Starting /dee2/code/volunteer_pipeline.sh SRR4237630 current disk space = 3051498885120 free memory = 1485810296 SRR4237630 SRAfilesize d6aafd46181c2095e11465bfb23a0f5d SRR4237630.sra SRR4237630.sra file validated SRR4237630 is paired end SRR4237630 is conventional basespace SRR4237630 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237630_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.25975 34.0 33.0 34.0 33.0 34.0 2 33.28125 34.0 33.0 34.0 32.0 34.0 3 33.3405 34.0 33.0 34.0 33.0 34.0 4 33.4015 34.0 33.0 34.0 33.0 34.0 5 33.34975 34.0 33.0 34.0 33.0 34.0 6 34.42225 38.0 37.0 38.0 29.0 38.0 7 36.6815 38.0 38.0 38.0 31.0 38.0 8 36.7985 38.0 38.0 38.0 33.0 38.0 9 37.265 38.0 38.0 38.0 37.0 38.0 10-14 37.38715 38.0 38.0 38.0 37.0 38.0 15-19 37.414500000000004 38.0 38.0 38.0 37.2 38.0 20-24 37.32084999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.3789 38.0 38.0 38.0 37.0 38.0 30-34 37.3942 38.0 38.0 38.0 37.0 38.0 35-39 37.1374 38.0 38.0 38.0 36.2 38.0 40-44 37.24395 38.0 38.0 38.0 37.0 38.0 45-49 37.01219999999999 38.0 38.0 38.0 35.8 38.0 50-54 37.186699999999995 38.0 38.0 38.0 36.2 38.0 55-59 37.13065 38.0 38.0 38.0 36.4 38.0 60-64 37.0788 38.0 38.0 38.0 36.0 38.0 65-69 37.0893 38.0 38.0 38.0 36.0 38.0 70-74 37.1221 38.0 38.0 38.0 36.0 38.0 75-79 37.0591 38.0 38.0 38.0 36.0 38.0 80-84 37.009 38.0 38.0 38.0 36.0 38.0 85-89 36.952 38.0 38.0 38.0 35.8 38.0 90-94 36.8675 38.0 38.0 38.0 35.4 38.0 95-99 36.8149 38.0 38.0 38.0 35.4 38.0 100-104 36.53495 38.0 38.0 38.0 34.6 38.0 105-109 36.57185 38.0 38.0 38.0 34.4 38.0 110-114 35.79815 38.0 37.0 38.0 30.4 38.0 115-119 36.3478 38.0 37.8 38.0 33.8 38.0 120-124 36.372400000000006 38.0 38.0 38.0 34.0 38.0 125-129 36.254 38.0 38.0 38.0 34.0 38.0 130-134 36.261250000000004 38.0 38.0 38.0 33.8 38.0 135-139 35.844449999999995 38.0 37.0 38.0 33.0 38.0 140-144 35.815549999999995 38.0 37.2 38.0 33.0 38.0 145-149 35.408100000000005 38.0 36.2 38.0 32.8 38.0 150 31.003 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 3.0 15 1.0 16 0.0 17 2.0 18 3.0 19 1.0 20 3.0 21 6.0 22 7.0 23 1.0 24 5.0 25 8.0 26 8.0 27 17.0 28 23.0 29 26.0 30 41.0 31 39.0 32 66.0 33 110.0 34 138.0 35 185.0 36 458.0 37 2846.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.17517517517518 11.436436436436438 8.283283283283284 30.105105105105107 2 24.675 13.775 32.800000000000004 28.749999999999996 3 21.15 20.875 25.55 32.425 4 24.575 30.075000000000003 21.925 23.425 5 24.5 32.225 22.8 20.474999999999998 6 18.396987627756857 36.30984400215169 25.443786982248522 19.849381387842925 7 14.124999999999998 26.974999999999998 40.9 18.0 8 16.8 25.95 32.05 25.2 9 17.4 25.025 33.625 23.95 10-14 20.135 29.365000000000002 27.229999999999997 23.27 15-19 20.665 28.660000000000004 27.224999999999998 23.45 20-24 21.044999999999998 29.060000000000002 26.655 23.24 25-29 20.51 28.67 27.134999999999998 23.685000000000002 30-34 20.4 29.18 27.505000000000003 22.915 35-39 20.28 29.01 27.095000000000002 23.615 40-44 20.26 29.86 26.8 23.080000000000002 45-49 19.939999999999998 29.075 27.29 23.695 50-54 20.075000000000003 