Starting /dee2/code/volunteer_pipeline.sh SRR4237626 current disk space = 3051338551296 free memory = 1579239688 SRR4237626 SRAfilesize edfe65b46aa747d8b68457cce7624b8d SRR4237626.sra SRR4237626.sra file validated SRR4237626 is paired end SRR4237626 is conventional basespace SRR4237626 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237626_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.239 34.0 33.0 34.0 32.0 34.0 2 33.294 34.0 33.0 34.0 33.0 34.0 3 33.1595 34.0 33.0 34.0 31.0 34.0 4 33.2425 34.0 33.0 34.0 33.0 34.0 5 33.34225 34.0 33.0 34.0 33.0 34.0 6 36.61325 38.0 37.0 38.0 35.0 38.0 7 37.24225 38.0 38.0 38.0 36.0 38.0 8 37.0895 38.0 38.0 38.0 36.0 38.0 9 37.40575 38.0 38.0 38.0 37.0 38.0 10-14 37.0634 38.0 38.0 38.0 36.0 38.0 15-19 37.43855 38.0 38.0 38.0 37.4 38.0 20-24 37.445 38.0 38.0 38.0 37.0 38.0 25-29 37.37675 38.0 38.0 38.0 37.0 38.0 30-34 37.32585 38.0 38.0 38.0 37.0 38.0 35-39 37.1832 38.0 38.0 38.0 36.4 38.0 40-44 37.031000000000006 38.0 38.0 38.0 36.0 38.0 45-49 37.0664 38.0 38.0 38.0 36.0 38.0 50-54 37.101299999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.891749999999995 38.0 38.0 38.0 35.2 38.0 60-64 36.7675 38.0 38.0 38.0 35.0 38.0 65-69 36.9885 38.0 38.0 38.0 36.0 38.0 70-74 37.01455 38.0 38.0 38.0 35.8 38.0 75-79 36.8709 38.0 38.0 38.0 35.4 38.0 80-84 36.7887 38.0 38.0 38.0 35.2 38.0 85-89 36.5707 38.0 37.8 38.0 34.2 38.0 90-94 36.691449999999996 38.0 38.0 38.0 34.8 38.0 95-99 36.59045 38.0 38.0 38.0 34.4 38.0 100-104 36.494 38.0 38.0 38.0 34.0 38.0 105-109 36.52290000000001 38.0 38.0 38.0 34.4 38.0 110-114 36.2811 38.0 38.0 38.0 33.8 38.0 115-119 35.9861 38.0 37.6 38.0 32.6 38.0 120-124 36.08195 38.0 38.0 38.0 33.6 38.0 125-129 35.99665 38.0 37.8 38.0 33.2 38.0 130-134 35.875099999999996 38.0 37.6 38.0 32.6 38.0 135-139 35.621050000000004 38.0 37.0 38.0 31.2 38.0 140-144 35.50675 38.0 36.6 38.0 32.2 38.0 145-149 34.08195 38.0 35.0 38.0 25.2 38.0 150 28.85225 35.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 2.0 16 2.0 17 3.0 18 4.0 19 5.0 20 2.0 21 5.0 22 10.0 23 8.0 24 5.0 25 17.0 26 15.0 27 23.0 28 26.0 29 43.0 30 49.0 31 39.0 32 70.0 33 78.0 34 138.0 35 230.0 36 461.0 37 2763.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.05882352941176 13.16645807259074 8.285356695869837 31.48936170212766 2 23.400000000000002 14.625 33.25 28.725 3 20.75 20.5 27.0 31.75 4 23.25 29.95 22.525000000000002 24.275 5 23.35 34.2 23.175 19.275000000000002 6 18.87267237040765 37.669854051333665 23.251132360342226 20.206341217916457 7 15.049999999999999 25.974999999999998 40.949999999999996 18.025 8 15.75 26.8 32.25 25.2 9 18.4 26.625 31.95 23.025000000000002 10-14 20.09 30.605 26.735 22.57 15-19 19.77 29.38 27.650000000000002 23.200000000000003 20-24 20.19 29.235 27.305 23.27 25-29 19.79 29.835 27.229999999999997 23.145 30-34 19.8 29.275000000000002 27.694999999999997 23.23 35-39 19.945 28.595 27.72 23.74 40-44 20.4 29.7 26.700000000000003 23.200000000000003 45-49 19.72 29.335 27.49 23.455000000000002 50-54 19.765 29.84 27.389999999999997 23.005 55-59 19.79 28.875 27.615000000000002 23.72 60-64 20.53 29.104999999999997 