Starting /dee2/code/volunteer_pipeline.sh SRR4237627 current disk space = 3051715854336 free memory = 1457958252 SRR4237627 SRAfilesize a48dfb52ac77f254a4902c6b489dec49 SRR4237627.sra SRR4237627.sra file validated SRR4237627 is paired end SRR4237627 is conventional basespace SRR4237627 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237627_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.215 34.0 33.0 34.0 32.0 34.0 2 33.18725 34.0 33.0 34.0 32.0 34.0 3 33.2385 34.0 33.0 34.0 32.0 34.0 4 33.244 34.0 33.0 34.0 33.0 34.0 5 33.2425 34.0 33.0 34.0 32.0 34.0 6 36.78425 38.0 37.0 38.0 35.0 38.0 7 37.183 38.0 38.0 38.0 36.0 38.0 8 37.391 38.0 38.0 38.0 37.0 38.0 9 37.36825 38.0 38.0 38.0 37.0 38.0 10-14 37.42045 38.0 38.0 38.0 37.0 38.0 15-19 37.415749999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.4362 38.0 38.0 38.0 37.0 38.0 25-29 37.42895 38.0 38.0 38.0 37.0 38.0 30-34 37.3934 38.0 38.0 38.0 37.0 38.0 35-39 37.374849999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.26125 38.0 38.0 38.0 36.6 38.0 45-49 37.229350000000004 38.0 38.0 38.0 36.6 38.0 50-54 37.2069 38.0 38.0 38.0 36.2 38.0 55-59 37.15405 38.0 38.0 38.0 36.0 38.0 60-64 37.15160000000001 38.0 38.0 38.0 36.0 38.0 65-69 37.06035 38.0 38.0 38.0 36.0 38.0 70-74 37.02415 38.0 38.0 38.0 36.0 38.0 75-79 36.48155 38.0 37.4 38.0 33.4 38.0 80-84 36.852250000000005 38.0 38.0 38.0 35.4 38.0 85-89 36.4195 38.0 37.6 38.0 31.6 38.0 90-94 36.63099999999999 38.0 37.6 38.0 33.6 38.0 95-99 36.711850000000005 38.0 38.0 38.0 34.8 38.0 100-104 36.6188 38.0 38.0 38.0 34.2 38.0 105-109 36.64585 38.0 38.0 38.0 34.6 38.0 110-114 36.499649999999995 38.0 38.0 38.0 34.2 38.0 115-119 36.377700000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.33135 38.0 38.0 38.0 34.0 38.0 125-129 36.2856 38.0 38.0 38.0 33.8 38.0 130-134 36.005 38.0 37.0 38.0 32.6 38.0 135-139 35.88495 38.0 37.0 38.0 33.0 38.0 140-144 35.6749 38.0 36.2 38.0 31.8 38.0 145-149 35.1902 38.0 36.0 38.0 31.0 38.0 150 29.708 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 1.0 20 2.0 21 3.0 22 6.0 23 1.0 24 15.0 25 10.0 26 10.0 27 11.0 28 16.0 29 27.0 30 50.0 31 55.0 32 69.0 33 93.0 34 148.0 35 206.0 36 481.0 37 2792.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.7 11.075 8.5 43.725 2 23.12703583061889 15.134051616136308 37.15860686544726 24.580305687797544 3 20.549999999999997 19.85 25.275 34.325 4 23.724999999999998 29.099999999999998 21.675 25.5 5 21.675 34.525 24.6 19.2 6 17.9029419160171 36.6607995976867 24.46567764646719 20.97058083982902 7 14.6 27.3 40.1 18.0 8 16.150000000000002 26.05 31.6 26.200000000000003 9 17.025000000000002 23.35 35.199999999999996 24.425 10-14 19.555 30.509999999999998 26.655 23.28 15-19 19.950000000000003 28.65 28.02 23.380000000000003 20-24 19.205 28.660000000000004 28.005000000000003 24.13 25-29 19.66 29.310000000000002 27.275 23.755000000000003 30-34 19.814999999999998 27.85 28.49 23.845 35-39 19.255 29.565 27.775 23.405 40-44 19.98 28.96 27.415 23.645 