Starting /dee2/code/volunteer_pipeline.sh SRR4237632 current disk space = 3051135107072 free memory = 1579724904 SRR4237632 SRAfilesize 5b27548715fe2d7a7ebc734d2455ad06 SRR4237632.sra SRR4237632.sra file validated SRR4237632 is paired end SRR4237632 is conventional basespace SRR4237632 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237632_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.36175 34.0 33.0 34.0 33.0 34.0 2 33.25425 34.0 33.0 34.0 33.0 34.0 3 33.31725 34.0 33.0 34.0 33.0 34.0 4 33.361 34.0 33.0 34.0 33.0 34.0 5 33.29 34.0 33.0 34.0 33.0 34.0 6 36.7345 38.0 37.0 38.0 34.0 38.0 7 36.4425 38.0 38.0 38.0 36.0 38.0 8 37.1855 38.0 38.0 38.0 36.0 38.0 9 37.3295 38.0 38.0 38.0 37.0 38.0 10-14 37.3995 38.0 38.0 38.0 37.0 38.0 15-19 37.46464999999999 38.0 38.0 38.0 37.2 38.0 20-24 37.484500000000004 38.0 38.0 38.0 37.2 38.0 25-29 37.4481 38.0 38.0 38.0 37.2 38.0 30-34 37.3842 38.0 38.0 38.0 37.0 38.0 35-39 36.91725 38.0 37.8 38.0 34.8 38.0 40-44 37.25505 38.0 38.0 38.0 36.8 38.0 45-49 37.247099999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.18145 38.0 38.0 38.0 36.4 38.0 55-59 37.111650000000004 38.0 38.0 38.0 36.0 38.0 60-64 37.09995 38.0 38.0 38.0 36.0 38.0 65-69 36.15319999999999 38.0 36.2 38.0 32.0 38.0 70-74 36.5082 38.0 37.4 38.0 33.6 38.0 75-79 36.94605 38.0 38.0 38.0 35.8 38.0 80-84 36.83805 38.0 38.0 38.0 35.4 38.0 85-89 36.1742 38.0 37.0 38.0 31.4 38.0 90-94 36.564299999999996 38.0 37.6 38.0 33.6 38.0 95-99 36.5733 38.0 38.0 38.0 34.4 38.0 100-104 36.705650000000006 38.0 38.0 38.0 34.8 38.0 105-109 36.15785 38.0 37.4 38.0 32.2 38.0 110-114 36.4788 38.0 38.0 38.0 34.0 38.0 115-119 35.9426 38.0 37.0 38.0 31.2 38.0 120-124 36.347500000000004 38.0 38.0 38.0 34.0 38.0 125-129 36.25865 38.0 37.8 38.0 33.8 38.0 130-134 36.0184 38.0 37.2 38.0 33.4 38.0 135-139 35.77325 38.0 36.4 38.0 32.2 38.0 140-144 35.62275 38.0 36.2 38.0 32.2 38.0 145-149 35.1066 38.0 36.0 38.0 31.0 38.0 150 29.59725 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 4.0 20 3.0 21 6.0 22 3.0 23 7.0 24 4.0 25 12.0 26 13.0 27 18.0 28 26.0 29 39.0 30 43.0 31 36.0 32 68.0 33 102.0 34 131.0 35 232.0 36 561.0 37 2686.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.4 11.425 10.174999999999999 39.0 2 23.223223223223226 15.69069069069069 34.134134134134136 26.95195195195195 3 20.1 19.975 25.6 34.325 4 23.974999999999998 28.4 23.325000000000003 24.3 5 21.85 34.25 23.575 20.325 6 17.5 36.449999999999996 23.849999999999998 22.2 7 13.522494887525562 26.380368098159508 42.305725971370144 17.791411042944784 8 17.625 24.099999999999998 32.125 26.150000000000002 9 18.0 23.7 33.5 24.8 10-14 19.5 29.75 27.115000000000002 23.635 15-19 19.68 28.765 27.665 23.89 20-24 19.885 28.645 28.015 23.455000000000002 25-29 19.48 28.804999999999996 28.18 23.535 30-34 20.005 29.07 27.584999999999997 23.34 35-39 19.325 29.53 27.46 23.685000000000002 40-44 19.865 29.4 27.3 23.435 45-49 19.88 28.785 27.900000000000002 23.435 50-54 20.055 29.134999999999998 27.650000000000002 23.16 55-59 19.836942930025508 28.70504676636823 27.049467313559745 24.408542990046517 60-64 20.294999999999998 28.7 27.310000000000002 23.695 65-69 19.425 28.720000000000002 27.615000000000002 