26.91 23.455000000000002 65-69 20.405 29.2 26.765 23.630000000000003 70-74 20.544999999999998 28.884999999999998 27.505000000000003 23.064999999999998 75-79 20.36 29.349999999999998 27.115000000000002 23.175 80-84 20.09 29.445 27.224999999999998 23.24 85-89 19.965 28.904999999999998 27.24 23.89 90-94 20.49 28.910000000000004 26.889999999999997 23.71 95-99 20.555 28.76 27.08 23.605 100-104 20.05 28.794999999999998 27.375 23.78 105-109 20.16 28.95 27.435 23.455000000000002 110-114 20.715 28.84 26.99 23.455000000000002 115-119 20.455000000000002 28.105000000000004 27.58 23.86 120-124 20.185 29.38 26.86 23.575 125-129 21.19 27.96 27.215 23.635 130-134 21.105 28.76 26.490000000000002 23.645 135-139 20.455000000000002 29.020000000000003 26.235000000000003 24.29 140-144 20.845 28.355000000000004 26.51 24.29 145-149 21.15 28.435 26.095000000000002 24.32 150 19.6 29.775000000000002 25.174999999999997 25.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 2.0 21 2.5 22 1.0 23 1.5 24 3.0 25 3.5 26 6.5 27 10.0 28 18.0 29 22.0 30 21.5 31 32.5 32 39.5 33 51.0 34 65.0 35 73.0 36 90.5 37 113.0 38 139.0 39 158.5 40 174.5 41 204.5 42 226.0 43 248.0 44 270.0 45 269.0 46 260.5 47 250.0 48 240.0 49 215.0 50 168.0 51 132.0 52 110.0 53 90.0 54 77.0 55 54.0 56 38.0 57 35.0 58 22.5 59 14.0 60 11.0 61 8.0 62 5.0 63 3.5 64 3.5 65 2.0 66 1.5 67 1.5 68 1.5 69 1.5 70 1.0 71 2.0 72 1.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.65 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.32630522088353414 0.65 3 0.0 0.0 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.36250000000000004 0.0 0.0 0.0 0.0 78-79 0.44999999999999996 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.6875 0.0 0.0 0.0 0.0 86-87 0.85 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 90-91 1.05 0.0 0.0 0.0 0.0 92-93 1.2 0.0 0.0 0.0 0.0 94-95 1.35 0.0 0.0 0.0 0.0 96-97 1.5750000000000002 0.0 0.0 0.0 0.0 98-99 1.9249999999999998 0.0 0.0 0.0 0.0 100-101 2.1500000000000004 0.0 0.0 0.0 0.0 102-103 2.425 0.0 0.0 0.0 0.0 104-105 2.675 0.0 0.0 0.0 0.0 106-107 2.9000000000000004 0.0 0.0 0.0 0.0 108-109 3.2 0.0 0.0 0.0 0.0 110-111 3.625 0.0 0.0 0.0 0.0 112-113 3.9625000000000004 0.0 0.0 0.0 0.0 114-115 4.5125 0.0 0.0 0.0 0.0 116-117 4.875 0.0 0.0 0.0 0.0 118-119 5.4125 0.0 0.0 0.0 0.0 120-121 6.075 0.0 0.0 0.0 0.0 122-123 6.6125 0.0 0.0 0.0 0.0 124-125 7.175000000000001 0.0 0.0 0.0 0.0 126-127 7.925 0.0 0.0 0.0 0.0 128-129 8.575 0.0 0.0 0.0 0.0 130-131 8.9875 0.0 0.0 0.0 0.0 132-133 9.587499999999999 0.0 0.0 0.0 0.0 134-135 10.125 0.0 0.0 0.0 0.0 136-137 10.7875 0.0 0.0 0.0 0.0 138 11.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATGGG 10 0.006973645 144.0 9 ACATTCA 10 0.006973645 144.0 6 >>END_MODULE SRR4237626 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237626_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74425 33.0 33.0 34.0 32.0 34.0 2 32.83225 34.0 33.0 34.0 32.0 34.0 3 32.8395 34.0 33.0 34.0 32.0 34.0 4 32.37825 34.0 33.0 34.0 31.0 34.0 5 32.62025 34.0 33.0 34.0 32.0 34.0 6 36.7815 38.0 38.0 38.0 36.0 38.0 7 36.8905 38.0 38.0 38.0 36.0 38.0 8 36.84275 38.0 38.0 38.0 36.0 