Starting /dee2/code/volunteer_pipeline.sh SRR4237629 current disk space = 3051178164224 free memory = 1572278280 SRR4237629 SRAfilesize 9e6d9d223bee8f6babdbf82d6d999c13 SRR4237629.sra SRR4237629.sra file validated SRR4237629 is paired end SRR4237629 is conventional basespace SRR4237629 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237629_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.343 34.0 33.0 34.0 33.0 34.0 2 33.40925 34.0 33.0 34.0 33.0 34.0 3 33.45125 34.0 34.0 34.0 33.0 34.0 4 33.42975 34.0 34.0 34.0 33.0 34.0 5 33.40125 34.0 34.0 34.0 33.0 34.0 6 35.8385 38.0 37.0 38.0 34.0 38.0 7 37.1345 38.0 38.0 38.0 36.0 38.0 8 37.14775 38.0 38.0 38.0 36.0 38.0 9 37.42175 38.0 38.0 38.0 37.0 38.0 10-14 37.503049999999995 38.0 38.0 38.0 37.8 38.0 15-19 37.4859 38.0 38.0 38.0 38.0 38.0 20-24 37.432 38.0 38.0 38.0 37.6 38.0 25-29 37.485699999999994 38.0 38.0 38.0 38.0 38.0 30-34 36.81679999999999 38.0 38.0 38.0 35.2 38.0 35-39 37.4034 38.0 38.0 38.0 37.2 38.0 40-44 37.380250000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.1881 38.0 38.0 38.0 36.6 38.0 50-54 37.23365 38.0 38.0 38.0 36.8 38.0 55-59 37.2329 38.0 38.0 38.0 37.0 38.0 60-64 37.19584999999999 38.0 38.0 38.0 36.6 38.0 65-69 37.1588 38.0 38.0 38.0 36.6 38.0 70-74 37.0885 38.0 38.0 38.0 36.2 38.0 75-79 37.05030000000001 38.0 38.0 38.0 36.0 38.0 80-84 37.01664999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.96595 38.0 38.0 38.0 35.8 38.0 90-94 35.74275 38.0 35.8 38.0 30.2 38.0 95-99 36.6945 38.0 37.8 38.0 35.0 38.0 100-104 36.8759 38.0 38.0 38.0 35.8 38.0 105-109 36.8574 38.0 38.0 38.0 35.6 38.0 110-114 36.7722 38.0 38.0 38.0 35.2 38.0 115-119 36.5989 38.0 38.0 38.0 34.8 38.0 120-124 36.539500000000004 38.0 38.0 38.0 34.4 38.0 125-129 36.386700000000005 38.0 38.0 38.0 34.0 38.0 130-134 36.312200000000004 38.0 38.0 38.0 34.0 38.0 135-139 34.8654 38.0 35.2 38.0 27.4 38.0 140-144 35.91055 38.0 37.4 38.0 33.0 38.0 145-149 35.77895 38.0 38.0 38.0 33.0 38.0 150 30.77425 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 1.0 15 0.0 16 2.0 17 1.0 18 2.0 19 2.0 20 2.0 21 3.0 22 1.0 23 6.0 24 4.0 25 9.0 26 11.0 27 23.0 28 26.0 29 24.0 30 43.0 31 27.0 32 55.0 33 77.0 34 102.0 35 191.0 36 486.0 37 2897.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.45 12.975 9.15 38.425 2 22.85571392848212 16.029007251812956 36.03400850212553 25.081270317579396 3 19.2 20.0 27.625 33.175 4 22.125 29.925 22.8 25.15 5 21.099999999999998 34.65 25.1 19.15 6 16.40826873385013 36.51162790697675 25.142118863049095 21.93798449612403 7 13.825000000000001 26.1 42.225 17.849999999999998 8 17.299999999999997 23.849999999999998 33.175 25.674999999999997 9 17.299999999999997 23.400000000000002 34.375 24.925 10-14 20.080000000000002 29.975 26.465 23.48 15-19 19.56 28.410000000000004 28.205000000000002 23.825 20-24 20.61 28.67 27.165 23.555 25-29 19.295 28.694999999999997 27.97 24.04 30-34 19.72 28.634999999999998 27.935 23.71 35-39 20.125 28.970000000000002 27.43 23.474999999999998 40-44 19.695 28.92 27.37 24.015 45-49 19.950000000000003 28.42 27.775 23.855 50-54 19.66 29.555 27.150000000000002 23.635 55-59 20.195 29.26 26.674999999999997 23.87 60-64 20.02 28.48 27.305 24.195 65-69 20.705000000000002 28.7 27.655 22.939999999999998 70-74 20.21 29.315 27.02 23.455000000000002 75-79 19.945 28.37 27.725 23.96 80-84 19.725 28.565 27.82 23.89 85-89 20.415 28.57 27.025 23.990000000000002 90-94 20.0 28.78 27.915 23.305 95-99 19.99 28.565 27.67 23.775 100-104 20.169999999999998 29.189999999999998 27.115000000000002 23.525 105-109 20.29 28.48 