Starting /dee2/code/volunteer_pipeline.sh SRR4237631 current disk space = 3051181277184 free memory = 1576496596 SRR4237631 SRAfilesize 34869fdfec5eac71364367a2d84e673e SRR4237631.sra SRR4237631.sra file validated SRR4237631 is paired end SRR4237631 is conventional basespace SRR4237631 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237631_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.35875 34.0 33.0 34.0 33.0 34.0 2 33.377 34.0 33.0 34.0 33.0 34.0 3 33.39 34.0 33.0 34.0 33.0 34.0 4 33.36675 34.0 33.0 34.0 33.0 34.0 5 33.3175 34.0 33.0 34.0 33.0 34.0 6 35.88625 38.0 37.0 38.0 34.0 38.0 7 37.00175 38.0 38.0 38.0 35.0 38.0 8 37.15225 38.0 38.0 38.0 36.0 38.0 9 37.35225 38.0 38.0 38.0 37.0 38.0 10-14 37.4544 38.0 38.0 38.0 37.0 38.0 15-19 37.43555 38.0 38.0 38.0 37.2 38.0 20-24 36.84355000000001 38.0 37.8 38.0 34.8 38.0 25-29 37.3515 38.0 38.0 38.0 37.0 38.0 30-34 37.3767 38.0 38.0 38.0 37.0 38.0 35-39 37.33970000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.2522 38.0 38.0 38.0 36.8 38.0 45-49 37.1932 38.0 38.0 38.0 37.0 38.0 50-54 37.05525 38.0 38.0 38.0 36.0 38.0 55-59 37.080149999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.080499999999994 38.0 38.0 38.0 36.0 38.0 65-69 37.04535 38.0 38.0 38.0 36.0 38.0 70-74 36.432449999999996 38.0 37.4 38.0 33.4 38.0 75-79 36.87585 38.0 38.0 38.0 35.6 38.0 80-84 36.675200000000004 38.0 37.8 38.0 34.8 38.0 85-89 36.748400000000004 38.0 38.0 38.0 34.8 38.0 90-94 36.74495 38.0 38.0 38.0 34.8 38.0 95-99 36.7138 38.0 38.0 38.0 35.0 38.0 100-104 36.6031 38.0 38.0 38.0 34.4 38.0 105-109 36.522800000000004 38.0 38.0 38.0 34.2 38.0 110-114 35.31685 38.0 35.8 38.0 28.4 38.0 115-119 36.33075 38.0 38.0 38.0 34.0 38.0 120-124 36.12465 38.0 37.6 38.0 33.2 38.0 125-129 36.20735 38.0 38.0 38.0 33.8 38.0 130-134 35.72955 38.0 37.2 38.0 31.6 38.0 135-139 33.8714 37.4 32.6 38.0 25.4 38.0 140-144 35.466750000000005 38.0 36.0 38.0 31.4 38.0 145-149 35.223400000000005 38.0 36.0 38.0 31.2 38.0 150 30.409 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 3.0 19 2.0 20 4.0 21 3.0 22 5.0 23 6.0 24 14.0 25 10.0 26 13.0 27 28.0 28 25.0 29 32.0 30 38.0 31 39.0 32 63.0 33 103.0 34 134.0 35 252.0 36 579.0 37 2641.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 48.38709677419355 12.603150787696924 8.352088022005502 30.657664416104026 2 24.425 15.375 32.4 27.800000000000004 3 20.175 21.25 26.75 31.825 4 21.775 29.65 22.825 25.75 5 22.475 34.949999999999996 22.1 20.474999999999998 6 19.057377049180328 36.24487704918033 24.30840163934426 20.38934426229508 7 14.45 26.325 42.25 16.975 8 17.224999999999998 26.025 31.35 25.4 9 16.950000000000003 25.5 33.75 23.799999999999997 10-14 19.515 30.595 26.445 23.445 15-19 19.950000000000003 29.635 27.155 23.26 20-24 19.945 29.705 27.355 22.994999999999997 25-29 19.105 29.645 27.79 23.46 30-34 19.794999999999998 29.609999999999996 27.42 23.175 35-39 19.49 29.134999999999998 27.994999999999997 23.380000000000003 40-44 19.63 29.095 27.785 23.49 45-49 20.064999999999998 28.895 26.76 24.279999999999998 50-54 19.67 29.67 26.58 24.08 55-59 19.18 29.025000000000002 27.779999999999998 24.015 60-64 19.905 29.29 27.33 23.474999999999998 65-69 19.869999999999997 28.7 28.215 23.215 70-74 20.195 28.96 27.215 23.630000000000003 75-79 19.84 28.835 27.505000000000003 23.82 80-84 20.34 28.665000000000003 27.400000000000002 23.595 85-89 20.09 29.299999999999997 27.11 23.5 90-94 19.945 29.080000000000002 27.894999999999996 23.080000000000002 95-99 20.365 28.785 27.339999999999996 23.51 100-104 20.72 28.725 27.265 23.29 105-109 