Starting /dee2/code/volunteer_pipeline.sh SRR4237628 current disk space = 3051234738176 free memory = 1574804820 SRR4237628 SRAfilesize d115eee7012db04a4b2593a8bf6ce7cd SRR4237628.sra SRR4237628.sra file validated SRR4237628 is paired end SRR4237628 is conventional basespace SRR4237628 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237628_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2405 34.0 33.0 34.0 33.0 34.0 2 33.4535 34.0 33.0 34.0 33.0 34.0 3 33.439 34.0 34.0 34.0 33.0 34.0 4 33.33675 34.0 34.0 34.0 33.0 34.0 5 33.38 34.0 34.0 34.0 33.0 34.0 6 36.6455 38.0 37.0 38.0 34.0 38.0 7 37.359 38.0 38.0 38.0 37.0 38.0 8 37.37375 38.0 38.0 38.0 37.0 38.0 9 37.519 38.0 38.0 38.0 38.0 38.0 10-14 37.5436 38.0 38.0 38.0 38.0 38.0 15-19 37.534000000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.546499999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.4693 38.0 38.0 38.0 38.0 38.0 30-34 37.025999999999996 38.0 38.0 38.0 35.4 38.0 35-39 37.455650000000006 38.0 38.0 38.0 38.0 38.0 40-44 37.3545 38.0 38.0 38.0 37.2 38.0 45-49 37.35745 38.0 38.0 38.0 37.0 38.0 50-54 37.15075 38.0 38.0 38.0 36.8 38.0 55-59 37.1038 38.0 38.0 38.0 36.4 38.0 60-64 37.2112 38.0 38.0 38.0 36.8 38.0 65-69 37.1377 38.0 38.0 38.0 36.8 38.0 70-74 37.025850000000005 38.0 38.0 38.0 36.2 38.0 75-79 37.064 38.0 38.0 38.0 36.8 38.0 80-84 36.9329 38.0 38.0 38.0 36.0 38.0 85-89 36.906349999999996 38.0 38.0 38.0 36.2 38.0 90-94 36.880100000000006 38.0 38.0 38.0 36.0 38.0 95-99 36.855000000000004 38.0 38.0 38.0 36.0 38.0 100-104 36.7164 38.0 38.0 38.0 35.6 38.0 105-109 36.5869 38.0 38.0 38.0 34.8 38.0 110-114 36.48265 38.0 38.0 38.0 34.4 38.0 115-119 35.57885 38.0 36.6 38.0 29.0 38.0 120-124 36.442600000000006 38.0 38.0 38.0 34.6 38.0 125-129 36.2574 38.0 38.0 38.0 34.0 38.0 130-134 36.060050000000004 38.0 38.0 38.0 33.6 38.0 135-139 36.04345 38.0 38.0 38.0 33.8 38.0 140-144 35.835699999999996 38.0 38.0 38.0 33.0 38.0 145-149 34.1818 38.0 35.0 38.0 25.8 38.0 150 29.5885 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 2.0 10 1.0 11 0.0 12 2.0 13 4.0 14 1.0 15 1.0 16 2.0 17 4.0 18 4.0 19 6.0 20 1.0 21 2.0 22 2.0 23 6.0 24 6.0 25 8.0 26 12.0 27 12.0 28 22.0 29 26.0 30 41.0 31 52.0 32 47.0 33 66.0 34 106.0 35 153.0 36 458.0 37 2950.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.19548872180451 12.656641604010025 10.25062656641604 38.89724310776943 2 23.799999999999997 14.625 34.8 26.775 3 18.8 20.599999999999998 25.85 34.75 4 23.20580145036259 28.93223305826457 22.155538884721178 25.70642660665166 5 23.925 33.650000000000006 22.525000000000002 19.900000000000002 6 18.575 36.9 24.15 20.375 7 13.3 28.65 41.375 16.675 8 15.775 26.85 32.15 25.224999999999998 9 16.75 26.375 32.7 24.175 10-14 19.28 31.71 26.6 22.41 15-19 19.54 30.48 27.12 22.86 20-24 19.275000000000002 30.8 26.77 23.155 25-29 19.345000000000002 30.725 26.919999999999998 23.01 30-34 18.975 30.855 27.265 22.905 35-39 19.91 29.975 26.915 23.200000000000003 40-44 19.625 30.520000000000003 26.47 23.385 45-49 19.79 30.349999999999998 27.084999999999997 22.775000000000002 50-54 19.384999999999998 30.154999999999998 27.189999999999998 23.27 55-59 19.085 29.925 26.8 24.19 60-64 19.415 30.795 26.534999999999997 23.255 65-69 19.365 