27.384999999999998 23.845 110-114 19.86 28.935 27.384999999999998 23.82 115-119 20.165 28.62 27.500000000000004 23.715 120-124 20.52 28.93 26.790000000000003 23.76 125-129 20.849999999999998 29.285 26.534999999999997 23.330000000000002 130-134 21.29 28.025 27.01 23.674999999999997 135-139 20.45 28.025 27.634999999999998 23.89 140-144 20.62 28.655 26.950000000000003 23.775 145-149 20.86 28.815 26.484999999999996 23.84 150 21.113340020060182 28.159478435305918 26.705115346038117 24.022066198595788 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.5 25 3.5 26 7.5 27 10.5 28 11.5 29 10.5 30 11.0 31 22.0 32 36.5 33 48.5 34 60.5 35 69.5 36 84.5 37 102.5 38 125.5 39 157.0 40 193.0 41 224.0 42 242.5 43 256.5 44 268.0 45 281.0 46 280.0 47 272.5 48 244.0 49 200.0 50 170.5 51 141.5 52 114.0 53 80.5 54 60.0 55 50.0 56 38.0 57 33.5 58 22.0 59 11.5 60 8.0 61 7.5 62 8.0 63 6.0 64 5.0 65 4.0 66 3.0 67 1.5 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 3.25 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.38749999999999996 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.2374999999999998 0.0 0.0 0.0 0.0 116-117 1.4375 0.0 0.0 0.0 0.0 118-119 1.6124999999999998 0.0 0.0 0.0 0.0 120-121 1.9375 0.0 0.0 0.0 0.0 122-123 2.075 0.0 0.0 0.0 0.0 124-125 2.3499999999999996 0.0 0.0 0.0 0.0 126-127 2.6624999999999996 0.0 0.0 0.0 0.0 128-129 3.0 0.0 0.0 0.0 0.0 130-131 3.2875 0.0 0.0 0.0 0.0 132-133 3.75 0.0 0.0 0.0 0.0 134-135 4.1625 0.0 0.0 0.0 0.0 136-137 4.7125 0.0 0.0 0.0 0.0 138 5.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGCACC 10 0.0062404233 149.37663 5 >>END_MODULE SRR4237629 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237629_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.58175 33.0 33.0 34.0 32.0 34.0 2 30.7715 33.0 32.0 34.0 18.0 34.0 3 32.33825 33.0 33.0 34.0 28.0 34.0 4 32.58725 33.0 33.0 34.0 32.0 34.0 5 32.7865 33.0 33.0 34.0 32.0 34.0 6 36.9955 38.0 38.0 38.0 36.0 38.0 7 37.08875 38.0 38.0 38.0 37.0 38.0 8 37.1115 38.0 38.0 38.0 37.0 38.0 9 37.15325 38.0 38.0 38.0 37.0 38.0 10-14 37.06475 38.0 38.0 38.0 36.8 38.0 15-19 37.03484999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.047399999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.04705 38.0 38.0 38.0 37.0 38.0 30-34 37.05094999999999 38.0 38.0 38.0 37.0 38.0 35-39 36.993199999999995 38.0 38.0 38.0 37.0 38.0 40-44 36.9961 38.0 38.0 38.0 36.8 38.0 45-49 37.02759999999999 38.0 38.0 38.0 37.0 38.0 50-54 36.88695 38.0 38.0 38.0 36.0 38.0 55-59 36.89335 38.0 38.0 38.0 36.2 38.0 60-64 36.91225 38.0 38.0 38.0 36.4 38.0 65-69 36.84385 38.0 38.0 38.0 36.0 38.0 70-74 36.59995 38.0 37.8 38.0 34.6 38.0 75-79 36.750099999999996 38.0 38.0 38.0 35.6 38.0 80-84 36.575300000000006 38.0 38.0 38.0 35.2 38.0 85-89 35.41185 38.0 36.6 38.0 28.2 38.0 90-94 35.8702 38.0 37.6 38.0 31.0 38.0 95-99 36.36035 38.0 38.0 38.0 34.4 38.0 100-104 36.52525 38.0 38.0 38.0 35.0 38.0 105-109 36.4062 38.0 38.0 38.0 34.6 38.0 110-114 36.32555 38.0 38.0 38.0 34.2 38.0 115-119 36.29305 38.0 38.0 38.0 34.2 38.0 120-124 36.27335000000001 38.0 38.0 38.0 34.0 38.0 125-129 36.009750000000004 38.0 38.0 38.0 33.8 38.0 130-134 35.98025 38.0 38.0 38.0 33.4 38.0 135-139 35.625350000000005 38.0 38.0 38.0 32.4 38.0 140-144 35.334450000000004 38.0 37.8 38.0 31.0 38.0 145-149 34.954449999999994 38.0 37.6 38.0 31.0 38.0 150 28.07975 33.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 1.0 5 1.0 6 3.0 7 3.0 8 0.0 9 1.0 10 1.0 11 3.0 12 3.0 13 7.0 14 2.0 15 0.0 16 4.0 17 5.0 18 5.0 19 4.0 20 8.0 21 7.0 22 5.0 23 7.0 24 10.0 25 12.0 26 23.0 27 18.0 28 26.0 29 38.0 30 27.0 31 41.0 32 67.0 33 74.0 34 112.0 35 151.0 36 441.0 37 2879.