20.555 29.054999999999996 27.055 23.335 110-114 20.47 28.58 27.189999999999998 23.76 115-119 20.405 29.104999999999997 26.740000000000002 23.75 120-124 20.18 28.449999999999996 27.61 23.76 125-129 19.919999999999998 28.625 27.145000000000003 24.310000000000002 130-134 20.865000000000002 28.76 26.77 23.605 135-139 20.919999999999998 28.875 27.11 23.095 140-144 20.325 28.725 26.695 24.255 145-149 20.974999999999998 28.525 26.534999999999997 23.965 150 19.729594391587383 29.218828242363543 25.863795693540307 25.187781672508763 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 1.5 23 2.0 24 2.5 25 3.5 26 3.5 27 4.0 28 11.5 29 23.0 30 31.5 31 35.0 32 38.5 33 43.5 34 60.5 35 78.0 36 85.5 37 98.5 38 123.0 39 167.0 40 198.5 41 225.5 42 243.5 43 258.0 44 273.5 45 275.5 46 273.5 47 263.0 48 226.0 49 187.0 50 164.5 51 142.0 52 117.0 53 91.0 54 77.0 55 55.5 56 34.5 57 22.5 58 14.5 59 10.5 60 7.0 61 5.0 62 5.5 63 3.5 64 2.0 65 2.0 66 0.5 67 0.0 68 0.5 69 2.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 2.4 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 1.95 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.5 0.0 0.0 0.0 0.0 120-121 2.8 0.0 0.0 0.0 0.0 122-123 3.125 0.0 0.0 0.0 0.0 124-125 3.3375 0.0 0.0 0.0 0.0 126-127 3.725 0.0 0.0 0.0 0.0 128-129 4.0625 0.0 0.0 0.0 0.0 130-131 4.3375 0.0 0.0 0.0 0.0 132-133 4.6 0.0 0.0 0.0 0.0 134-135 4.9 0.0 0.0 0.0 0.0 136-137 5.2125 0.0 0.0 0.0 0.0 138 5.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCTTT 10 0.0062323185 149.44156 1 >>END_MODULE SRR4237631 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237631_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82975 33.0 33.0 34.0 32.0 34.0 2 32.776 34.0 33.0 34.0 32.0 34.0 3 32.92225 34.0 33.0 34.0 32.0 34.0 4 32.8865 34.0 33.0 34.0 32.0 34.0 5 32.75575 34.0 33.0 34.0 32.0 34.0 6 34.536 38.0 36.0 38.0 16.0 38.0 7 36.588 38.0 38.0 38.0 34.0 38.0 8 36.74675 38.0 38.0 38.0 36.0 38.0 9 36.851 38.0 38.0 38.0 36.0 38.0 10-14 36.75775 38.0 38.0 38.0 35.6 38.0 15-19 36.87949999999999 38.0 38.0 38.0 36.0 38.0 20-24 36.91369999999999 38.0 38.0 38.0 36.4 38.0 25-29 36.233850000000004 38.0 37.0 38.0 32.4 38.0 30-34 36.07695 38.0 37.0 38.0 32.6 38.0 35-39 36.8459 38.0 38.0 38.0 36.4 38.0 40-44 36.9103 38.0 38.0 38.0 36.4 38.0 45-49 36.90175 38.0 38.0 38.0 36.2 38.0 50-54 36.87635 38.0 38.0 38.0 36.2 38.0 55-59 36.82824999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.791799999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.761250000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.7527 38.0 38.0 38.0 36.0 38.0 75-79 36.399699999999996 38.0 38.0 38.0 34.6 38.0 80-84 36.50144999999999 38.0 38.0 38.0 35.0 38.0 85-89 36.568799999999996 38.0 38.0 38.0 35.4 38.0 90-94 36.49550000000001 38.0 38.0 38.0 35.2 38.0 95-99 36.43405 38.0 38.0 38.0 35.0 38.0 100-104 36.27475 38.0 38.0 38.0 34.6 38.0 105-109 36.299 38.0 38.0 38.0 34.2 38.0 110-114 36.2404 38.0 38.0 38.0 34.2 38.0 115-119 35.94905 38.0 37.8 38.0 32.8 38.0 120-124 35.7866 38.0 37.8 38.0 32.6 38.0 125-129 35.933049999999994 38.0 38.0 38.0 33.6 38.0 130-134 35.70745 38.0 38.0 38.0 32.6 38.0 135-139 35.55885 38.0 38.0 38.0 32.6 38.0 140-144 35.2394 38.0 37.4 38.0 31.4 38.0 145-149 34.93044999999999 38.0 37.8 38.0 31.0 38.0 150 28.7685 34.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 7.0 4 3.0 5 3.0 6 1.0 7 2.0 8 3.0 9 3.0 10 4.0 11 2.0 12 2.0 13 5.0 14 2.0 15 3.0 16 5.0 17 1.0 18 3.0 19 4.0 20 5.0 21 3.0 22 17.0 23 7.0 24 13.0 25 11.0 26 17.0 27 20.0 28 27.0 29 28.0 30 54.0 31 45.0 32 62.0 33 71.0 34 116.0 35 177.0 36 389.0 37 2876.