29.330000000000002 26.900000000000002 23.695 55-59 20.645 28.599999999999998 27.339999999999996 23.415 60-64 20.73 28.560000000000002 26.995 23.715 65-69 20.27 29.125 26.685 23.919999999999998 70-74 19.93 29.294999999999998 27.13 23.645 75-79 20.285 28.775000000000002 27.229999999999997 23.71 80-84 20.315 28.810000000000002 26.919999999999998 23.955000000000002 85-89 20.47 28.144999999999996 27.625 23.76 90-94 20.205000000000002 29.659999999999997 26.895000000000003 23.24 95-99 20.155 28.470000000000002 27.22 24.154999999999998 100-104 20.205000000000002 28.999999999999996 27.215 23.580000000000002 105-109 20.115 28.910000000000004 27.034999999999997 23.94 110-114 20.605 28.525 27.055 23.815 115-119 20.669999999999998 28.595 27.38 23.355 120-124 20.955 28.685 26.705000000000002 23.655 125-129 20.605 28.355000000000004 27.055 23.985 130-134 21.23 28.694999999999997 26.779999999999998 23.294999999999998 135-139 20.79 28.310000000000002 26.595000000000002 24.305 140-144 20.580000000000002 28.035 27.125 24.26 145-149 21.385 28.205000000000002 26.865 23.544999999999998 150 20.849999999999998 27.500000000000004 26.325 25.324999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 2.0 23 1.0 24 0.5 25 2.0 26 3.5 27 7.0 28 14.0 29 17.0 30 17.5 31 25.5 32 34.5 33 43.5 34 52.5 35 64.0 36 84.5 37 100.0 38 114.5 39 149.5 40 181.5 41 197.0 42 243.0 43 278.5 44 267.5 45 275.5 46 275.5 47 259.5 48 236.0 49 200.5 50 167.0 51 145.5 52 127.5 53 94.0 54 79.0 55 61.5 56 45.5 57 39.5 58 26.5 59 19.5 60 12.0 61 5.5 62 4.0 63 2.5 64 2.5 65 4.5 66 4.0 67 1.5 68 1.5 69 3.0 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 7.049999999999999 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.47500000000000003 0.0 0.0 0.0 0.0 94-95 0.6499999999999999 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.2375 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.6749999999999998 0.0 0.0 0.0 0.0 106-107 1.8624999999999998 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.4875 0.0 0.0 0.0 0.0 112-113 2.925 0.0 0.0 0.0 0.0 114-115 3.325 0.0 0.0 0.0 0.0 116-117 3.75 0.0 0.0 0.0 0.0 118-119 4.1125 0.0 0.0 0.0 0.0 120-121 4.525 0.0 0.0 0.0 0.0 122-123 4.9125 0.0 0.0 0.0 0.0 124-125 5.550000000000001 0.0 0.0 0.0 0.0 126-127 6.012499999999999 0.0 0.0 0.0 0.0 128-129 6.425 0.0 0.0 0.0 0.0 130-131 6.8375 0.0 0.0 0.0 0.0 132-133 7.425000000000001 0.0 0.0 0.0 0.0 134-135 7.9125 0.0 0.0 0.0 0.0 136-137 8.4125 0.0 0.0 0.0 0.0 138 8.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237630 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237630_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6925 33.0 33.0 34.0 32.0 34.0 2 32.8045 34.0 33.0 34.0 32.0 34.0 3 32.76275 34.0 33.0 34.0 32.0 34.0 4 32.75475 34.0 33.0 34.0 32.0 34.0 5 32.74275 34.0 33.0 34.0 32.0 34.0 6 36.85875 38.0 38.0 38.0 36.0 38.0 7 36.944 38.0 38.0 38.0 36.0 38.0 8 36.864 38.0 38.0 38.0 36.0 38.0 9 36.87525 38.0 38.0 38.0 36.0 38.0 10-14 36.753949999999996 38.0 38.0 38.0 36.0 38.0 15-19 36.74135 38.0 38.0 38.0 36.0 38.0 20-24 36.72474999999999 38.0 38.0 38.0 