30.805 26.735 23.095 70-74 19.835 29.799999999999997 27.134999999999998 23.23 75-79 19.975 29.59 26.985 23.45 80-84 20.0 30.135 26.240000000000002 23.625 85-89 19.62 30.025000000000002 26.700000000000003 23.655 90-94 19.97 30.34 26.57 23.119999999999997 95-99 20.005 29.49 27.21 23.294999999999998 100-104 20.275000000000002 28.825 27.055 23.845 105-109 20.015 29.785 26.479999999999997 23.72 110-114 20.06 30.009999999999998 26.029999999999998 23.9 115-119 20.18 29.775000000000002 26.765 23.28 120-124 20.605 29.4 26.715 23.28 125-129 21.205 28.99 25.89 23.915 130-134 20.925 28.804999999999996 26.43 23.84 135-139 20.625 29.325000000000003 26.179999999999996 23.87 140-144 21.265 29.115000000000002 25.580000000000002 24.04 145-149 20.979999999999997 29.005 25.490000000000002 24.525 150 21.04733131923464 28.826787512588115 25.50352467270896 24.622356495468278 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.5 17 1.0 18 0.5 19 0.0 20 0.0 21 1.5 22 2.5 23 2.5 24 5.5 25 8.0 26 8.0 27 10.5 28 16.5 29 25.0 30 34.5 31 50.5 32 67.5 33 74.5 34 85.0 35 109.5 36 131.5 37 141.0 38 159.0 39 174.0 40 185.0 41 208.5 42 216.0 43 213.0 44 226.5 45 230.5 46 212.5 47 195.5 48 193.0 49 180.5 50 153.0 51 137.0 52 113.0 53 99.5 54 86.5 55 64.0 56 44.0 57 28.5 58 24.5 59 17.5 60 11.5 61 9.5 62 10.0 63 10.5 64 6.5 65 2.0 66 2.0 67 1.0 68 1.0 69 1.0 70 1.5 71 1.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.7000000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4438775510204 96.475 2 1.2244897959183674 2.4 3 0.28061224489795916 0.8250000000000001 4 0.025510204081632654 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025510204081632654 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGC 8 0.2 TruSeq Adapter, Index 1 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 1.1124999999999998 0.0 0.0 0.0 0.0 100-101 1.3375 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.775 0.0 0.0 0.0 0.0 106-107 2.0999999999999996 0.0 0.0 0.0 0.0 108-109 2.45 0.0 0.0 0.0 0.0 110-111 2.8125 0.0 0.0 0.0 0.0 112-113 3.05 0.0 0.0 0.0 0.0 114-115 3.575 0.0 0.0 0.0 0.0 116-117 3.9375 0.0 0.0 0.0 0.0 118-119 4.550000000000001 0.0 0.0 0.0 0.0 120-121 5.199999999999999 0.0 0.0 0.0 0.0 122-123 5.85 0.0 0.0 0.0 0.0 124-125 6.275 0.0 0.0 0.0 0.0 126-127 6.8 0.0 0.0 0.0 0.0 128-129 7.75 0.0 0.0 0.0 0.0 130-131 8.5 0.0 0.0 0.0 0.0 132-133 9.3 0.0 0.0 0.0 0.0 134-135 10.25 0.0 0.0 0.0 0.0 136-137 11.2375 0.0 0.0 0.0 0.0 138 11.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTGAA 10 0.006973645 144.0 5 >>END_MODULE SRR4237628 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237628_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.009 33.0 33.0 34.0 32.0 34.0 2 32.818 34.0 33.0 34.0 32.0 34.0 3 33.0375 34.0 33.0 34.0 32.0 34.0 4 33.01825 34.0 33.0 34.0 33.0 34.0 5 32.97225 34.0 33.0 34.0 32.0 34.0 6 37.20475 38.0 38.0 38.0 37.0 38.0 7 37.2835 38.0 38.0 38.0 37.0 38.0 8 37.202 38.0 38.0 38.0 37.0 38.0 9 37.17575 38.0 38.0 38.0 37.0 38.0 10-14 37.1935 38.0 38.0 38.0 37.0 38.0 15-19 37.219049999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.22835 38.0 38.0 38.0 37.0 38.0 25-29 37.20655 38.0 38.0 38.0 37.0 38.0 30-34 36.426300000000005 38.0 37.4 38.0 32.0 38.0 35-39 37.12820000000001 38.0 38.0 