38.0 9 36.79325 38.0 38.0 38.0 36.0 38.0 10-14 36.84585 38.0 38.0 38.0 36.4 38.0 15-19 36.76825 38.0 38.0 38.0 36.0 38.0 20-24 36.73805 38.0 38.0 38.0 36.2 38.0 25-29 36.634550000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.5933 38.0 38.0 38.0 36.0 38.0 35-39 36.328250000000004 38.0 38.0 38.0 34.2 38.0 40-44 36.176649999999995 38.0 37.8 38.0 33.4 38.0 45-49 36.613 38.0 38.0 38.0 36.0 38.0 50-54 36.53185 38.0 38.0 38.0 36.0 38.0 55-59 36.35209999999999 38.0 38.0 38.0 34.4 38.0 60-64 36.490750000000006 38.0 38.0 38.0 35.2 38.0 65-69 36.16235 38.0 37.8 38.0 33.8 38.0 70-74 36.3762 38.0 38.0 38.0 34.8 38.0 75-79 36.40905 38.0 38.0 38.0 35.2 38.0 80-84 36.2632 38.0 38.0 38.0 34.6 38.0 85-89 36.215199999999996 38.0 38.0 38.0 34.4 38.0 90-94 36.070049999999995 38.0 38.0 38.0 33.8 38.0 95-99 36.1057 38.0 38.0 38.0 34.0 38.0 100-104 36.0039 38.0 38.0 38.0 34.0 38.0 105-109 35.846050000000005 38.0 38.0 38.0 33.6 38.0 110-114 35.849849999999996 38.0 38.0 38.0 34.0 38.0 115-119 35.6936 38.0 38.0 38.0 32.8 38.0 120-124 35.63155 38.0 38.0 38.0 33.0 38.0 125-129 35.5 38.0 38.0 38.0 32.8 38.0 130-134 35.290049999999994 38.0 38.0 38.0 31.4 38.0 135-139 35.0829 38.0 37.8 38.0 30.6 38.0 140-144 34.72325 38.0 36.2 38.0 28.4 38.0 145-149 34.41875 38.0 36.0 38.0 27.8 38.0 150 29.14575 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 13.0 4 8.0 5 4.0 6 2.0 7 4.0 8 2.0 9 5.0 10 3.0 11 5.0 12 1.0 13 3.0 14 7.0 15 7.0 16 4.0 17 6.0 18 5.0 19 6.0 20 7.0 21 7.0 22 8.0 23 9.0 24 13.0 25 20.0 26 19.0 27 22.0 28 25.0 29 31.0 30 43.0 31 49.0 32 82.0 33 63.0 34 101.0 35 158.0 36 356.0 37 2888.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.050000000000004 22.650000000000002 11.899999999999999 20.4 2 28.425 25.05 31.45 15.075 3 22.85 26.55 31.874999999999996 18.725 4 25.724999999999998 33.800000000000004 22.45 18.025 5 25.35 35.55 22.275 16.825000000000003 6 19.35 38.324999999999996 23.974999999999998 18.35 7 21.349999999999998 20.225 39.375 19.05 8 21.125 24.725 29.549999999999997 24.6 9 21.8 26.424999999999997 29.9 21.875 10-14 23.74 29.205 26.729999999999997 20.325 15-19 23.775 26.815 28.294999999999998 21.115000000000002 20-24 23.27 27.785 27.975 20.97 25-29 22.665 28.060000000000002 28.38 20.895 30-34 23.419999999999998 27.845 28.04 20.695 35-39 23.015 28.475 27.735 20.775 40-44 23.62 28.035 27.865000000000002 20.48 45-49 23.255 27.785 28.33 20.630000000000003 50-54 22.95 27.97 28.525 20.555 55-59 23.380000000000003 28.444999999999997 27.625 20.549999999999997 60-64 23.544999999999998 27.775 28.060000000000002 20.62 65-69 23.325000000000003 27.3 28.365000000000002 21.01 70-74 23.5 27.145000000000003 29.09 20.265 75-79 23.549999999999997 27.73 28.185 20.535 80-84 23.325000000000003 27.975 28.544999999999998 20.155 85-89 23.66 27.68 28.335 20.325 90-94 23.84 27.38 28.815 19.965 95-99 23.905 27.665 28.470000000000002 19.96 100-104 23.61 27.634999999999998 28.675 20.080000000000002 105-109 24.505 27.405 28.17 19.919999999999998 110-114 24.195 28.060000000000002 28.28 19.465 115-119 24.545 27.91 27.935 19.61 120-124 24.585 27.18 28.310000000000002 19.925 125-129 25.080000000000002 27.76 27.810000000000002 19.35 130-134 25.05 27.775 27.665 19.509999999999998 135-139 25.2 27.575 27.584999999999997 19.64 140-144 25.82 27.555000000000003 26.534999999999997 20.09 145-149 25.685000000000002 28.144999999999996 26.915 19.255 150 24.6 27.35 28.175 19.