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.6 20.45 13.175 25.775 2 28.475 24.65 33.0 13.875000000000002 3 21.3 28.025 31.5 19.175 4 23.525 35.3 23.175 18.0 5 24.474999999999998 38.975 21.349999999999998 15.2 6 19.275000000000002 40.050000000000004 23.325000000000003 17.349999999999998 7 20.225 20.674999999999997 39.35 19.75 8 22.5 24.625 29.049999999999997 23.825 9 22.8 24.925 29.7 22.575 10-14 23.935000000000002 28.89 26.405 20.77 15-19 23.43 27.67 28.144999999999996 20.755000000000003 20-24 23.16 28.470000000000002 28.244999999999997 20.125 25-29 23.595 27.889999999999997 28.084999999999997 20.43 30-34 23.125 28.294999999999998 28.555000000000003 20.025000000000002 35-39 23.155 27.875 28.33 20.64 40-44 23.56 27.685 28.24 20.515 45-49 23.005 27.694999999999997 28.660000000000004 20.64 50-54 23.25 27.725 28.244999999999997 20.78 55-59 23.64 27.725 27.96 20.674999999999997 60-64 22.795 27.54 28.499999999999996 21.165 65-69 23.225 27.884999999999998 28.294999999999998 20.595 70-74 23.95 27.785 28.28 19.985 75-79 23.169999999999998 27.534999999999997 28.895 20.4 80-84 23.875 27.305 28.384999999999998 20.435 85-89 23.41 27.735 28.384999999999998 20.47 90-94 23.68 27.229999999999997 28.62 20.47 95-99 23.595 27.46 28.765 20.18 100-104 23.865 28.58 27.500000000000004 20.055 105-109 23.69 27.62 28.395 20.294999999999998 110-114 23.435 28.794999999999998 27.485 20.285 115-119 24.404999999999998 27.47 28.249999999999996 19.875 120-124 23.97 27.725 27.845 20.46 125-129 24.21 27.49 27.87 20.43 130-134 24.365000000000002 28.03 27.83 19.775000000000002 135-139 24.69 27.57 27.700000000000003 20.04 140-144 24.43 27.805000000000003 27.425 20.34 145-149 25.27 28.08 27.339999999999996 19.31 150 24.05 28.125 28.249999999999996 19.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.0 23 1.5 24 2.0 25 2.5 26 3.0 27 7.0 28 9.0 29 11.0 30 14.0 31 21.0 32 28.5 33 31.5 34 49.0 35 59.0 36 78.0 37 114.0 38 147.5 39 178.0 40 204.0 41 247.5 42 262.5 43 259.5 44 271.0 45 276.5 46 279.5 47 267.0 48 232.0 49 201.0 50 171.0 51 129.0 52 110.0 53 89.0 54 54.0 55 44.5 56 43.0 57 27.5 58 15.5 59 13.5 60 9.0 61 5.5 62 5.5 63 4.5 64 4.5 65 4.5 66 3.0 67 1.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.38749999999999996 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.5875 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 1.0750000000000002 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.3875 0.0 0.0 0.0 0.0 118-119 1.575 0.0 0.0 0.0 0.0 120-121 1.8875000000000002 0.0 0.0 0.0 0.0 122-123 2.0250000000000004 0.0 0.0 0.0 0.0 124-125 2.2750000000000004 0.0 0.0 0.0 0.0 126-127 2.5875000000000004 0.0 0.0 0.0 0.0 128-129 2.9375 0.0 0.0 0.0 0.0 130-131 3.2375 0.0 0.0 0.0 0.0 132-133 3.6875 0.0 0.0 0.0 0.0 134-135 4.05 0.0 0.0 0.0 0.0 136-137 4.5875 0.0 0.0 0.0 0.0 138 4.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCCAG 10 0.006973645 144.0 8 GGAGGAT 10 0.006973645 144.0 1 >>END_MODULE Read 2692627 spots for SRR4237629.sra Written 2692627 spots for SRR4237629.sra Read 2692627 spots for SRR4237629.sra Written 2692627 spots for SRR4237629.sra Read 2692627 spots for SRR4237629.sra Written 2692627 spots for SRR4237629.sra Read 2692627 spots for SRR4237629.sra Written 2692627 spots for SRR4237629.sra Read 2692627 spots for SRR4237629.sra Written 2692627 spots for SRR4237629.sra Read 2692627 spots for SRR4237629.sra Written 2692627 spots for SRR4237629.sra Read 2692627 spots for SRR4237629.sra