45-49 19.91 28.68 27.455000000000002 23.955000000000002 50-54 19.605 29.185 27.165 24.044999999999998 55-59 19.650000000000002 29.26 27.27 23.82 60-64 19.645000000000003 29.175 27.089999999999996 24.09 65-69 19.84 27.975 27.88 24.305 70-74 19.855 29.325000000000003 26.955000000000002 23.865 75-79 19.814999999999998 29.255 27.295 23.635 80-84 20.119999999999997 28.83 27.0 24.05 85-89 20.275000000000002 28.335 27.665 23.724999999999998 90-94 20.445 28.299999999999997 27.405 23.849999999999998 95-99 20.125 28.939999999999998 27.72 23.215 100-104 20.59 28.470000000000002 27.250000000000004 23.69 105-109 20.335 28.449999999999996 27.155 24.060000000000002 110-114 20.135 28.01 28.08 23.775 115-119 20.41 28.95 27.175 23.465 120-124 20.535 28.655 27.365000000000002 23.445 125-129 20.380000000000003 28.365000000000002 27.474999999999998 23.78 130-134 20.48 28.22 27.295 24.005000000000003 135-139 20.715 28.384999999999998 26.715 24.185000000000002 140-144 20.64 28.52 26.93 23.91 145-149 21.145 28.694999999999997 26.515 23.645 150 20.26686807653575 28.575025176233638 25.6797583081571 25.478348439073518 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 1.0 22 1.5 23 2.0 24 3.5 25 3.5 26 3.0 27 5.0 28 9.0 29 13.5 30 18.0 31 22.5 32 34.5 33 41.5 34 54.0 35 75.5 36 93.5 37 111.5 38 130.0 39 145.0 40 191.0 41 219.5 42 240.0 43 283.5 44 294.0 45 279.0 46 272.5 47 263.5 48 223.5 49 187.0 50 161.0 51 140.0 52 117.5 53 90.5 54 68.0 55 50.5 56 36.0 57 32.0 58 26.5 59 18.5 60 11.5 61 6.0 62 3.0 63 2.5 64 4.0 65 2.5 66 1.0 67 0.5 68 0.0 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.575 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.7000000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.2125 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.3250000000000002 0.0 0.0 0.0 0.0 118-119 1.5 0.0 0.0 0.0 0.0 120-121 1.7 0.0 0.0 0.0 0.0 122-123 2.0 0.0 0.0 0.0 0.0 124-125 2.2249999999999996 0.0 0.0 0.0 0.0 126-127 2.5875 0.0 0.0 0.0 0.0 128-129 2.7750000000000004 0.0 0.0 0.0 0.0 130-131 3.0625 0.0 0.0 0.0 0.0 132-133 3.45 0.0 0.0 0.0 0.0 134-135 3.7875 0.0 0.0 0.0 0.0 136-137 4.125 0.0 0.0 0.0 0.0 138 4.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237627 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237627_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.38425 33.0 33.0 34.0 31.0 34.0 2 32.64975 33.0 33.0 34.0 32.0 34.0 3 31.08175 33.0 32.0 34.0 18.0 34.0 4 32.30525 33.0 33.0 34.0 28.0 34.0 5 32.53125 33.0 33.0 34.0 32.0 34.0 6 36.8835 38.0 38.0 38.0 36.0 38.0 7 36.9885 38.0 38.0 38.0 36.0 38.0 8 36.86625 38.0 38.0 38.0 35.0 38.0 9 37.00175 38.0 38.0 38.0 36.0 38.0 10-14 36.5344 38.0 37.8 38.0 34.0 38.0 15-19 36.7082 38.0 38.0 38.0 34.8 38.0 20-24 37.03815 38.0 38.0 38.0 36.4 38.0 25-29 37.01745000000001 38.0 38.0 38.0 36.4 38.0 30-34 37.00099999999999 38.0 38.0 38.0 36.0 38.0 35-39 36.491949999999996 38.0 37.8 38.0 33.4 38.0 40-44 36.85915000000001 38.0 38.0 38.0 35.8 38.0 45-49 36.86395 38.0 38.0 