24.240000000000002 70-74 19.919999999999998 28.65 27.62 23.810000000000002 75-79 20.135 28.28 27.744999999999997 23.84 80-84 19.765 28.42 27.41 24.404999999999998 85-89 20.085 28.754999999999995 27.76 23.400000000000002 90-94 20.025000000000002 28.255000000000003 27.395000000000003 24.325 95-99 19.88 28.49 27.825 23.805 100-104 20.54 28.705000000000002 27.725 23.03 105-109 20.165 29.005 26.974999999999998 23.855 110-114 20.27 29.03 27.12 23.580000000000002 115-119 20.155 28.67 27.365000000000002 23.810000000000002 120-124 20.395 28.475 27.139999999999997 23.990000000000002 125-129 20.27 28.689999999999998 26.810000000000002 24.23 130-134 19.960988296488946 28.88366509952986 27.108132439731918 24.047214164249276 135-139 20.244999999999997 28.794999999999998 26.905 24.055 140-144 20.302181308785272 28.912347408445065 26.425855513307983 24.359615769461676 145-149 21.135 28.965000000000003 26.39 23.51 150 21.823692851730232 27.810053043697902 26.54710785551907 23.819146249052793 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.5 24 3.5 25 3.0 26 5.0 27 9.5 28 9.0 29 11.0 30 18.0 31 26.5 32 30.5 33 40.5 34 62.5 35 74.5 36 90.5 37 131.0 38 156.0 39 165.5 40 192.5 41 212.5 42 238.5 43 248.5 44 252.0 45 263.0 46 250.0 47 257.5 48 242.0 49 206.5 50 178.5 51 142.5 52 119.0 53 92.0 54 72.0 55 52.5 56 30.5 57 26.5 58 20.0 59 14.5 60 12.0 61 8.5 62 9.5 63 5.5 64 2.5 65 5.0 66 4.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 2.1999999999999997 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.034999999999999996 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.03 135-139 0.0 140-144 0.06 145-149 0.0 150 1.0250000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.9875 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 2.85 0.0 0.0 0.0 0.0 120-121 3.175 0.0 0.0 0.0 0.0 122-123 3.5125 0.0 0.0 0.0 0.0 124-125 3.9375 0.0 0.0 0.0 0.0 126-127 4.25 0.0 0.0 0.0 0.0 128-129 4.5375 0.0 0.0 0.0 0.0 130-131 4.7625 0.0 0.0 0.0 0.0 132-133 5.0625 0.0 0.0 0.0 0.0 134-135 5.725 0.0 0.0 0.0 0.0 136-137 6.2125 0.0 0.0 0.0 0.0 138 6.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCCAA 10 0.0064824508 147.51282 5 >>END_MODULE SRR4237632 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237632_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3305 33.0 33.0 34.0 31.0 34.0 2 32.74525 33.0 33.0 34.0 32.0 34.0 3 32.78025 34.0 33.0 34.0 32.0 34.0 4 31.26225 33.0 32.0 34.0 25.0 34.0 5 32.33 33.0 33.0 34.0 31.0 34.0 6 36.8055 38.0 38.0 38.0 36.0 38.0 7 36.96275 38.0 38.0 38.0 36.0 38.0 8 37.08275 38.0 38.0 38.0 36.0 38.0 9 36.9815 38.0 38.0 38.0 36.0 38.0 10-14 37.052949999999996 38.0 38.0 38.0 36.4 38.0 15-19 37.026799999999994 38.0 38.0 38.0 36.4 38.0 20-24 37.026450000000004 38.0 38.0 38.0 36.4 38.0 25-29 37.01325 38.0 38.0 38.0 36.6 38.0 30-34 36.9979 38.0 38.0 38.0 36.0 38.0 35-39 36.986599999999996 38.0 38.0 38.0 36.0 38.0 40-44 36.9832 38.0 38.0 38.0 36.4 38.0 45-49 36.942449999999994 38.0 38.0 38.0 36.2 38.0 50-54 36.4584 38.0 38.0 38.0 34.2 38.0 55-59 36.80309999999999 38.0 38.0 38.0 35.8 38.0 60-64 36.85455 38.0 38.0 38.0 36.0 38.0 65-69 36.46235 38.0 37.8 38.0 34.4 38.0 70-74 36.63915000000001 38.0 38.0 38.0 