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.475 23.0 10.35 20.175 2 28.975 25.4 30.075000000000003 15.55 3 21.224999999999998 27.900000000000002 32.9 17.974999999999998 4 25.575 34.025 22.775000000000002 17.625 5 23.825 37.974999999999994 22.45 15.75 6 21.775 38.7 23.175 16.35 7 21.175 19.775000000000002 40.45 18.6 8 20.599999999999998 25.35 30.075000000000003 23.974999999999998 9 23.075000000000003 24.175 29.475 23.275000000000002 10-14 23.724999999999998 28.685 26.855 20.735 15-19 23.7 28.185 27.555000000000003 20.560000000000002 20-24 23.265 28.025 28.249999999999996 20.46 25-29 23.255 28.07 28.044999999999998 20.630000000000003 30-34 23.655 27.325 28.48 20.54 35-39 23.34 27.589999999999996 28.175 20.895 40-44 23.44 28.405 27.500000000000004 20.655 45-49 23.36 27.915 28.189999999999998 20.535 50-54 23.1 28.235 27.889999999999997 20.775 55-59 23.52 27.235 28.689999999999998 20.555 60-64 23.24 27.950000000000003 28.634999999999998 20.175 65-69 23.39 27.935 28.194999999999997 20.48 70-74 24.02 27.625 28.115000000000002 20.24 75-79 23.625 27.605 28.725 20.044999999999998 80-84 23.419999999999998 27.915 28.470000000000002 20.195 85-89 23.44 27.295 29.2 20.064999999999998 90-94 23.735 27.375 28.705000000000002 20.185 95-99 23.57 27.71 28.65 20.07 100-104 23.925 27.939999999999998 27.939999999999998 20.195 105-109 24.14620731036552 27.561378068903448 27.881394069703486 20.41102055102755 110-114 23.535 28.095 28.57 19.8 115-119 23.986199309965496 28.096404820241013 27.861393069653484 20.056002800140007 120-124 24.09 27.389999999999997 28.42 20.1 125-129 24.215 27.884999999999998 28.07 19.830000000000002 130-134 24.5 27.450000000000003 27.715 20.335 135-139 24.54 27.365000000000002 28.044999999999998 20.05 140-144 24.665 27.92 27.474999999999998 19.939999999999998 145-149 25.04625231261563 28.381419070953545 27.456372818640933 19.11595579778989 150 25.45 27.325 27.400000000000002 19.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 2.5 24 4.5 25 3.5 26 3.0 27 5.0 28 7.0 29 8.0 30 11.5 31 15.5 32 24.5 33 37.5 34 43.5 35 64.5 36 90.0 37 111.0 38 129.0 39 169.0 40 193.5 41 225.5 42 287.5 43 288.0 44 272.0 45 268.0 46 277.5 47 268.5 48 238.0 49 215.0 50 174.5 51 130.5 52 107.0 53 97.5 54 71.5 55 39.5 56 27.5 57 19.5 58 14.5 59 13.5 60 10.5 61 8.5 62 4.0 63 4.0 64 3.5 65 2.0 66 2.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.7625 0.0 0.0 0.0 0.0 114-115 1.8875000000000002 0.0 0.0 0.0 0.0 116-117 2.0999999999999996 0.0 0.0 0.0 0.0 118-119 2.375 0.0 0.0 0.0 0.0 120-121 2.675 0.0 0.0 0.0 0.0 122-123 3.0250000000000004 0.0 0.0 0.0 0.0 124-125 3.2375 0.0 0.0 0.0 0.0 126-127 3.65 0.0 0.0 0.0 0.0 128-129 4.050000000000001 0.0 0.0 0.0 0.0 130-131 4.300000000000001 0.0 0.0 0.0 0.0 132-133 4.55 0.0 0.0 0.0 0.0 134-135 4.862500000000001 0.0 0.0 0.0 0.0 136-137 5.275 0.0 0.0 0.0 0.0 138 5.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACAAAG 10 0.0070081474 143.7625 5 GAGATAC 10 0.0070081474 143.7625 3 >>END_MODULE Read 3088722 spots for SRR4237631.sra Written 3088722 spots for SRR4237631.sra Read 3088722 spots for SRR4237631.sra Written 3088722 spots for SRR4237631.sra Read 3088722 spots for SRR4237631.sra Written 3088722 spots for SRR4237631.sra Read 3088722 spots for SRR4237631.sra Written 3088722 spots for SRR4237631.sra Read 3088722 spots for SRR4237631.sra Written 3088722 spots for SRR4237631.sra Read 3088722 spots for SRR4237631.sra Written 3088722 spots for SRR4237631.sra Read 3088722 spots for SRR4237631.sra Written 3088722 spots for SRR4237631.sra Read 