38.0 37.0 38.0 40-44 35.654300000000006 38.0 36.2 38.0 28.8 38.0 45-49 36.21655 38.0 37.0 38.0 31.2 38.0 50-54 36.6768 38.0 38.0 38.0 34.4 38.0 55-59 37.01535 38.0 38.0 38.0 36.6 38.0 60-64 37.0845 38.0 38.0 38.0 37.0 38.0 65-69 37.0526 38.0 38.0 38.0 37.0 38.0 70-74 36.93135 38.0 38.0 38.0 36.4 38.0 75-79 36.727599999999995 38.0 38.0 38.0 35.6 38.0 80-84 36.8187 38.0 38.0 38.0 36.2 38.0 85-89 36.8325 38.0 38.0 38.0 36.0 38.0 90-94 36.7894 38.0 38.0 38.0 36.0 38.0 95-99 36.786449999999995 38.0 38.0 38.0 36.0 38.0 100-104 36.6827 38.0 38.0 38.0 35.4 38.0 105-109 36.587900000000005 38.0 38.0 38.0 35.2 38.0 110-114 36.54705 38.0 38.0 38.0 35.0 38.0 115-119 36.47495 38.0 38.0 38.0 34.6 38.0 120-124 36.255700000000004 38.0 38.0 38.0 34.2 38.0 125-129 36.12724999999999 38.0 38.0 38.0 33.8 38.0 130-134 36.001 38.0 38.0 38.0 33.8 38.0 135-139 35.779650000000004 38.0 38.0 38.0 33.2 38.0 140-144 35.55265 38.0 38.0 38.0 32.4 38.0 145-149 35.22055 38.0 38.0 38.0 31.2 38.0 150 28.99475 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 3.0 11 1.0 12 2.0 13 1.0 14 1.0 15 2.0 16 1.0 17 8.0 18 4.0 19 5.0 20 5.0 21 2.0 22 9.0 23 7.0 24 15.0 25 13.0 26 13.0 27 14.0 28 24.0 29 35.0 30 39.0 31 38.0 32 52.0 33 73.0 34 102.0 35 156.0 36 438.0 37 2923.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.45 20.8 13.600000000000001 27.150000000000002 2 28.349999999999998 23.175 32.35 16.125 3 21.325 26.900000000000002 32.625 19.15 4 25.75 32.475 22.05 19.725 5 26.974999999999998 36.225 21.775 15.024999999999999 6 20.775 39.5 23.525 16.2 7 20.549999999999997 21.25 40.75 17.45 8 23.0 24.55 28.9 23.549999999999997 9 23.575 24.075 29.9 22.45 10-14 24.43 28.26 26.525 20.785 15-19 24.02 27.3 28.43 20.25 20-24 23.77 27.74 27.76 20.73 25-29 24.02 27.805000000000003 27.634999999999998 20.54 30-34 23.855 27.839999999999996 27.845 20.46 35-39 23.915 27.61 27.96 20.515 40-44 23.91 26.96 28.62 20.51 45-49 24.205 27.235 28.860000000000003 19.7 50-54 23.24 27.389999999999997 28.625 20.745 55-59 23.849999999999998 26.895000000000003 29.709999999999997 19.545 60-64 23.45 27.305 29.15 20.095 65-69 23.294999999999998 27.644999999999996 28.689999999999998 20.369999999999997 70-74 24.175 27.105 29.14 19.580000000000002 75-79 23.535 26.950000000000003 29.110000000000003 20.405 80-84 23.225 27.134999999999998 29.675 19.965 85-89 23.56 27.195000000000004 28.78 20.465 90-94 22.99 27.74 29.005 20.265 95-99 23.77 27.505000000000003 28.375 20.349999999999998 100-104 23.605 27.1 29.354999999999997 19.939999999999998 105-109 24.169999999999998 27.37 28.935 19.525000000000002 110-114 24.32 27.07 28.815 19.794999999999998 115-119 23.77 27.52 28.794999999999998 19.915 120-124 24.38 27.915 28.28 19.425 125-129 24.5 27.57 27.91 20.02 130-134 24.555 27.884999999999998 28.000000000000004 19.56 135-139 25.590000000000003 27.435 27.794999999999998 19.18 140-144 25.8 27.97 27.694999999999997 18.535 145-149 26.479999999999997 27.465 27.61 18.445 150 26.1 26.375 28.975 18.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 0.5 21 1.0 22 2.0 23 1.0 24 3.5 25 6.5 26 6.5 27 9.0 28 12.5 29 18.5 30 24.5 31 35.0 32 37.0 33 41.5 34 61.5 35 81.0 36 101.0 37 114.0 38 140.0 39 157.0 40 179.5 41 211.5 42 230.5 43 231.0 44 238.5 45 270.0 46 268.0 47 243.0 48 212.0 49 179.5 50 167.5 51 146.5 52 113.0 53 92.5 54 78.5 55 64.0 56 46.5 57 40.5 58 36.5 59 24.0 60 12.5 61 11.0 62 13.0 63 10.0 64 5.5 65 3.5 66 3.5 67 4.0 68 3.0 69 2.0 70 1.