Starting /dee2/code/volunteer_pipeline.sh SRR4237633 current disk space = 3051355844608 free memory = 1455331500 SRR4237633 SRAfilesize 7d4320dc6cb8d87df6c52133b16ecafe SRR4237633.sra SRR4237633.sra file validated SRR4237633 is paired end SRR4237633 is conventional basespace SRR4237633 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237633_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.215 34.0 33.0 34.0 33.0 34.0 2 33.35175 34.0 33.0 34.0 33.0 34.0 3 33.4215 34.0 33.0 34.0 33.0 34.0 4 33.3605 34.0 33.0 34.0 33.0 34.0 5 33.4025 34.0 34.0 34.0 33.0 34.0 6 30.839 38.0 35.0 38.0 2.0 38.0 7 35.83425 38.0 36.0 38.0 30.0 38.0 8 36.1965 38.0 37.0 38.0 30.0 38.0 9 37.18725 38.0 37.0 38.0 36.0 38.0 10-14 37.4704 38.0 38.0 38.0 37.6 38.0 15-19 37.484449999999995 38.0 38.0 38.0 37.8 38.0 20-24 37.4029 38.0 38.0 38.0 37.2 38.0 25-29 37.385349999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.3849 38.0 38.0 38.0 37.0 38.0 35-39 37.398199999999996 38.0 38.0 38.0 37.4 38.0 40-44 37.278150000000004 38.0 38.0 38.0 36.8 38.0 45-49 37.28715 38.0 38.0 38.0 37.0 38.0 50-54 37.26649999999999 38.0 38.0 38.0 36.8 38.0 55-59 37.0929 38.0 38.0 38.0 36.2 38.0 60-64 37.18 38.0 38.0 38.0 37.0 38.0 65-69 37.17275 38.0 38.0 38.0 36.2 38.0 70-74 37.145599999999995 38.0 38.0 38.0 36.2 38.0 75-79 37.107749999999996 38.0 38.0 38.0 36.2 38.0 80-84 37.0461 38.0 38.0 38.0 36.0 38.0 85-89 36.82725000000001 38.0 38.0 38.0 35.4 38.0 90-94 36.92765000000001 38.0 38.0 38.0 36.0 38.0 95-99 36.880849999999995 38.0 38.0 38.0 35.6 38.0 100-104 36.8112 38.0 38.0 38.0 35.2 38.0 105-109 36.47475 38.0 37.8 38.0 34.0 38.0 110-114 36.55159999999999 38.0 38.0 38.0 34.2 38.0 115-119 36.513250000000006 38.0 38.0 38.0 34.6 38.0 120-124 36.53075 38.0 38.0 38.0 34.2 38.0 125-129 36.3872 38.0 38.0 38.0 34.2 38.0 130-134 36.35525 38.0 38.0 38.0 34.2 38.0 135-139 36.189 38.0 38.0 38.0 33.4 38.0 140-144 35.888400000000004 38.0 37.6 38.0 32.8 38.0 145-149 34.4615 38.0 35.4 38.0 26.6 38.0 150 30.99825 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 3.0 20 0.0 21 6.0 22 2.0 23 7.0 24 6.0 25 9.0 26 13.0 27 20.0 28 19.0 29 31.0 30 44.0 31 49.0 32 50.0 33 91.0 34 118.0 35 195.0 36 455.0 37 2878.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.25432222500626 11.325482335254321 9.396141317965421 44.02405412177399 2 21.275 15.25 36.55 26.924999999999997 3 19.425 18.75 26.674999999999997 35.15 4 22.8 28.7 21.725 26.775 5 20.974999999999998 34.325 24.925 19.775000000000002 6 16.90909090909091 36.878787878787875 25.272727272727273 20.939393939393938 7 13.950000000000001 25.95 42.05 18.05 8 17.0 25.974999999999998 32.375 24.65 9 16.575 23.474999999999998 35.025 24.925 10-14 19.755 30.380000000000003 26.505000000000003 23.36 15-19 19.335 29.325000000000003 27.355 