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 1.0 16 1.0 17 1.5 18 2.0 19 1.0 20 0.5 21 2.0 22 2.5 23 2.0 24 2.5 25 4.0 26 5.5 27 7.5 28 8.0 29 10.5 30 23.0 31 26.5 32 25.0 33 35.0 34 49.0 35 61.0 36 79.5 37 103.5 38 140.0 39 173.5 40 198.5 41 214.0 42 242.5 43 274.5 44 266.5 45 267.0 46 265.5 47 255.0 48 242.0 49 202.0 50 163.5 51 145.0 52 120.0 53 99.0 54 75.5 55 50.0 56 41.0 57 31.0 58 24.5 59 19.5 60 9.5 61 4.0 62 4.5 63 3.5 64 2.0 65 2.5 66 1.5 67 0.5 68 1.5 69 1.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.42500000000000004 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.775 0.0 0.0 0.0 0.0 88-89 0.8875 0.0 0.0 0.0 0.0 90-91 1.0 0.0 0.0 0.0 0.0 92-93 1.1375000000000002 0.0 0.0 0.0 0.0 94-95 1.25 0.0 0.0 0.0 0.0 96-97 1.45 0.0 0.0 0.0 0.0 98-99 1.775 0.0 0.0 0.0 0.0 100-101 2.0 0.0 0.0 0.0 0.0 102-103 2.2750000000000004 0.0 0.0 0.0 0.0 104-105 2.525 0.0 0.0 0.0 0.0 106-107 2.7375 0.0 0.0 0.0 0.0 108-109 3.05 0.0 0.0 0.0 0.0 110-111 3.45 0.0 0.0 0.0 0.0 112-113 3.7750000000000004 0.0 0.0 0.0 0.0 114-115 4.325 0.0 0.0 0.0 0.0 116-117 4.6625 0.0 0.0 0.0 0.0 118-119 5.2 0.0 0.0 0.0 0.0 120-121 5.85 0.0 0.0 0.0 0.0 122-123 6.324999999999999 0.0 0.0 0.0 0.0 124-125 6.85 0.0 0.0 0.0 0.0 126-127 7.55 0.0 0.0 0.0 0.0 128-129 8.2 0.0 0.0 0.0 0.0 130-131 8.625 0.0 0.0 0.0 0.0 132-133 9.2 0.0 0.0 0.0 0.0 134-135 9.6875 0.0 0.0 0.0 0.0 136-137 10.2875 0.0 0.0 0.0 0.0 138 10.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTAAAAC 10 0.006973645 144.0 8 >>END_MODULE Read 2006169 spots for SRR4237626.sra Written 2006169 spots for SRR4237626.sra Read 2006169 spots for SRR4237626.sra Written 2006169 spots for SRR4237626.sra Read 2006169 spots for SRR4237626.sra Written 2006169 spots for SRR4237626.sra Read 2006169 spots for SRR4237626.sra Written 2006169 spots for SRR4237626.sra Read 2006169 spots for SRR4237626.sra Written 2006169 spots for SRR4237626.sra Read 2006169 spots for SRR4237626.sra Written 2006169 spots for SRR4237626.sra Read 2006169 spots for SRR4237626.sra Written 2006169 spots for SRR4237626.sra Read 2006169 spots for SRR4237626.sra Written 2006169 spots for SRR4237626.sra Read 2006169 spots for SRR4237626.sra Written 2006169 spots for SRR4237626.sra Read 2006169 spots for SRR4237626.sra Written 2006169 spots for SRR4237626.sra Read 2006169 spots for SRR4237626.sra Written 2006169 spots for SRR4237626.sra Read 2006169 spots for SRR4237626.sra Written 2006169 spots for SRR4237626.sra Read 2006169 spots for SRR4237626.sra Written 2006169 spots for SRR4237626.sra Read 2006169 spots for SRR4237626.sra Written 2006169 spots for SRR4237626.sra Read 2006169 spots for SRR4237626.sra Written 2006169 spots for SRR4237626.sra Read 2006169 spots for SRR4237626.sra Written 2006169 spots for SRR4237626.sra Read 2006169 spots for SRR4237626.sra Written 2006169 spots for SRR4237626.sra Read 2006169 spots for SRR4237626.sra Written 2006169 spots for SRR4237626.sra Read 2006172 spots for SRR4237626.sra Written 2006172 spots for SRR4237626.sra Read 2006169 spots for SRR4237626.sra Written 2006169 spots for SRR4237626.sra SRR ids: ['SRR4237626.