 0.00% 35 37 0.00% 36 41 0.00% 37 43 0.00% 38 67 0.00% 39 56 0.00% 40 63 0.00% 41 78 0.00% 42 82 0.00% 43 105 0.00% 44 121 0.00% 45 130 0.00% 46 151 0.00% 47 187 0.00% 48 212 0.00% 49 187 0.00% 50 255 0.00% 51 260 0.00% 52 278 0.00% 53 310 0.00% 54 313 0.00% 55 360 0.00% 56 404 0.00% 57 419 0.00% 58 499 0.00% 59 544 0.00% 60 588 0.00% 61 648 0.00% 62 733 0.00% 63 784 0.00% 64 930 0.00% 65 1073 0.00% 66 1247 0.00% 67 1646 0.00% 68 2635 0.00% 69 7108 0.01% 70 5130 0.01% 71 2540 0.00% 72 2519 0.00% 73 2738 0.00% 74 2913 0.00% 75 3289 0.01% 76 3739 0.01% 77 4169 0.01% 78 4617 0.01% 79 5065 0.01% 80 5703 0.01% 81 6612 0.01% 82 7652 0.01% 83 9923 0.02% 84 22744 0.04% 85 22619 0.04% 86 23152 0.04% 87 23682 0.04% 88 24564 0.04% 89 25709 0.04% 90 26866 0.05% 91 27781 0.05% 92 30008 0.05% 93 31531 0.05% 94 33569 0.06% 95 35874 0.06% 96 37507 0.06% 97 39732 0.07% 98 41554 0.07% 99 44253 0.07% 100 47195 0.08% 101 50549 0.09% 102 53117 0.09% 103 56525 0.10% 104 60149 0.10% 105 63790 0.11% 106 67623 0.11% 107 70841 0.12% 108 73656 0.12% 109 77515 0.13% 110 81422 0.14% 111 85756 0.14% 112 89713 0.15% 113 93764 0.16% 114 99765 0.17% 115 103929 0.18% 116 108195 0.18% 117 113339 0.19% 118 117672 0.20% 119 121220 0.20% 120 125823 0.21% 121 130628 0.22% 122 136077 0.23% 123 142936 0.24% 124 149612 0.25% 125 155554 0.26% 126 163149 0.28% 127 168834 0.29% 128 176144 0.30% 129 183730 0.31% 130 191559 0.32% 131 199289 0.34% 132 208378 0.35% 133 218355 0.37% 134 229469 0.39% 135 242119 0.41% 136 256186 0.43% 137 270360 0.46% 138 289059 0.49% 139 307558 0.52% 140 329165 0.56% 141 359936 0.61% 142 397348 0.67% 143 444267 0.75% 144 520594 0.88% 145 633769 1.07% 146 812086 1.37% 147 1151872 1.95% 148 2082956 3.52% 149 10847001 18.32% 150 35474622 59.91% 59214850 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=29 prefix-density=0.21 prefix-fanout=2.5 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.13 sequence-density-rank=8 fanout-score=84.23 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=16.7 sequence=CCACCACCAACATCCACCAAGGATGTGAGGCCTTCAAAGCCTTTGTAGGTCTCAAGAAGCTTCTTCATGGTAATGGTAGAGTGGTCAGACATTCCCTTATTGAA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=25.65 fanout-score-rank=5 prefix-density=0.44 prefix-fanout=10.2 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=33 fanout-score=34.99 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=7.6 sequence=ATCTTTGTGGTTGATAGCAATGATCGTGACCGTGTGGTTGA SRR4237625 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:31:51 Started mapping on | Feb 12 18:31:51 Finished on | Feb 12 18:36:05 Mapping speed, Million of reads per hour | 839.27 Number of input reads | 59214850 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 57016232 Uniquely mapped reads % | 96.29% Average mapped length | 292.06 Number of splices: Total | 44125714 Number of splices: Annotated (sjdb) | 43250544 Number of splices: GT/AG | 43437807 Number of splices: GC/AG | 517403 Number of splices: AT/AC | 42498 Number of splices: Non-canonical | 128006 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1111933 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 95220 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.64% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1271030 1271030 1271030 N_multimapping 1111933 1111933 1111933 N_noFeature 1711003 56176662 2064402 N_ambiguous 738370 3679 249711 UnstrandedReadsAssigned:54566859 PositiveStrandReadsAssigned:835891 NegativeStrandReadsAssigned:54702119 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237625 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237625-trimmed-pair1.fastq SRR4237625-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 59,214,850 reads, 54,662,077 reads pseudoaligned [quant] estimated average fragment length: 229.707 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52401 SRR4237625.ke.tsv 34699 SRR4237625.se.tsv 87100 total ==> SRR4237625.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.29 1203 11.6691 Potri.005G024800.1.v4.1 1035 806.293 158 3.4011 Potri.004G059700.1.v4.1 961 732.314 15 0.355507 Potri.007G009000.2.v4.1 1416 1187.29 0 0 Potri.003G141000.2.v4.1 2943 2714.29 735.03 4.70005 Potri.016G087400.1.v4.1 270 80.3281 10022.5 2165.52 Potri.015G069301.1.v4.1 564 337.718 0 0 Potri.010G195200.1.v4.1 1773 1544.29 106 1.19133 Potri.012G127500.1.v4.1 977 748.308 4371 101.381 ==> SRR4237625.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 10486 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 872 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 68 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR4237625 completed mapping pipeline successfully