36.0 38.0 25-29 36.67835 38.0 38.0 38.0 36.0 38.0 30-34 36.64295 38.0 38.0 38.0 35.8 38.0 35-39 36.65465 38.0 38.0 38.0 36.0 38.0 40-44 36.631400000000006 38.0 38.0 38.0 36.0 38.0 45-49 36.6219 38.0 38.0 38.0 35.8 38.0 50-54 36.58985 38.0 38.0 38.0 35.8 38.0 55-59 36.492650000000005 38.0 38.0 38.0 35.2 38.0 60-64 36.52550000000001 38.0 38.0 38.0 35.2 38.0 65-69 36.50205 38.0 38.0 38.0 35.4 38.0 70-74 36.420399999999994 38.0 38.0 38.0 35.2 38.0 75-79 36.4228 38.0 38.0 38.0 35.4 38.0 80-84 36.35765000000001 38.0 38.0 38.0 34.6 38.0 85-89 36.2054 38.0 38.0 38.0 34.2 38.0 90-94 36.14675 38.0 38.0 38.0 34.2 38.0 95-99 36.0989 38.0 38.0 38.0 34.0 38.0 100-104 36.095400000000005 38.0 38.0 38.0 34.0 38.0 105-109 35.985699999999994 38.0 38.0 38.0 34.0 38.0 110-114 35.8766 38.0 38.0 38.0 33.6 38.0 115-119 35.734899999999996 38.0 38.0 38.0 33.0 38.0 120-124 35.688300000000005 38.0 38.0 38.0 33.4 38.0 125-129 35.6302 38.0 38.0 38.0 33.0 38.0 130-134 35.43070000000001 38.0 38.0 38.0 31.8 38.0 135-139 35.211349999999996 38.0 37.8 38.0 30.6 38.0 140-144 34.91585 38.0 37.0 38.0 30.4 38.0 145-149 34.3528 38.0 36.0 38.0 26.4 38.0 150 29.2565 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 7.0 4 5.0 5 4.0 6 3.0 7 1.0 8 3.0 9 0.0 10 2.0 11 0.0 12 6.0 13 4.0 14 7.0 15 5.0 16 8.0 17 2.0 18 6.0 19 7.0 20 5.0 21 8.0 22 10.0 23 15.0 24 17.0 25 14.0 26 27.0 27 27.0 28 26.0 29 20.0 30 41.0 31 39.0 32 61.0 33 68.0 34 99.0 35 159.0 36 359.0 37 2914.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.300000000000004 20.674999999999997 12.425 21.6 2 28.249999999999996 25.5 30.425 15.825 3 21.975 28.599999999999998 30.5 18.925 4 24.45 33.875 23.549999999999997 18.125 5 25.15 36.875 21.725 16.25 6 21.224999999999998 38.1 24.3 16.375 7 20.575 21.55 38.25 19.625 8 21.175 24.7 28.599999999999998 25.525 9 22.825 25.8 28.050000000000004 23.325000000000003 10-14 24.195 29.01 26.36 20.435 15-19 23.985 27.200000000000003 28.060000000000002 20.755000000000003 20-24 23.455000000000002 28.465 27.500000000000004 20.580000000000002 25-29 23.64 27.894999999999996 27.76 20.705000000000002 30-34 23.645 27.025 28.32 21.01 35-39 23.625 27.800000000000004 28.155 20.419999999999998 40-44 23.775 27.529999999999998 27.839999999999996 20.855 45-49 23.27 27.589999999999996 28.405 20.735 50-54 22.915 28.075 28.465 20.544999999999998 55-59 24.279999999999998 26.99 28.38 20.349999999999998 60-64 23.189999999999998 27.505000000000003 28.525 20.78 65-69 23.16 27.57 28.499999999999996 20.77 70-74 23.544999999999998 27.794999999999998 27.99 20.669999999999998 75-79 23.555 27.544999999999998 28.33 20.57 80-84 23.669999999999998 27.08 28.494999999999997 20.755000000000003 85-89 23.43 27.834999999999997 28.26 20.474999999999998 90-94 23.169999999999998 27.705000000000002 28.599999999999998 20.525 95-99 23.16 27.755000000000003 28.035 21.05 100-104 23.775 27.565 27.815 20.845 105-109 24.01 26.99 28.720000000000002 20.28 110-114 23.91 27.715 27.794999999999998 20.580000000000002 115-119 24.6 28.115000000000002 28.050000000000004 19.235 120-124 24.54 27.77 27.675 20.015 125-129 24.395 27.42 27.485 20.7 130-134 25.025 27.315 27.150000000000002 20.51 135-139 24.404999999999998 27.965 27.450000000000003 20.18 140-144 25.205 27.700000000000003 27.224999999999998 19.869999999999997 145-149 25.66 28.345 26.66 19.335 150 25.074999999999996 27.275 27.675 19.