35.2 38.0 75-79 36.646100000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.54540000000001 38.0 38.0 38.0 35.4 38.0 85-89 36.51180000000001 38.0 38.0 38.0 35.0 38.0 90-94 36.51285 38.0 38.0 38.0 35.0 38.0 95-99 36.4762 38.0 38.0 38.0 35.0 38.0 100-104 36.33710000000001 38.0 38.0 38.0 34.6 38.0 105-109 36.33245 38.0 38.0 38.0 34.2 38.0 110-114 36.24195 38.0 38.0 38.0 34.0 38.0 115-119 36.142250000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.05885 38.0 38.0 38.0 33.8 38.0 125-129 35.866400000000006 38.0 38.0 38.0 33.4 38.0 130-134 35.7602 38.0 38.0 38.0 33.0 38.0 135-139 35.7257 38.0 38.0 38.0 33.0 38.0 140-144 35.36325000000001 38.0 37.6 38.0 31.6 38.0 145-149 34.79735 38.0 36.4 38.0 30.6 38.0 150 28.77225 35.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 0.0 5 2.0 6 3.0 7 2.0 8 3.0 9 4.0 10 3.0 11 5.0 12 3.0 13 1.0 14 3.0 15 4.0 16 6.0 17 2.0 18 2.0 19 4.0 20 6.0 21 6.0 22 10.0 23 5.0 24 19.0 25 12.0 26 17.0 27 26.0 28 28.0 29 29.0 30 29.0 31 64.0 32 62.0 33 87.0 34 88.0 35 184.0 36 359.0 37 2916.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.35131744040151 20.30112923462986 12.521957340025095 26.82559598494354 2 28.549999999999997 26.224999999999998 30.675 14.549999999999999 3 21.425 29.475 28.775000000000002 20.325 4 25.775 34.275 22.75 17.2 5 25.224999999999998 36.9 22.8 15.075 6 20.549999999999997 38.6 23.525 17.325 7 20.025000000000002 20.525 40.45 19.0 8 20.974999999999998 25.55 29.95 23.525 9 23.474999999999998 23.724999999999998 30.599999999999998 22.2 10-14 24.11 28.825 26.655 20.41 15-19 23.71618580929046 27.85139256962848 28.056402820141006 20.376018800940045 20-24 23.552355235523553 27.912791279127912 28.172817281728175 20.362036203620363 25-29 23.8247649529906 28.025605121024206 27.50550110022004 20.644128825765154 30-34 23.308496274441165 27.819172875931393 28.22423363504526 20.648097214582187 35-39 23.165057287236703 27.92815329964477 28.55355981387902 20.353229599239505 40-44 23.592694520890667 27.545659244433324 28.34125594195647 20.52039029271954 45-49 23.386693346673336 28.36418209104552 28.124062031015505 20.125062531265634 50-54 22.899654325935575 28.215019287610843 28.17995090426331 20.705375482190274 55-59 23.112735282338807 27.65818982779335 29.04985983179816 20.179215058069683 60-64 23.424911174498323 28.063854276134713 27.97878196466997 20.53245258469699 65-69 23.6565595917142 27.639347543280294 28.114680276193337 20.58941258881217 70-74 23.811430287258535 27.444700230207186 28.48563707336603 20.25823240916825 75-79 23.38943993587817 27.923053802224224 28.173529706442242 20.513976555455365 80-84 23.560314204232753 27.412818331915744 27.778055736228545 21.248811727622954 85-89 23.802852139104328 27.425569176882664 28.741556167125342 20.030022516887666 90-94 23.871484335902313 27.43469122209989 28.415574016614954 20.278250425382844 95-99 23.573859087269817 26.566253002401925 29.17333867093675 20.686549239391514 100-104 24.027826435113358 27.23587408037636 28.537110254742004 20.19918922976828 105-109 23.802612481857764 27.446073770081576 28.677243381212154 20.074070366848506 110-114 24.327573253193087 27.923866766841975 27.943901828199348 19.80465815176559 115-119 