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kcpx9830 SRR4237626.sra spots: 40123383 blocks: [[1, 2006169], [2006170, 4012338], [4012339, 6018507], [6018508, 8024676], [8024677, 10030845], [10030846, 12037014], [12037015, 14043183], [14043184, 16049352], [16049353, 18055521], [18055522, 20061690], [20061691, 22067859], [22067860, 24074028], [24074029, 26080197], [26080198, 28086366], [28086367, 30092535], [30092536, 32098704], [32098705, 34104873], [34104874, 36111042], [36111043, 38117211], [38117212, 40123383]] SRR4237626 file size 13496431 SRR4237626 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237626 SRR4237626_1.fastq SRR4237626_2.fastq Input file: SRR4237626_1.fastq Paired file: SRR4237626_2.fastq trimmed: SRR4237626-trimmed-pair1.fastq, SRR4237626-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:25:07 2025 >> started Wed Feb 12 18:25:47 2025 >> done (40.305s) 40123383 read pairs processed; of these: 109905 ( 0.27%) short read pairs filtered out after trimming by size control 101957 ( 0.25%) empty read pairs filtered out after trimming by size control 39911521 (99.47%) read pairs available; of these: 14466858 (36.25%) trimmed read pairs available after processing 25444663 (63.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 21 0.00% 20 6 0.00% 21 12 0.00% 22 18 0.00% 23 16 0.00% 24 22 0.00% 25 11 0.00% 26 14 0.00% 27 29 0.00% 28 31 0.00% 29 27 0.00% 30 47 0.00% 31 52 0.00% 32 70 0.00% 33 65 0.00% 34 67 0.00% 35 89 0.00% 36 86 0.00% 37 121 0.00% 38 128 0.00% 39 137 0.00% 40 220 0.00% 41 198 0.00% 42 236 0.00% 43 244 0.00% 44 242 0.00% 45 355 0.00% 46 341 0.00% 47 463 0.00% 48 455 0.00% 49 522 0.00% 50 592 0.00% 51 635 0.00% 52 728 0.00% 53 776 0.00% 54 829 0.00% 55 924 0.00% 56 1106 0.00% 57 1200 0.00% 58 1346 0.00% 59 1453 0.00% 60 1755 0.00% 61 1959 0.00% 62 2166 0.01% 63 2494 0.01% 64 2760 0.01% 65 2991 0.01% 66 3553 0.01% 67 4846 0.01% 68 6831 0.02% 69 26459 0.07% 70 22085 0.06% 71 7751 0.02% 72 6919 0.02% 73 7609 0.02% 74 8239 0.02% 75 8961 0.02% 76 9675 0.02% 77 10460 0.03% 78 11762 0.03% 79 12829 0.03% 80 14142 0.04% 81 15791 0.04% 82 17541 0.04% 83 19832 0.05% 84 31853 0.08% 85 32036 0.08% 86 28954 0.07% 87 31042 0.08% 88 32718 0.08% 89 35764 0.09% 90 38942 0.10% 91 40614 0.10% 92 50174 0.13% 93 47270 0.12% 94 50957 0.13% 95 52532 0.13% 96 54709 0.14% 97 56822 0.14% 98 59820 0.15% 99 63645 0.16% 100 66278 0.17% 101 69169 0.17% 102 73570 0.18% 103 76749 0.19% 104 80404 0.20% 105 84872 0.21% 106 87822 0.22% 107 90612 0.23% 108 95376 0.24% 109 97679 0.24% 110 99962 0.25% 111 102554 0.26% 112 107108 0.27% 113 109006 0.27% 114 114434 0.29% 115 118452 0.30% 116 120873 0.30% 117 124390 0.31% 118 128265 0.32% 119 129616 0.32% 120 132525 0.33% 121 135758 0.34% 122 138039 0.35% 123 141041 0.35% 124 144193 0.36% 125 147475 0.37% 126 151646 0.38% 127 