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98502918041106 97.52499999999999 2 0.659731032732809 1.3 3 0.25374270489723416 0.75 4 0.07612281146917026 0.3 5 0.025374270489723422 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.1124999999999998 0.0 0.0 0.0 0.0 100-101 1.3625 0.0 0.0 0.0 0.0 102-103 1.525 0.0 0.0 0.0 0.0 104-105 1.775 0.0 0.0 0.0 0.0 106-107 2.0999999999999996 0.0 0.0 0.0 0.0 108-109 2.4625000000000004 0.0 0.0 0.0 0.0 110-111 2.825 0.0 0.0 0.0 0.0 112-113 3.05 0.0 0.0 0.0 0.0 114-115 3.55 0.0 0.0 0.0 0.0 116-117 3.9125 0.0 0.0 0.0 0.0 118-119 4.550000000000001 0.0 0.0 0.0 0.0 120-121 5.199999999999999 0.0 0.0 0.0 0.0 122-123 5.85 0.0 0.0 0.0 0.0 124-125 6.275 0.0 0.0 0.0 0.0 126-127 6.775 0.0 0.0 0.0 0.0 128-129 7.75 0.0 0.0 0.0 0.0 130-131 8.45 0.0 0.0 0.0 0.0 132-133 9.25 0.0 0.0 0.0 0.0 134-135 10.25 0.0 0.0 0.0 0.0 136-137 11.2875 0.0 0.0 0.0 0.0 138 11.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTACAA 10 0.006973645 144.0 3 >>END_MODULE Read 2063376 spots for SRR4237628.sra Written 2063376 spots for SRR4237628.sra Read 2063376 spots for SRR4237628.sra Written 2063376 spots for SRR4237628.sra Read 2063376 spots for SRR4237628.sra Written 2063376 spots for SRR4237628.sra Read 2063376 spots for SRR4237628.sra Written 2063376 spots for SRR4237628.sra Read 2063376 spots for SRR4237628.sra Written 2063376 spots for SRR4237628.sra Read 2063376 spots for SRR4237628.sra Written 2063376 spots for SRR4237628.sra Read 2063376 spots for SRR4237628.sra Written 2063376 spots for SRR4237628.sra Read 2063376 spots for SRR4237628.sra Written 2063376 spots for SRR4237628.sra Read 2063376 spots for SRR4237628.sra Written 2063376 spots for SRR4237628.sra Read 2063376 spots for SRR4237628.sra Written 2063376 spots for SRR4237628.sra Read 2063393 spots for SRR4237628.sra Written 2063393 spots for SRR4237628.sra Read 2063376 spots for SRR4237628.sra Written 2063376 spots for SRR4237628.sra Read 2063376 spots for SRR4237628.sra Written 2063376 spots for SRR4237628.sra Read 2063376 spots for SRR4237628.sra Written 2063376 spots for SRR4237628.sra Read 2063376 spots for SRR4237628.sra Written 2063376 spots for SRR4237628.sra Read 2063376 spots for SRR4237628.sra Written 2063376 spots for SRR4237628.sra Read 2063376 spots for SRR4237628.sra Written 2063376 spots for SRR4237628.sra Read 2063376 spots for SRR4237628.sra Written 2063376 spots for SRR4237628.sra Read 2063376 spots for SRR4237628.sra Written 2063376 spots for SRR4237628.sra Read 2063376 spots for SRR4237628.sra Written 2063376 spots for SRR4237628.sra SRR ids: ['SRR4237628.