3088722 spots for SRR4237631.sra Written 3088722 spots for SRR4237631.sra Read 3088722 spots for SRR4237631.sra Written 3088722 spots for SRR4237631.sra Read 3088722 spots for SRR4237631.sra Written 3088722 spots for SRR4237631.sra Read 3088722 spots for SRR4237631.sra Written 3088722 spots for SRR4237631.sra Read 3088722 spots for SRR4237631.sra Written 3088722 spots for SRR4237631.sra Read 3088722 spots for SRR4237631.sra Written 3088722 spots for SRR4237631.sra Read 3088722 spots for SRR4237631.sra Written 3088722 spots for SRR4237631.sra Read 3088722 spots for SRR4237631.sra Written 3088722 spots for SRR4237631.sra Read 3088722 spots for SRR4237631.sra Written 3088722 spots for SRR4237631.sra Read 3088722 spots for SRR4237631.sra Written 3088722 spots for SRR4237631.sra Read 3088737 spots for SRR4237631.sra Written 3088737 spots for SRR4237631.sra Read 3088722 spots for SRR4237631.sra Written 3088722 spots for SRR4237631.sra Read 3088722 spots for SRR4237631.sra Written 3088722 spots for SRR4237631.sra SRR ids: ['SRR4237631.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1sqsxx4_ SRR4237631.sra spots: 61774455 blocks: [[1, 3088722], [3088723, 6177444], [6177445, 9266166], [9266167, 12354888], [12354889, 15443610], [15443611, 18532332], [18532333, 21621054], [21621055, 24709776], [24709777, 27798498], [27798499, 30887220], [30887221, 33975942], [33975943, 37064664], [37064665, 40153386], [40153387, 43242108], [43242109, 46330830], [46330831, 49419552], [49419553, 52508274], [52508275, 55596996], [55596997, 58685718], [58685719, 61774455]] SRR4237631 file size 20790982 SRR4237631 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237631 SRR4237631_1.fastq SRR4237631_2.fastq Input file: SRR4237631_1.fastq Paired file: SRR4237631_2.fastq trimmed: SRR4237631-trimmed-pair1.fastq, SRR4237631-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:04:53 2025 >> started Wed Feb 12 19:06:03 2025 >> done (69.261s) 61774455 read pairs processed; of these: 130522 ( 0.21%) short read pairs filtered out after trimming by size control 58813 ( 0.10%) empty read pairs filtered out after trimming by size control 61585120 (99.69%) read pairs available; of these: 20504222 (33.29%) trimmed read pairs available after processing 41080898 (66.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 8 0.00% 20 14 0.00% 21 9 0.00% 22 16 0.00% 23 17 0.00% 24 10 0.00% 25 17 0.00% 26 19 0.00% 27 32 0.00% 28 25 0.00% 29 22 0.00% 30 29 0.00% 31 36 0.00% 32 34 0.00% 33 36 0.00% 34 39 0.00% 35 44 0.00% 36 50 0.00% 37 65 0.00% 38 68 0.00% 39 68 0.00% 40 79 0.00% 41 90 0.00% 42 94 0.00% 43 114 0.00% 44 133 0.00% 45 132 0.00% 46 131 0.00% 47 156 0.00% 48 185 0.00% 49 187 0.00% 50 241 0.00% 51 284 0.00% 52 313 0.00% 53 310 0.00% 54 342 0.00% 55 402 0.00% 56 459 0.00% 57 505 0.00% 58 569 0.00% 59 614 0.00% 60 748 0.00% 61 882 0.00% 62 984 0.00% 63 1100 0.00% 64 1233 0.00% 65 1396 0.00% 66 1567 0.00% 67 1804 0.00% 68 2274 0.00% 69 4176 0.01% 70 4815 0.01% 71 3486 0.01% 72 3176 0.01% 73 3631 0.01% 74 4095 0.01% 75 4570 0.01% 76 4938 0.01% 77 5486 0.01% 78 6099 0.01% 79 6830 0.01% 80 7658 0.01% 81 9021 0.01% 82 10154 0.02% 83 12942 0.02% 84 28451 0.05% 85 33412 0.05% 86 21628 0.04% 87 22241 0.04% 88 24336 0.04% 89 25089 0.04% 90 28535 0.05% 91 29206 0.05% 92 31231 0.05% 93 34666 0.06% 94 35996 0.06% 95 37722 0.06% 96 40678 0.07% 97 43020 0.07% 98 46945 0.08% 99 47555 0.08% 100 50435 0.08% 101 53127 0.09% 102 56415 0.09% 103 59878 0.10% 104 63670 0.10% 105 67136 0.11% 106 70507 0.11% 107 74545 0.12% 108 80095 0.13% 109 80937 