Written 2692627 spots for SRR4237629.sra Read 2692627 spots for SRR4237629.sra Written 2692627 spots for SRR4237629.sra Read 2692627 spots for SRR4237629.sra Written 2692627 spots for SRR4237629.sra Read 2692627 spots for SRR4237629.sra Written 2692627 spots for SRR4237629.sra Read 2692638 spots for SRR4237629.sra Written 2692638 spots for SRR4237629.sra Read 2692627 spots for SRR4237629.sra Written 2692627 spots for SRR4237629.sra Read 2692627 spots for SRR4237629.sra Written 2692627 spots for SRR4237629.sra Read 2692627 spots for SRR4237629.sra Written 2692627 spots for SRR4237629.sra Read 2692627 spots for SRR4237629.sra Written 2692627 spots for SRR4237629.sra Read 2692627 spots for SRR4237629.sra Written 2692627 spots for SRR4237629.sra Read 2692627 spots for SRR4237629.sra Written 2692627 spots for SRR4237629.sra Read 2692627 spots for SRR4237629.sra Written 2692627 spots for SRR4237629.sra Read 2692627 spots for SRR4237629.sra Written 2692627 spots for SRR4237629.sra Read 2692627 spots for SRR4237629.sra Written 2692627 spots for SRR4237629.sra SRR ids: ['SRR4237629.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_29vnhpe3 SRR4237629.sra spots: 53852551 blocks: [[1, 2692627], [2692628, 5385254], [5385255, 8077881], [8077882, 10770508], [10770509, 13463135], [13463136, 16155762], [16155763, 18848389], [18848390, 21541016], [21541017, 24233643], [24233644, 26926270], [26926271, 29618897], [29618898, 32311524], [32311525, 35004151], [35004152, 37696778], [37696779, 40389405], [40389406, 43082032], [43082033, 45774659], [45774660, 48467286], [48467287, 51159913], [51159914, 53852551]] SRR4237629 file size 18121981 SRR4237629 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237629 SRR4237629_1.fastq SRR4237629_2.fastq Input file: SRR4237629_1.fastq Paired file: SRR4237629_2.fastq trimmed: SRR4237629-trimmed-pair1.fastq, SRR4237629-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:02:03 2025 >> started Wed Feb 12 19:03:01 2025 >> done (58.129s) 53852551 read pairs processed; of these: 78876 ( 0.15%) short read pairs filtered out after trimming by size control 25590 ( 0.05%) empty read pairs filtered out after trimming by size control 53748085 (99.81%) read pairs available; of these: 16440591 (30.59%) trimmed read pairs available after processing 37307494 (69.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 14 0.00% 20 12 0.00% 21 11 0.00% 22 10 0.00% 23 14 0.00% 24 7 0.00% 25 5 0.00% 26 18 0.00% 27 10 0.00% 28 12 0.00% 29 12 0.00% 30 21 0.00% 31 15 0.00% 32 19 0.00% 33 20 0.00% 34 30 0.00% 35 30 0.00% 36 30 0.00% 37 35 0.00% 38 32 0.00% 39 33 0.00% 40 62 0.00% 41 70 0.00% 42 47 0.00% 43 55 0.00% 44 67 0.00% 45 92 0.00% 46 76 0.00% 47 102 0.00% 48 99 0.00% 49 107 0.00% 50 146 0.00% 51 145 0.00% 52 170 0.00% 53 164 0.00% 54 189 0.00% 55 218 0.00% 56 253 0.00% 57 260 0.00% 58 332 0.00% 59 357 0.00% 60 424 0.00% 61 473 0.00% 62 482 0.00% 63 533 0.00% 64 622 0.00% 65 693 0.00% 66 845 0.00% 67 955 0.00% 68 1484 0.00% 69 3104 0.01% 70 2246 0.00% 71 1534 0.00% 72 1593 0.00% 73 1773 0.00% 74 2001 0.00% 75 2344 0.00% 76 2443 0.00% 77 2814 0.01% 78 3113 0.01% 79 3496 0.01% 80 3831 0.01% 81 4435 0.01% 82 5107 0.01% 83 6535 0.01% 84 18455 0.03% 85 14380 0.03% 86 11568 0.02% 87 12329 0.02% 88 15717 0.03% 89 15429 0.03% 90 14430 0.03% 91 21508 0.04% 92 16919 0.03% 93 18812 0.04% 94 22193 0.04% 95 22093 0.04% 96 24156 0.04% 97 25071 0.05% 98 26080 0.05% 99 27989 0.05% 100 29873 0.06% 101 32221 0.06% 102 34551 0.06% 103 37404 0.07% 104 40001 0.07% 105 42999 0.08% 106 