23.985 20-24 19.865 29.205 27.495000000000005 23.435 25-29 19.48 30.064999999999998 27.045 23.41 30-34 19.175 29.054999999999996 27.395000000000003 24.375 35-39 19.415 29.325000000000003 27.42 23.84 40-44 19.375 28.845 27.810000000000002 23.97 45-49 19.46 28.685 27.810000000000002 24.044999999999998 50-54 20.035 28.994999999999997 27.295 23.674999999999997 55-59 19.885 28.665000000000003 27.565 23.885 60-64 19.835 29.43 26.99 23.745 65-69 19.86 28.705000000000002 27.395000000000003 24.04 70-74 20.44 28.515 27.58 23.465 75-79 19.7 28.910000000000004 27.465 23.925 80-84 20.44 28.4 27.465 23.695 85-89 20.335 28.665000000000003 27.74 23.26 90-94 19.580000000000002 29.270000000000003 27.16 23.990000000000002 95-99 20.015 28.825 27.57 23.59 100-104 20.41 29.2 27.155 23.235 105-109 19.97 29.25 27.155 23.625 110-114 20.125 28.76 27.515 23.599999999999998 115-119 20.31 28.88 27.1 23.71 120-124 20.215 28.810000000000002 26.979999999999997 23.995 125-129 20.825 28.525 27.345000000000002 23.305 130-134 20.525 28.92 27.095000000000002 23.46 135-139 20.805 28.565 26.75 23.880000000000003 140-144 21.175 28.1 27.084999999999997 23.64 145-149 20.965 29.195 26.265 23.575 150 21.575 26.85 27.650000000000002 23.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 2.0 21 1.0 22 1.0 23 0.5 24 2.0 25 4.5 26 7.0 27 11.5 28 12.5 29 12.5 30 22.5 31 30.5 32 36.0 33 45.0 34 54.5 35 70.5 36 102.0 37 125.5 38 142.0 39 155.0 40 182.0 41 225.0 42 243.5 43 251.0 44 270.0 45 275.5 46 259.0 47 257.5 48 240.0 49 193.0 50 158.5 51 147.0 52 121.5 53 85.5 54 61.5 55 44.5 56 33.5 57 28.5 58 23.5 59 17.0 60 12.5 61 7.0 62 4.5 63 4.0 64 2.5 65 2.0 66 3.0 67 2.5 68 2.5 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 17.5 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.2999999999999998 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.8 0.0 0.0 0.0 0.0 116-117 2.025 0.0 0.0 0.0 0.0 118-119 2.2375 0.0 0.0 0.0 0.0 120-121 2.4000000000000004 0.0 0.0 0.0 0.0 122-123 2.7375 0.0 0.0 0.0 0.0 124-125 3.25 0.0 0.0 0.0 0.0 126-127 3.6375 0.0 0.0 0.0 0.0 128-129 4.1375 0.0 0.0 0.0 0.0 130-131 4.4 0.0 0.0 0.0 0.0 132-133 5.012499999999999 0.0 0.0 0.0 0.0 134-135 5.5875 0.0 0.0 0.0 0.0 136-137 6.05 0.0 0.0 0.0 0.0 138 6.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTCAA 10 0.007195433 142.5 9 >>END_MODULE SRR4237633 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237633_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7325 33.0 33.0 34.0 32.0 34.0 2 32.9655 34.0 33.0 34.0 32.0 34.0 3 32.94675 34.0 33.0 34.0 32.0 34.0 4 32.9985 34.0 33.0 34.0 32.0 34.0 5 32.38675 33.0 33.0 34.0 31.0 34.0 6 36.928 38.0 38.0 38.0 36.0 38.0 7 37.017 38.0 38.0 38.0 36.0 38.0 8 36.9055 38.0 38.0 38.0 36.0 38.0 9 37.0425 38.0 38.0 38.0 36.0 38.0 10-14 