38.0 36.0 38.0 50-54 36.91305 38.0 38.0 38.0 36.0 38.0 55-59 36.793350000000004 38.0 38.0 38.0 35.8 38.0 60-64 36.8326 38.0 38.0 38.0 35.8 38.0 65-69 36.7188 38.0 38.0 38.0 35.6 38.0 70-74 36.6902 38.0 38.0 38.0 35.2 38.0 75-79 36.72465 38.0 38.0 38.0 35.4 38.0 80-84 36.5663 38.0 38.0 38.0 35.0 38.0 85-89 36.61885 38.0 38.0 38.0 35.0 38.0 90-94 36.6404 38.0 38.0 38.0 35.2 38.0 95-99 35.7963 38.0 37.0 38.0 29.4 38.0 100-104 36.4207 38.0 38.0 38.0 34.0 38.0 105-109 36.363800000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.2144 38.0 38.0 38.0 34.0 38.0 115-119 34.01595 37.0 31.4 38.0 27.6 38.0 120-124 35.67955 38.0 37.0 38.0 31.6 38.0 125-129 35.9003 38.0 38.0 38.0 33.0 38.0 130-134 35.7619 38.0 37.8 38.0 33.0 38.0 135-139 35.511449999999996 38.0 37.0 38.0 31.4 38.0 140-144 34.0901 38.0 34.6 38.0 25.4 38.0 145-149 34.61319999999999 38.0 35.6 38.0 29.4 38.0 150 28.35875 33.0 26.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 3.0 5 0.0 6 4.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 3.0 13 6.0 14 3.0 15 3.0 16 2.0 17 2.0 18 7.0 19 10.0 20 7.0 21 6.0 22 8.0 23 12.0 24 9.0 25 15.0 26 19.0 27 21.0 28 30.0 29 34.0 30 40.0 31 70.0 32 74.0 33 114.0 34 128.0 35 220.0 36 532.0 37 2612.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.875 18.75 13.450000000000001 29.925 2 26.325 24.775 34.975 13.925 3 21.675 26.150000000000002 31.324999999999996 20.849999999999998 4 23.549999999999997 34.675 22.925 18.85 5 25.124999999999996 37.724999999999994 21.95 15.2 6 19.35 40.1 23.175 17.375 7 19.900000000000002 21.0 40.125 18.975 8 20.875 25.025 29.9 24.2 9 22.35 24.349999999999998 30.625000000000004 22.675 10-14 23.48 28.865000000000002 26.634999999999998 21.02 15-19 23.724999999999998 27.57 28.09 20.615 20-24 23.355 28.365000000000002 27.6 20.68 25-29 23.615 28.08 27.755000000000003 20.549999999999997 30-34 23.555 27.92 28.244999999999997 20.28 35-39 22.61 27.845 28.705000000000002 20.84 40-44 23.02 28.64 27.685 20.655 45-49 23.1 27.88 28.235 20.785 50-54 23.29 27.665 28.494999999999997 20.549999999999997 55-59 24.21 27.675 27.810000000000002 20.305 60-64 23.425 28.215 28.439999999999998 19.919999999999998 65-69 23.865 27.134999999999998 28.610000000000003 20.39 70-74 23.305 27.534999999999997 28.38 20.78 75-79 23.41 27.889999999999997 28.4 20.3 80-84 23.9 26.88 28.305000000000003 20.915 85-89 23.375 27.994999999999997 28.425 20.205000000000002 90-94 23.79 27.76 28.455000000000002 19.994999999999997 95-99 23.77 27.860000000000003 27.93 20.44 100-104 23.830000000000002 28.310000000000002 27.615000000000002 20.244999999999997 105-109 24.295 27.46 28.310000000000002 19.935 110-114 23.925 27.74 28.494999999999997 19.84 115-119 23.97 28.09 27.900000000000002 20.04 120-124 24.185000000000002 27.435 27.98 20.4 125-129 24.055 27.839999999999996 28.265 19.84 130-134 24.83 27.29 28.1 19.78 135-139 24.3 27.325 28.42 19.955000000000002 140-144 24.75 27.29 28.23 19.73 145-149 24.925 27.755000000000003 27.6 19.72 150 26.025 27.6 27.575 18.