23.836219841826008 27.960756832515766 27.83061367504255 20.372409650615676 120-124 24.05709992486852 27.59328825444528 28.034059604307537 20.315552216378663 125-129 24.60067097291072 27.18942466576536 27.935506484402385 20.274397876921533 130-134 24.662263584509155 27.409186430501354 28.194736315420794 19.733813669568697 135-139 24.714714714714713 27.8978978978979 27.57757757757758 19.80980980980981 140-144 24.946161165923776 28.266639955927282 27.475334301597638 19.31186457655131 145-149 25.108984316280004 28.24572831587914 26.58716239915819 20.058124968682666 150 25.808068153345026 26.935605111500877 28.313705838135807 18.94262089701829 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.5 24 2.0 25 4.5 26 6.0 27 6.5 28 8.0 29 7.5 30 10.0 31 18.5 32 31.0 33 42.5 34 42.0 35 58.0 36 83.0 37 107.0 38 128.5 39 158.0 40 207.0 41 236.5 42 254.5 43 275.5 44 286.0 45 279.5 46 267.0 47 253.0 48 245.0 49 216.5 50 175.0 51 153.5 52 117.5 53 75.0 54 57.5 55 46.5 56 32.5 57 27.0 58 22.0 59 15.0 60 8.5 61 4.5 62 5.0 63 5.5 64 3.5 65 2.0 66 2.5 67 2.5 68 1.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.01 25-29 0.02 30-34 0.015 35-39 0.065 40-44 0.075 45-49 0.05 50-54 0.19499999999999998 55-59 0.12 60-64 0.08499999999999999 65-69 0.06999999999999999 70-74 0.09 75-79 0.19 80-84 0.065 85-89 0.075 90-94 0.09 95-99 0.08 100-104 0.095 105-109 0.095 110-114 0.17500000000000002 115-119 0.11 120-124 0.17500000000000002 125-129 0.145 130-134 0.06999999999999999 135-139 0.1 140-144 0.165 145-149 0.215 150 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.4874999999999998 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 2.8875 0.0 0.0 0.0 0.0 120-121 3.225 0.0 0.0 0.0 0.0 122-123 3.5875 0.0 0.0 0.0 0.0 124-125 4.0125 0.0 0.0 0.0 0.0 126-127 4.3375 0.0 0.0 0.0 0.0 128-129 4.6 0.0 0.0 0.0 0.0 130-131 4.8125 0.0 0.0 0.0 0.0 132-133 5.125 0.0 0.0 0.0 0.0 134-135 5.8 0.0 0.0 0.0 0.0 136-137 6.2875 0.0 0.0 0.0 0.0 138 6.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3051006 spots for SRR4237632.sra Written 3051006 spots for SRR4237632.sra Read 3051006 spots for SRR4237632.sra Written 3051006 spots for SRR4237632.sra Read 3051006 spots for SRR4237632.sra Written 3051006 spots for SRR4237632.sra Read 3051006 spots for SRR4237632.sra Written 3051006 spots for SRR4237632.sra Read 3051006 spots for SRR4237632.sra Written 3051006 spots for SRR4237632.sra Read 3051006 spots for SRR4237632.sra Written 3051006 spots for SRR4237632.sra Read 3051006 spots for SRR4237632.sra Written 3051006 spots for SRR4237632.sra Read 3051006 spots for SRR4237632.sra Written 3051006 spots for SRR4237632.sra Read 3051006 spots for SRR4237632.sra Written 3051006 spots for SRR4237632.sra Read 3051024 spots for SRR4237632.sra Written 3051024 spots for SRR4237632.sra Read 3051006 spots for SRR4237632.sra Written 3051006 spots for SRR4237632.sra Read 3051006 spots for SRR4237632.sra Written 3051006 spots for SRR4237632.sra Read 3051006 spots for SRR4237632.sra Written 3051006 spots for SRR4237632.sra Read 3051006 spots for SRR4237632.sra Written 3051006 spots for SRR4237632.sra Read 3051006 spots for SRR4237632.sra Written 3051006 spots for SRR4237632.sra Read 3051006 spots for SRR4237632.sra Written 3051006 spots for SRR4237632.sra Read 3051006 spots for SRR4237632.sra Written 3051006 spots for SRR4237632.sra Read 3051006 spots for SRR4237632.sra Written 3051006 spots for SRR4237632.sra Read 3051006 spots for SRR4237632.sra Written 3051006 spots for SRR4237632.sra Read 3051006 spots for SRR4237632.sra Written 3051006 spots for SRR4237632.sra SRR ids: ['SRR4237632.