0.13% 110 84102 0.14% 111 87821 0.14% 112 91937 0.15% 113 96365 0.16% 114 98811 0.16% 115 103329 0.17% 116 106345 0.17% 117 112773 0.18% 118 118018 0.19% 119 115868 0.19% 120 120018 0.19% 121 124572 0.20% 122 128037 0.21% 123 134253 0.22% 124 137747 0.22% 125 142581 0.23% 126 148209 0.24% 127 152159 0.25% 128 159311 0.26% 129 162883 0.26% 130 167454 0.27% 131 172530 0.28% 132 179527 0.29% 133 186015 0.30% 134 192666 0.31% 135 203693 0.33% 136 212109 0.34% 137 222312 0.36% 138 235358 0.38% 139 248389 0.40% 140 264473 0.43% 141 285229 0.46% 142 310898 0.50% 143 342195 0.56% 144 395529 0.64% 145 464554 0.75% 146 589960 0.96% 147 832650 1.35% 148 1537310 2.50% 149 9739701 15.82% 150 41080898 66.71% 61585120 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=36 prefix-density=0.21 prefix-fanout=2.5 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=184.53 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=11.4 sequence=AGCAGCAAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTGAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTACTATCAGTACTCATCTCCTTCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=40 prefix-density=0.19 prefix-fanout=2.4 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=18 fanout-score=67.10 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=16.0 sequence=TGCTGCTGAAATT SRR4237631 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:06:44 Started mapping on | Feb 12 19:06:44 Finished on | Feb 12 19:12:18 Mapping speed, Million of reads per hour | 663.79 Number of input reads | 61585120 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 58732406 Uniquely mapped reads % | 95.37% Average mapped length | 292.77 Number of splices: Total | 52824700 Number of splices: Annotated (sjdb) | 51903996 Number of splices: GT/AG | 52061372 Number of splices: GC/AG | 593512 Number of splices: AT/AC | 50621 Number of splices: Non-canonical | 119195 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1046284 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 73377 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.79% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1893499 1893499 1893499 N_multimapping 1046284 1046284 1046284 N_noFeature 1799636 57931798 2190343 N_ambiguous 663836 3108 251716 UnstrandedReadsAssigned:56268934 PositiveStrandReadsAssigned:797500 NegativeStrandReadsAssigned:56290347 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237631 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237631-trimmed-pair1.fastq SRR4237631-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 61,585,120 reads, 55,937,382 reads pseudoaligned [quant] estimated average fragment length: 240.636 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52401 SRR4237631.ke.tsv 34699 SRR4237631.se.tsv 87100 total ==> SRR4237631.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.36 1193 12.4751 Potri.005G024800.1.v4.1 1035 795.364 163 3.81107 Potri.004G059700.1.v4.1 961 721.43 25 0.644423 Potri.007G009000.2.v4.1 1416 1176.36 0 0 Potri.003G141000.2.v4.1 2943 2703.36 863.353 5.93894 Potri.016G087400.1.v4.1 270 80.9764 5093.21 1169.66 Potri.015G069301.1.v4.1 564 329.21 0 0 Potri.010G195200.1.v4.1 1773 1533.36 67 0.812559 Potri.012G127500.1.v4.1 977 737.404 18296 461.398 ==> SRR4237631.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8455 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 1024 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 27 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 19 SRR4237631 completed mapping pipeline successfully