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 1.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 3.5 26 5.5 27 4.0 28 4.0 29 9.5 30 14.0 31 15.5 32 17.5 33 25.5 34 42.5 35 65.0 36 87.0 37 103.5 38 130.5 39 176.0 40 226.5 41 248.5 42 269.5 43 281.5 44 279.5 45 285.5 46 270.5 47 267.5 48 242.0 49 194.5 50 161.5 51 131.5 52 106.0 53 80.5 54 58.5 55 45.0 56 38.0 57 30.5 58 23.5 59 16.0 60 11.0 61 8.5 62 5.5 63 3.0 64 2.0 65 2.5 66 1.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0125 0.0 86-87 0.025 0.0 0.0 0.025 0.0 88-89 0.037500000000000006 0.0 0.0 0.025 0.0 90-91 0.1 0.0 0.0 0.025 0.0 92-93 0.1125 0.0 0.0 0.025 0.0 94-95 0.1875 0.0 0.0 0.025 0.0 96-97 0.2375 0.0 0.0 0.025 0.0 98-99 0.3875 0.0 0.0 0.025 0.0 100-101 0.5 0.0 0.0 0.025 0.0 102-103 0.575 0.0 0.0 0.025 0.0 104-105 0.7 0.0 0.0 0.025 0.0 106-107 0.775 0.0 0.0 0.025 0.0 108-109 0.8875 0.0 0.0 0.025 0.0 110-111 0.925 0.0 0.0 0.025 0.0 112-113 0.975 0.0 0.0 0.025 0.0 114-115 1.1125 0.0 0.0 0.025 0.0 116-117 1.25 0.0 0.0 0.025 0.0 118-119 1.375 0.0 0.0 0.025 0.0 120-121 1.575 0.0 0.0 0.025 0.0 122-123 1.875 0.0 0.0 0.025 0.0 124-125 2.125 0.0 0.0 0.025 0.0 126-127 2.4875 0.0 0.0 0.025 0.0 128-129 2.7 0.0 0.0 0.025 0.0 130-131 2.9875 0.0 0.0 0.025 0.0 132-133 3.375 0.0 0.0 0.025 0.0 134-135 3.675 0.0 0.0 0.025 0.0 136-137 3.9625000000000004 0.0 0.0 0.025 0.0 138 4.225 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGACCTA 10 0.006973645 144.0 4 ATTTCTA 10 0.006973645 144.0 5 >>END_MODULE Read 2513553 spots for SRR4237627.sra Written 2513553 spots for SRR4237627.sra Read 2513553 spots for SRR4237627.sra Written 2513553 spots for SRR4237627.sra Read 2513553 spots for SRR4237627.sra Written 2513553 spots for SRR4237627.sra Read 2513553 spots for SRR4237627.sra Written 2513553 spots for SRR4237627.sra Read 2513553 spots for SRR4237627.sra Written 2513553 spots for SRR4237627.sra Read 2513553 spots for SRR4237627.sra Written 2513553 spots for SRR4237627.sra Read 2513553 spots for SRR4237627.sra Written 2513553 spots for SRR4237627.sra Read 2513553 spots for SRR4237627.sra Written 2513553 spots for SRR4237627.sra Read 2513553 spots for SRR4237627.sra Written 2513553 spots for SRR4237627.sra Read 2513553 spots for SRR4237627.sra Written 2513553 spots for SRR4237627.sra Read 2513553 spots for SRR4237627.sra Written 2513553 spots for SRR4237627.sra Read 2513553 spots for SRR4237627.sra Written 2513553 spots for SRR4237627.sra Read 2513553 spots for SRR4237627.sra Written 2513553 spots for SRR4237627.sra Read 2513553 spots for SRR4237627.sra Written 2513553 spots for SRR4237627.sra Read 2513567 spots for SRR4237627.sra Written 2513567 spots for SRR4237627.sra Read 2513553 spots for SRR4237627.sra Written 2513553 spots for SRR4237627.sra Read 2513553 spots for SRR4237627.sra Written 2513553 spots for SRR4237627.sra Read 2513553 spots for SRR4237627.sra Written 2513553 spots for SRR4237627.sra Read 2513553 spots for SRR4237627.sra Written 2513553 spots for SRR4237627.sra Read 2513553 spots for SRR4237627.sra Written 2513553 spots for SRR4237627.sra SRR ids: ['SRR4237627.