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_244h66_6 SRR4237632.sra spots: 61020138 blocks: [[1, 3051006], [3051007, 6102012], [6102013, 9153018], [9153019, 12204024], [12204025, 15255030], [15255031, 18306036], [18306037, 21357042], [21357043, 24408048], [24408049, 27459054], [27459055, 30510060], [30510061, 33561066], [33561067, 36612072], [36612073, 39663078], [39663079, 42714084], [42714085, 45765090], [45765091, 48816096], [48816097, 51867102], [51867103, 54918108], [54918109, 57969114], [57969115, 61020138]] SRR4237632 file size 20536842 SRR4237632 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237632 SRR4237632_1.fastq SRR4237632_2.fastq Input file: SRR4237632_1.fastq Paired file: SRR4237632_2.fastq trimmed: SRR4237632-trimmed-pair1.fastq, SRR4237632-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:53:47 2025 >> started Wed Feb 12 18:54:49 2025 >> done (62.390s) 61020138 read pairs processed; of these: 94185 ( 0.15%) short read pairs filtered out after trimming by size control 36910 ( 0.06%) empty read pairs filtered out after trimming by size control 60889043 (99.79%) read pairs available; of these: 20686392 (33.97%) trimmed read pairs available after processing 40202651 (66.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 11 0.00% 20 8 0.00% 21 5 0.00% 22 9 0.00% 23 10 0.00% 24 21 0.00% 25 13 0.00% 26 19 0.00% 27 30 0.00% 28 19 0.00% 29 16 0.00% 30 24 0.00% 31 33 0.00% 32 37 0.00% 33 28 0.00% 34 27 0.00% 35 38 0.00% 36 41 0.00% 37 56 0.00% 38 55 0.00% 39 52 0.00% 40 64 0.00% 41 95 0.00% 42 68 0.00% 43 118 0.00% 44 95 0.00% 45 114 0.00% 46 125 0.00% 47 128 0.00% 48 160 0.00% 49 206 0.00% 50 197 0.00% 51 228 0.00% 52 241 0.00% 53 295 0.00% 54 323 0.00% 55 361 0.00% 56 398 0.00% 57 451 0.00% 58 497 0.00% 59 605 0.00% 60 697 0.00% 61 791 0.00% 62 903 0.00% 63 973 0.00% 64 1110 0.00% 65 1327 0.00% 66 1573 0.00% 67 1612 0.00% 68 2109 0.00% 69 4678 0.01% 70 4780 0.01% 71 3436 0.01% 72 3418 0.01% 73 3564 0.01% 74 3980 0.01% 75 4360 0.01% 76 4973 0.01% 77 5312 0.01% 78 5946 0.01% 79 6659 0.01% 80 7678 0.01% 81 8678 0.01% 82 9923 0.02% 83 12084 0.02% 84 30361 0.05% 85 29972 0.05% 86 19680 0.03% 87 21150 0.03% 88 23139 0.04% 89 27912 0.05% 90 29571 0.05% 91 30305 0.05% 92 44023 0.07% 93 32400 0.05% 94 37916 0.06% 95 39195 0.06% 96 41568 0.07% 97 42929 0.07% 98 45361 0.07% 99 49232 0.08% 100 51631 0.08% 101 55169 0.09% 102 58680 0.10% 103 62288 0.10% 104 66851 0.11% 105 71055 0.12% 106 75261 0.12% 107 79261 0.13% 108 83145 0.14% 109 86840 0.14% 110 89212 0.15% 111 94380 0.16% 112 98888 0.16% 113 103657 0.17% 114 109540 0.18% 115 114055 0.19% 116 118505 0.19% 117 124280 0.20% 118 130024 0.21% 119 134528 0.22% 120 136046 0.22% 121 140749 0.23% 122 145593 0.24% 123 150542 0.25% 124 155494 0.26% 125 160774 