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 2.0 21 1.0 22 1.0 23 2.5 24 2.0 25 2.0 26 1.5 27 5.0 28 9.5 29 9.5 30 13.0 31 18.0 32 29.5 33 40.5 34 43.5 35 55.0 36 76.5 37 88.0 38 110.5 39 151.5 40 190.0 41 223.5 42 254.0 43 281.0 44 284.0 45 282.0 46 291.0 47 281.5 48 236.0 49 203.0 50 190.0 51 153.0 52 110.5 53 83.5 54 67.5 55 51.5 56 41.5 57 31.5 58 23.5 59 20.5 60 14.0 61 7.0 62 2.5 63 1.5 64 0.5 65 1.5 66 2.5 67 2.0 68 0.5 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.47500000000000003 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.4125 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.8125 0.0 0.0 0.0 0.0 108-109 2.0375 0.0 0.0 0.0 0.0 110-111 2.4124999999999996 0.0 0.0 0.0 0.0 112-113 2.825 0.0 0.0 0.0 0.0 114-115 3.2125 0.0 0.0 0.0 0.0 116-117 3.65 0.0 0.0 0.0 0.0 118-119 4.0375 0.0 0.0 0.0 0.0 120-121 4.475 0.0 0.0 0.0 0.0 122-123 4.8875 0.0 0.0 0.0 0.0 124-125 5.5375 0.0 0.0 0.0 0.0 126-127 6.025 0.0 0.0 0.0 0.0 128-129 6.3875 0.0 0.0 0.0 0.0 130-131 6.775 0.0 0.0 0.0 0.0 132-133 7.375 0.0 0.0 0.0 0.0 134-135 7.875 0.0 0.0 0.0 0.0 136-137 8.3875 0.0 0.0 0.0 0.0 138 8.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACATG 10 0.006973645 144.0 1 >>END_MODULE Read 2869537 spots for SRR4237630.sra Written 2869537 spots for SRR4237630.sra Read 2869537 spots for SRR4237630.sra Written 2869537 spots for SRR4237630.sra Read 2869537 spots for SRR4237630.sra Written 2869537 spots for SRR4237630.sra Read 2869537 spots for SRR4237630.sra Written 2869537 spots for SRR4237630.sra Read 2869537 spots for SRR4237630.sra Written 2869537 spots for SRR4237630.sra Read 2869537 spots for SRR4237630.sra Written 2869537 spots for SRR4237630.sra Read 2869537 spots for SRR4237630.sra Written 2869537 spots for SRR4237630.sra Read 2869537 spots for SRR4237630.sra Written 2869537 spots for SRR4237630.sra Read 2869537 spots for SRR4237630.sra Written 2869537 spots for SRR4237630.sra Read 2869537 spots for SRR4237630.sra Written 2869537 spots for SRR4237630.sra Read 2869537 spots for SRR4237630.sra Written 2869537 spots for SRR4237630.sra Read 2869537 spots for SRR4237630.sra Written 2869537 spots for SRR4237630.sra Read 2869537 spots for SRR4237630.sra Written 2869537 spots for SRR4237630.sra Read 2869546 spots for SRR4237630.sra Written 2869546 spots for SRR4237630.sra Read 2869537 spots for SRR4237630.sra Written 2869537 spots for SRR4237630.sra Read 2869537 spots for SRR4237630.sra Written 2869537 spots for SRR4237630.sra Read 2869537 spots for SRR4237630.sra Written 2869537 spots for SRR4237630.sra Read 2869537 spots for SRR4237630.sra Written 2869537 spots for SRR4237630.sra Read 2869537 spots for SRR4237630.sra Written 2869537 spots for SRR4237630.sra Read 2869537 spots for SRR4237630.sra Written 2869537 spots for SRR4237630.sra SRR ids: ['SRR4237630.