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4fprxi8p SRR4237627.sra spots: 50271074 blocks: [[1, 2513553], [2513554, 5027106], [5027107, 7540659], [7540660, 10054212], [10054213, 12567765], [12567766, 15081318], [15081319, 17594871], [17594872, 20108424], [20108425, 22621977], [22621978, 25135530], [25135531, 27649083], [27649084, 30162636], [30162637, 32676189], [32676190, 35189742], [35189743, 37703295], [37703296, 40216848], [40216849, 42730401], [42730402, 45243954], [45243955, 47757507], [47757508, 50271074]] SRR4237627 file size 16915331 SRR4237627 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237627 SRR4237627_1.fastq SRR4237627_2.fastq Input file: SRR4237627_1.fastq Paired file: SRR4237627_2.fastq trimmed: SRR4237627-trimmed-pair1.fastq, SRR4237627-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:59:51 2025 >> started Wed Feb 12 18:00:52 2025 >> done (60.411s) 50271074 read pairs processed; of these: 82067 ( 0.16%) short read pairs filtered out after trimming by size control 44797 ( 0.09%) empty read pairs filtered out after trimming by size control 50144210 (99.75%) read pairs available; of these: 16359041 (32.62%) trimmed read pairs available after processing 33785169 (67.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 9 0.00% 20 7 0.00% 21 5 0.00% 22 6 0.00% 23 4 0.00% 24 7 0.00% 25 4 0.00% 26 7 0.00% 27 9 0.00% 28 7 0.00% 29 6 0.00% 30 21 0.00% 31 13 0.00% 32 20 0.00% 33 19 0.00% 34 14 0.00% 35 20 0.00% 36 19 0.00% 37 29 0.00% 38 24 0.00% 39 25 0.00% 40 39 0.00% 41 42 0.00% 42 47 0.00% 43 47 0.00% 44 69 0.00% 45 66 0.00% 46 74 0.00% 47 78 0.00% 48 99 0.00% 49 91 0.00% 50 104 0.00% 51 111 0.00% 52 140 0.00% 53 156 0.00% 54 163 0.00% 55 176 0.00% 56 200 0.00% 57 271 0.00% 58 254 0.00% 59 271 0.00% 60 368 0.00% 61 378 0.00% 62 446 0.00% 63 504 0.00% 64 529 0.00% 65 693 0.00% 66 712 0.00% 67 873 0.00% 68 976 0.00% 69 1706 0.00% 70 1505 0.00% 71 1307 0.00% 72 1453 0.00% 73 1578 0.00% 74 1815 0.00% 75 2080 0.00% 76 2316 0.00% 77 2493 0.00% 78 2794 0.01% 79 3158 0.01% 80 3524 0.01% 81 4142 0.01% 82 4828 0.01% 83 5941 0.01% 84 13012 0.03% 85 15416 0.03% 86 11380 0.02% 87 14706 0.03% 88 18706 0.04% 89 13068 0.03% 90 13415 0.03% 91 16481 0.03% 92 18548 0.04% 93 16568 0.03% 94 18756 0.04% 95 20386 0.04% 96 20970 0.04% 97 22868 0.05% 98 24199 0.05% 99 26016 0.05% 100 27318 0.05% 101 29170 0.06% 102 31490 0.06% 103 33653 0.07% 104 35973 0.07% 105 38153 0.08% 106 41474 0.08% 107 43510 0.09% 108 46794 0.09% 109 51958 0.10% 110 54028 0.11% 111 53104 0.11% 112 56108 0.11% 113 58716 0.12% 114 62541 0.12% 115 66129 0.13% 116 68838 0.14% 117 73238 0.15% 118 77139 0.15% 119 79675 0.16% 120 82498 0.16% 121 85814 0.17% 122 87362 0.17% 123 91127 0.18% 124 95894 0.19% 125 99482 0.20% 126 103703 0.21% 127 108811 0.22% 128 113099 0.23% 129 117616 0.23% 130 124169 0.25% 