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hc45gtut SRR4237628.sra spots: 41267537 blocks: [[1, 2063376], [2063377, 4126752], [4126753, 6190128], [6190129, 8253504], [8253505, 10316880], [10316881, 12380256], [12380257, 14443632], [14443633, 16507008], [16507009, 18570384], [18570385, 20633760], [20633761, 22697136], [22697137, 24760512], [24760513, 26823888], [26823889, 28887264], [28887265, 30950640], [30950641, 33014016], [33014017, 35077392], [35077393, 37140768], [37140769, 39204144], [39204145, 41267537]] SRR4237628 file size 13881913 SRR4237628 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237628 SRR4237628_1.fastq SRR4237628_2.fastq Input file: SRR4237628_1.fastq Paired file: SRR4237628_2.fastq trimmed: SRR4237628-trimmed-pair1.fastq, SRR4237628-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:41:43 2025 >> started Wed Feb 12 18:42:29 2025 >> done (45.750s) 41267537 read pairs processed; of these: 66359 ( 0.16%) short read pairs filtered out after trimming by size control 98424 ( 0.24%) empty read pairs filtered out after trimming by size control 41102754 (99.60%) read pairs available; of these: 15480479 (37.66%) trimmed read pairs available after processing 25622275 (62.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 13 0.00% 20 24 0.00% 21 10 0.00% 22 14 0.00% 23 28 0.00% 24 18 0.00% 25 28 0.00% 26 22 0.00% 27 22 0.00% 28 21 0.00% 29 30 0.00% 30 28 0.00% 31 51 0.00% 32 41 0.00% 33 33 0.00% 34 39 0.00% 35 85 0.00% 36 59 0.00% 37 48 0.00% 38 46 0.00% 39 64 0.00% 40 61 0.00% 41 73 0.00% 42 72 0.00% 43 101 0.00% 44 121 0.00% 45 140 0.00% 46 157 0.00% 47 161 0.00% 48 188 0.00% 49 243 0.00% 50 214 0.00% 51 266 0.00% 52 295 0.00% 53 338 0.00% 54 370 0.00% 55 374 0.00% 56 446 0.00% 57 504 0.00% 58 576 0.00% 59 608 0.00% 60 791 0.00% 61 813 0.00% 62 946 0.00% 63 980 0.00% 64 1168 0.00% 65 1673 0.00% 66 1684 0.00% 67 2146 0.01% 68 3303 0.01% 69 15246 0.04% 70 14087 0.03% 71 4260 0.01% 72 3713 0.01% 73 3696 0.01% 74 4225 0.01% 75 4563 0.01% 76 5248 0.01% 77 5828 0.01% 78 6256 0.02% 79 6865 0.02% 80 7738 0.02% 81 8740 0.02% 82 9967 0.02% 83 11929 0.03% 84 19266 0.05% 85 19178 0.05% 86 19920 0.05% 87 21766 0.05% 88 24527 0.06% 89 25800 0.06% 90 25772 0.06% 91 27501 0.07% 92 32368 0.08% 93 33722 0.08% 94 36869 0.09% 95 38684 0.09% 96 42018 0.10% 97 44202 0.11% 98 46580 0.11% 99 50122 0.12% 100 53519 0.13% 101 55602 0.14% 102 60775 0.15% 103 64428 0.16% 104 69462 0.17% 105 73841 0.18% 106 79052 0.19% 107 82832 0.20% 108 87986 0.21% 109 89751 0.22% 110 91910 0.22% 111 97245 0.24% 112 100604 0.24% 113 105773 0.26% 114 113038 0.28% 115 119176 0.29% 116 123627 0.30% 117 127224 0.31% 118 131049 0.32% 119 131869 0.32% 120 135102 0.33% 121 137860 0.34% 122 143081 0.35% 123 148025 0.36% 124 152959 0.37% 125 159019 0.39% 126 165608 0.40% 127 170172 0.41% 128 174736 0.43% 129 177186 0.43% 130 180610 0.44% 131 183422 0.45% 132 187414 0.46% 133 191691 0.47% 134 196433 0.48% 135 203054 0.49% 136 210958 0.51% 137 218305 0.53% 138 226766 0.55% 139 233825 0.57% 140 243509 0.59% 141 251726 0.61% 142 265745 0.65% 143 279810 0.68% 144 301718 0.73% 145 347481 0.85% 146 416255 1.01% 147 585968 1.43% 148 896987 2.18% 149 5796090 14.10% 150 25622275 62.34% 41102754 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.78 fanout-score-rank=31 prefix-density=0.18 prefix-fanout=2.9 sequence=GGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=312.74 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=19.8 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=5.52 fanout-score-rank=18 prefix-density=0.21 prefix-fanout=4.1 