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n82o2svq SRR4237630.sra spots: 57390749 blocks: [[1, 2869537], [2869538, 5739074], [5739075, 8608611], [8608612, 11478148], [11478149, 14347685], [14347686, 17217222], [17217223, 20086759], [20086760, 22956296], [22956297, 25825833], [25825834, 28695370], [28695371, 31564907], [31564908, 34434444], [34434445, 37303981], [37303982, 40173518], [40173519, 43043055], [43043056, 45912592], [45912593, 48782129], [48782130, 51651666], [51651667, 54521203], [54521204, 57390749]] SRR4237630 file size 19314050 SRR4237630 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237630 SRR4237630_1.fastq SRR4237630_2.fastq Input file: SRR4237630_1.fastq Paired file: SRR4237630_2.fastq trimmed: SRR4237630-trimmed-pair1.fastq, SRR4237630-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:07:33 2025 >> started Wed Feb 12 18:08:33 2025 >> done (60.614s) 57390749 read pairs processed; of these: 147862 ( 0.26%) short read pairs filtered out after trimming by size control 71514 ( 0.12%) empty read pairs filtered out after trimming by size control 57171373 (99.62%) read pairs available; of these: 19077122 (33.37%) trimmed read pairs available after processing 38094251 (66.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 15 0.00% 20 23 0.00% 21 16 0.00% 22 20 0.00% 23 21 0.00% 24 29 0.00% 25 17 0.00% 26 14 0.00% 27 27 0.00% 28 27 0.00% 29 26 0.00% 30 30 0.00% 31 31 0.00% 32 36 0.00% 33 44 0.00% 34 55 0.00% 35 62 0.00% 36 83 0.00% 37 81 0.00% 38 91 0.00% 39 108 0.00% 40 121 0.00% 41 137 0.00% 42 175 0.00% 43 165 0.00% 44 210 0.00% 45 226 0.00% 46 264 0.00% 47 294 0.00% 48 314 0.00% 49 350 0.00% 50 441 0.00% 51 485 0.00% 52 495 0.00% 53 615 0.00% 54 635 0.00% 55 745 0.00% 56 771 0.00% 57 867 0.00% 58 1036 0.00% 59 1184 0.00% 60 1344 0.00% 61 1604 0.00% 62 1612 0.00% 63 1984 0.00% 64 2107 0.00% 65 2399 0.00% 66 2807 0.00% 67 3423 0.01% 68 5203 0.01% 69 18112 0.03% 70 14051 0.02% 71 6038 0.01% 72 5853 0.01% 73 6247 0.01% 74 6896 0.01% 75 7378 0.01% 76 8488 0.01% 77 9038 0.02% 78 10057 0.02% 79 11248 0.02% 80 12653 0.02% 81 14237 0.02% 82 15698 0.03% 83 18783 0.03% 84 37098 0.06% 85 31175 0.05% 86 33918 0.06% 87 33026 0.06% 88 32686 0.06% 89 34704 0.06% 90 37703 0.07% 91 39803 0.07% 92 42949 0.08% 93 47285 0.08% 94 56551 0.10% 95 55896 0.10% 96 56078 0.10% 97 61478 0.11% 98 61187 0.11% 99 64989 0.11% 100 67746 0.12% 101 72058 0.13% 102 75742 0.13% 103 79936 0.14% 104 84713 0.15% 105 88817 0.16% 106 93385 0.16% 107 96091 0.17% 108 100176 0.18% 109 104586 0.18% 110 107281 0.19% 111 110565 0.19% 112 114904 0.20% 113 119199 0.21% 114 125274 0.22% 115 129187 0.23% 116 133544 0.23% 117 138002 0.24% 118 140516 0.25% 119 143271 0.25% 120 148114 0.26% 121 151805 0.27% 122 155457 0.27% 123 159045 0.28% 124 165217 0.29% 125 168752 0.30% 126 175247 0.31% 127 178769 0.31% 128 184114 0.32% 129 190379 0.33% 130 192283 0.34% 131 195626 0.34% 132 202155 0.35% 133 208536 0.36% 134 214279 0.37% 135 221681 0.39% 136 229002 0.40% 137 237318 0.42% 138 247983 0.43% 139 