0.26% 126 167394 0.27% 127 174240 0.29% 128 179928 0.30% 129 184905 0.30% 130 190494 0.31% 131 194716 0.32% 132 202367 0.33% 133 208795 0.34% 134 215221 0.35% 135 225088 0.37% 136 234325 0.38% 137 244374 0.40% 138 256676 0.42% 139 269950 0.44% 140 285111 0.47% 141 303271 0.50% 142 330194 0.54% 143 358979 0.59% 144 404751 0.66% 145 474075 0.78% 146 587673 0.97% 147 808386 1.33% 148 1446458 2.38% 149 9391960 15.42% 150 40202651 66.03% 60889043 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=37 prefix-density=0.15 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=9 fanout-score=109.39 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=19.7 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=7.28 fanout-score-rank=19 prefix-density=0.25 prefix-fanout=4.7 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=29 fanout-score=269.62 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=27.6 sequence=GAAGAAGAAGAAA SRR4237632 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:55:33 Started mapping on | Feb 12 18:55:33 Finished on | Feb 12 19:00:16 Mapping speed, Million of reads per hour | 774.56 Number of input reads | 60889043 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 58756416 Uniquely mapped reads % | 96.50% Average mapped length | 292.31 Number of splices: Total | 54495743 Number of splices: Annotated (sjdb) | 53573095 Number of splices: GT/AG | 53676426 Number of splices: GC/AG | 642330 Number of splices: AT/AC | 49262 Number of splices: Non-canonical | 127725 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1195896 % of reads mapped to multiple loci | 1.96% Number of reads mapped to too many loci | 90990 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.36% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 997053 997053 997053 N_multimapping 1195896 1195896 1195896 N_noFeature 1590612 58084935 1951216 N_ambiguous 561018 3222 247768 UnstrandedReadsAssigned:56604786 PositiveStrandReadsAssigned:668259 NegativeStrandReadsAssigned:56557432 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237632 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237632-trimmed-pair1.fastq SRR4237632-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 60,889,043 reads, 56,139,922 reads pseudoaligned [quant] estimated average fragment length: 232.098 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,309 rounds 52401 SRR4237632.ke.tsv 34699 SRR4237632.se.tsv 87100 total ==> SRR4237632.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.9 1317 13.7015 Potri.005G024800.1.v4.1 1035 803.902 117 2.70561 Potri.004G059700.1.v4.1 961 729.952 69 1.75727 Potri.007G009000.2.v4.1 1416 1184.9 0 0 Potri.003G141000.2.v4.1 2943 2711.9 846.137 5.80029 Potri.016G087400.1.v4.1 270 84.7306 5637 1236.78 Potri.015G069301.1.v4.1 564 337.348 0 0 Potri.010G195200.1.v4.1 1773 1541.9 157 1.89289 Potri.012G127500.1.v4.1 977 745.93 16635 414.579 ==> SRR4237632.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4810 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 757 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 39 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR4237632 completed mapping pipeline successfully