45333 0.08% 107 48366 0.09% 108 51168 0.10% 109 52718 0.10% 110 55287 0.10% 111 59408 0.11% 112 62587 0.12% 113 65488 0.12% 114 69475 0.13% 115 72943 0.14% 116 76032 0.14% 117 79694 0.15% 118 83281 0.15% 119 87051 0.16% 120 91573 0.17% 121 92936 0.17% 122 95652 0.18% 123 102044 0.19% 124 106843 0.20% 125 109317 0.20% 126 113540 0.21% 127 118024 0.22% 128 122772 0.23% 129 127277 0.24% 130 131468 0.24% 131 136005 0.25% 132 141384 0.26% 133 147413 0.27% 134 153108 0.28% 135 160381 0.30% 136 168311 0.31% 137 176985 0.33% 138 187210 0.35% 139 196053 0.36% 140 207373 0.39% 141 223755 0.42% 142 241816 0.45% 143 265517 0.49% 144 301688 0.56% 145 356912 0.66% 146 452215 0.84% 147 615876 1.15% 148 1138966 2.12% 149 8468879 15.76% 150 37307494 69.41% 53748085 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=13.43 fanout-score-rank=9 prefix-density=0.29 prefix-fanout=6.8 sequence=CAACCTCAACAGTGGCCATTGGAACTAGAAGGAAAATAAAGCACAGCTGGGATACAAAAGAAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=266.98 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=29.6 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=38 prefix-density=0.21 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=281.05 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=28.3 sequence=AAGAAGAAGAAG SRR4237629 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:03:44 Started mapping on | Feb 12 19:03:44 Finished on | Feb 12 19:08:16 Mapping speed, Million of reads per hour | 711.37 Number of input reads | 53748085 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 51895614 Uniquely mapped reads % | 96.55% Average mapped length | 294.07 Number of splices: Total | 50640182 Number of splices: Annotated (sjdb) | 49807666 Number of splices: GT/AG | 49881549 Number of splices: GC/AG | 604710 Number of splices: AT/AC | 45056 Number of splices: Non-canonical | 108867 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1034341 % of reads mapped to multiple loci | 1.92% Number of reads mapped to too many loci | 39914 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.43% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 861334 861334 861334 N_multimapping 1034341 1034341 1034341 N_noFeature 1301767 51380409 1579957 N_ambiguous 445375 2977 206113 UnstrandedReadsAssigned:50148472 PositiveStrandReadsAssigned:512228 NegativeStrandReadsAssigned:50109544 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237629 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237629-trimmed-pair1.fastq SRR4237629-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 53,748,085 reads, 49,718,919 reads pseudoaligned [quant] estimated average fragment length: 240.266 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,238 rounds 52401 SRR4237629.ke.tsv 34699 SRR4237629.se.tsv 87100 total ==> SRR4237629.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.73 1376 15.9231 Potri.005G024800.1.v4.1 1035 795.734 116 3.00061 Potri.004G059700.1.v4.1 961 721.778 44 1.25478 Potri.007G009000.2.v4.1 1416 1176.73 0 0 Potri.003G141000.2.v4.1 2943 2703.73 980.188 7.46218 Potri.016G087400.1.v4.1 270 79.4589 5475 1418.28 Potri.015G069301.1.v4.1 564 329.13 0 0 Potri.010G195200.1.v4.1 1773 1533.73 68 0.912597 Potri.012G127500.1.v4.1 977 737.764 18439 514.446 ==> SRR4237629.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4401 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 847 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 31 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR4237629 completed mapping pipeline successfully