257703 0.45% 140 270802 0.47% 141 285916 0.50% 142 305607 0.53% 143 331372 0.58% 144 372871 0.65% 145 430342 0.75% 146 526783 0.92% 147 721241 1.26% 148 1254490 2.19% 149 7645055 13.37% 150 38094251 66.63% 57171373 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=32 prefix-density=0.21 prefix-fanout=2.6 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=192.48 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=10.2 sequence=AGCAGCAAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTGAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTACTATCAGTACTCATCTCCTTCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=43 prefix-density=0.19 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=18 fanout-score=77.76 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=17.4 sequence=TGCTGCTGAAATT SRR4237630 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:09:18 Started mapping on | Feb 12 18:09:18 Finished on | Feb 12 18:13:48 Mapping speed, Million of reads per hour | 762.28 Number of input reads | 57171373 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 54918844 Uniquely mapped reads % | 96.06% Average mapped length | 290.87 Number of splices: Total | 48040730 Number of splices: Annotated (sjdb) | 47237799 Number of splices: GT/AG | 47348998 Number of splices: GC/AG | 541153 Number of splices: AT/AC | 41473 Number of splices: Non-canonical | 109106 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1088009 % of reads mapped to multiple loci | 1.90% Number of reads mapped to too many loci | 48861 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.93% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1263568 1263568 1263568 N_multimapping 1088009 1088009 1088009 N_noFeature 1353720 54189640 1772718 N_ambiguous 544874 4130 231211 UnstrandedReadsAssigned:53020250 PositiveStrandReadsAssigned:725074 NegativeStrandReadsAssigned:52914915 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237630 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237630-trimmed-pair1.fastq SRR4237630-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 57,171,373 reads, 52,693,828 reads pseudoaligned [quant] estimated average fragment length: 229.432 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,226 rounds 52401 SRR4237630.ke.tsv 34699 SRR4237630.se.tsv 87100 total ==> SRR4237630.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.57 1227 14.0584 Potri.005G024800.1.v4.1 1035 806.568 90 2.28793 Potri.004G059700.1.v4.1 961 732.612 9 0.251889 Potri.007G009000.2.v4.1 1416 1187.57 0 0 Potri.003G141000.2.v4.1 2943 2714.57 773.345 5.84135 Potri.016G087400.1.v4.1 270 88.3016 5582 1296.17 Potri.015G069301.1.v4.1 564 340.33 0 0 Potri.010G195200.1.v4.1 1773 1544.57 50 0.663748 Potri.012G127500.1.v4.1 977 748.596 10452 286.281 ==> SRR4237630.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7908 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 771 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 55 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR4237630 completed mapping pipeline successfully