154232 0.39% 128 157714 0.40% 129 160952 0.40% 130 163909 0.41% 131 167681 0.42% 132 170825 0.43% 133 176258 0.44% 134 179093 0.45% 135 183809 0.46% 136 189354 0.47% 137 195815 0.49% 138 202368 0.51% 139 208260 0.52% 140 216183 0.54% 141 227864 0.57% 142 239811 0.60% 143 256235 0.64% 144 281681 0.71% 145 319168 0.80% 146 381727 0.96% 147 507895 1.27% 148 838724 2.10% 149 4968226 12.45% 150 25444663 63.75% 39911521 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=15.46 fanout-score-rank=9 prefix-density=0.33 prefix-fanout=7.3 sequence=GGTGCTGGTGCTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=235.51 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=29.8 sequence=TTCTTCTTCTTTGC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=27.07 fanout-score-rank=8 prefix-density=0.39 prefix-fanout=9.8 sequence=TGCTGAGATCATTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=235.34 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=24.9 sequence=AAGAAGAAGAAG SRR4237626 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:26:31 Started mapping on | Feb 12 18:26:32 Finished on | Feb 12 18:30:12 Mapping speed, Million of reads per hour | 653.10 Number of input reads | 39911521 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 38091342 Uniquely mapped reads % | 95.44% Average mapped length | 288.34 Number of splices: Total | 33181424 Number of splices: Annotated (sjdb) | 32582058 Number of splices: GT/AG | 32648400 Number of splices: GC/AG | 400522 Number of splices: AT/AC | 34450 Number of splices: Non-canonical | 98052 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 771248 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 49732 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1117978 1117978 1117978 N_multimapping 771248 771248 771248 N_noFeature 1108186 37542675 1426063 N_ambiguous 378265 2536 145606 UnstrandedReadsAssigned:36604891 PositiveStrandReadsAssigned:546131 NegativeStrandReadsAssigned:36519673 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=148 echo kmer=143 SRR4237626 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237626-trimmed-pair1.fastq SRR4237626-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,911,521 reads, 36,399,812 reads pseudoaligned [quant] estimated average fragment length: 216.45 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,262 rounds 52401 SRR4237626.ke.tsv 34699 SRR4237626.se.tsv 87100 total ==> SRR4237626.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1802.55 783.467 12.0298 Potri.005G024800.1.v4.1 1035 819.55 112 3.78239 Potri.004G059700.1.v4.1 961 745.568 30 1.11367 Potri.007G009000.2.v4.1 1416 1200.55 0 0 Potri.003G141000.2.v4.1 2943 2727.55 560.305 5.68558 Potri.016G087400.1.v4.1 270 94.0376 5691 1674.98 Potri.015G069301.1.v4.1 564 351.859 0 0 Potri.010G195200.1.v4.1 1773 1557.55 176 3.12747 Potri.012G127500.1.v4.1 977 761.55 22252 808.712 ==> SRR4237626.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3871 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 707 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237626 completed mapping pipeline successfully