sequence=CAGCACCAGCACCTGAAAAGCCAAAGAAGAGATCCAAAGCTGCAGCGAGTCCAGAATCTCCTGCGGATACTTCTGGGGCAGTAAGCTTTACTGTTCTGAACAATGTTGTGTTCTTTGGAGTTTGCATGGTTGCAGCAATATATTCTTTGTGACACAGAAGGTTTTGATGAGGTTATTGCATGGATTGCTCTCGTTTTTTTAAGTGGGCTATGATTTTGTAGAGTCGGATCGAATCCAATGATTTGTGTGAATAATTGTTGTTATGGTCTCATTGTACCATTCAAGTTTATGCTTAAGATTGAATT criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=76.82 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=11.6 sequence=TGGTGCTGGTGTAGTGAAGGGTCTCCAAGGAAGCCACAACTACGAGCTTCAGGGTGGCGGAGCTAATGTTGTGAATCATGGATACACCAAGGGTGATGGCCTTGGTGCGGAGATAGTCGGTACCTTTGTTCTTGTCTACACTGTCTTCTCTGCTACTGATGCCAAGAGAAACGCTAGAGACTCTCATGTCCCTATTTTGGCTCCCCTTCCCATTGGATTTGCAGTCTTCTTGGTTCATTTGGCTACCATCCCCATAACTGGAACTGGCATTAACCCGGCAAGGAGTCTTGGAGCCGCCATCATCTTCAACAAAGACCATGCATGGGATGACCACTGGATCTTCTGGGTTGGCCCATTCATTGGAGCTGCTCTTGCCGCTGTCTACCACCAGATAGTCATTAGAGCCATTCCTTTCAAGAGCAGAGCTTAATTTCGTTCGCCCTTTCAAGAATCACACCATCTCACAACTTCTTCTATCCTTGTTTGAACTTTGGCTTCTCTATCTATCATA SRR4237628 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:43:22 Started mapping on | Feb 12 18:43:22 Finished on | Feb 12 18:54:36 Mapping speed, Million of reads per hour | 219.54 Number of input reads | 41102754 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 35111477 Uniquely mapped reads % | 85.42% Average mapped length | 289.28 Number of splices: Total | 24217862 Number of splices: Annotated (sjdb) | 23693717 Number of splices: GT/AG | 23815791 Number of splices: GC/AG | 281465 Number of splices: AT/AC | 27101 Number of splices: Non-canonical | 93505 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.61 Insertion rate per base | 0.03% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 783101 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 327241 % of reads mapped to too many loci | 0.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.76% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5235206 5235206 5235206 N_multimapping 783101 783101 783101 N_noFeature 1031091 34521567 1321580 N_ambiguous 451896 2865 150502 UnstrandedReadsAssigned:33628490 PositiveStrandReadsAssigned:587045 NegativeStrandReadsAssigned:33639395 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=148 echo kmer=143 SRR4237628 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237628-trimmed-pair1.fastq SRR4237628-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,102,754 reads, 33,858,355 reads pseudoaligned [quant] estimated average fragment length: 207.058 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR4237628.ke.tsv 34699 SRR4237628.se.tsv 87100 total ==> SRR4237628.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1811.94 777 12.7012 Potri.005G024800.1.v4.1 1035 828.942 107 3.82322 Potri.004G059700.1.v4.1 961 754.966 52 2.04007 Potri.007G009000.2.v4.1 1416 1209.94 0 0 Potri.003G141000.2.v4.1 2943 2736.94 435.13 4.70894 Potri.016G087400.1.v4.1 270 93.4436 4358 1381.36 Potri.015G069301.1.v4.1 564 360.116 0 0 Potri.010G195200.1.v4.1 1773 1566.94 233 4.40426 Potri.012G127500.1.v4.1 977 770.961 5792 222.518 ==> SRR4237628.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4466 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 494 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 33 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR4237628 completed mapping pipeline successfully