131 127579 0.25% 132 132608 0.26% 133 139372 0.28% 134 143819 0.29% 135 150933 0.30% 136 159373 0.32% 137 169539 0.34% 138 179563 0.36% 139 190902 0.38% 140 204331 0.41% 141 220579 0.44% 142 244210 0.49% 143 272686 0.54% 144 315215 0.63% 145 371539 0.74% 146 474422 0.95% 147 681245 1.36% 148 1289022 2.57% 149 8420131 16.79% 150 33785169 67.38% 50144210 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=40 prefix-density=0.16 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=287.45 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=31.3 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=30 prefix-density=0.23 prefix-fanout=2.9 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=277.96 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=28.0 sequence=GAAGAAGAAGAAA SRR4237627 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:01:40 Started mapping on | Feb 12 18:01:40 Finished on | Feb 12 18:06:10 Mapping speed, Million of reads per hour | 668.59 Number of input reads | 50144210 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 48603824 Uniquely mapped reads % | 96.93% Average mapped length | 294.12 Number of splices: Total | 46409493 Number of splices: Annotated (sjdb) | 45657298 Number of splices: GT/AG | 45711572 Number of splices: GC/AG | 550287 Number of splices: AT/AC | 43644 Number of splices: Non-canonical | 103990 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 984252 % of reads mapped to multiple loci | 1.96% Number of reads mapped to too many loci | 91502 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.89% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 595549 595549 595549 N_multimapping 984252 984252 984252 N_noFeature 1242264 48072956 1537849 N_ambiguous 437520 2685 200228 UnstrandedReadsAssigned:46924040 PositiveStrandReadsAssigned:528183 NegativeStrandReadsAssigned:46865747 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237627 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237627-trimmed-pair1.fastq SRR4237627-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 50,144,210 reads, 46,500,976 reads pseudoaligned [quant] estimated average fragment length: 243.549 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52401 SRR4237627.ke.tsv 34699 SRR4237627.se.tsv 87100 total ==> SRR4237627.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.45 1036 12.4159 Potri.005G024800.1.v4.1 1035 792.451 159 4.26927 Potri.004G059700.1.v4.1 961 718.51 39 1.15494 Potri.007G009000.2.v4.1 1416 1173.45 0 0 Potri.003G141000.2.v4.1 2943 2700.45 758.11 5.97343 Potri.016G087400.1.v4.1 270 78.3034 4658 1265.75 Potri.015G069301.1.v4.1 564 326.568 0 0 Potri.010G195200.1.v4.1 1773 1530.45 142 1.97423 Potri.012G127500.1.v4.1 977 734.487 20553 595.414 ==> SRR4237627.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3336 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 699 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR4237627 completed mapping pipeline successfully