36.970349999999996 38.0 38.0 38.0 36.0 38.0 15-19 37.09485000000001 38.0 38.0 38.0 37.0 38.0 20-24 36.9146 38.0 38.0 38.0 35.8 38.0 25-29 37.101350000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.0626 38.0 38.0 38.0 37.0 38.0 35-39 37.06395 38.0 38.0 38.0 36.6 38.0 40-44 37.0382 38.0 38.0 38.0 36.4 38.0 45-49 36.973699999999994 38.0 38.0 38.0 36.2 38.0 50-54 36.663 38.0 38.0 38.0 34.8 38.0 55-59 36.1195 38.0 37.0 38.0 30.8 38.0 60-64 36.844500000000004 38.0 38.0 38.0 35.8 38.0 65-69 36.88835 38.0 38.0 38.0 36.0 38.0 70-74 36.8759 38.0 38.0 38.0 36.0 38.0 75-79 36.88215 38.0 38.0 38.0 36.0 38.0 80-84 36.846500000000006 38.0 38.0 38.0 36.0 38.0 85-89 36.77725 38.0 38.0 38.0 36.0 38.0 90-94 36.628400000000006 38.0 38.0 38.0 35.4 38.0 95-99 36.61945 38.0 38.0 38.0 35.4 38.0 100-104 35.4155 38.0 36.0 38.0 29.4 38.0 105-109 35.91185 38.0 37.4 38.0 31.2 38.0 110-114 36.43825 38.0 38.0 38.0 34.4 38.0 115-119 36.41585 38.0 38.0 38.0 34.2 38.0 120-124 36.274150000000006 38.0 38.0 38.0 34.0 38.0 125-129 36.1469 38.0 38.0 38.0 33.8 38.0 130-134 35.592949999999995 38.0 37.4 38.0 31.8 38.0 135-139 35.42595 38.0 37.0 38.0 31.4 38.0 140-144 34.1527 38.0 34.2 38.0 25.2 38.0 145-149 34.807449999999996 38.0 37.6 38.0 27.8 38.0 150 28.32325 33.0 26.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 2.0 5 0.0 6 2.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.0 14 1.0 15 2.0 16 7.0 17 1.0 18 3.0 19 7.0 20 4.0 21 7.0 22 7.0 23 12.0 24 13.0 25 14.0 26 23.0 27 29.0 28 25.0 29 49.0 30 32.0 31 53.0 32 73.0 33 81.0 34 113.0 35 205.0 36 435.0 37 2790.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.075 19.400000000000002 13.225000000000001 30.3 2 26.3 25.5 33.75 14.45 3 21.275 28.199999999999996 29.775000000000002 20.75 4 24.45 33.675 23.625 18.25 5 25.900000000000002 35.199999999999996 23.599999999999998 15.299999999999999 6 19.875 37.7 24.375 18.05 7 18.675 20.150000000000002 41.55 19.625 8 21.45 24.474999999999998 29.375 24.7 9 22.6 24.525 30.599999999999998 22.275 10-14 23.73 28.83 26.365 21.075 15-19 23.544999999999998 28.294999999999998 27.85 20.31 20-24 23.485 28.34 27.365000000000002 20.810000000000002 25-29 23.315 27.99 28.02 20.674999999999997 30-34 23.35 27.18 28.64 20.830000000000002 35-39 22.935 27.634999999999998 28.275 21.154999999999998 40-44 23.23 28.299999999999997 27.92 20.549999999999997 45-49 23.605 28.645 27.589999999999996 20.16 50-54 23.73 27.465 28.249999999999996 20.555 55-59 23.830000000000002 28.249999999999996 27.58 20.34 60-64 24.015 27.58 28.57 19.835 65-69 23.28 27.685 28.305000000000003 20.73 70-74 23.71 28.38 27.845 20.064999999999998 75-79 23.205000000000002 27.675 28.810000000000002 20.31 80-84 23.855 27.275 28.62 20.25 85-89 23.11 27.544999999999998 28.634999999999998 20.71 90-94 23.23 28.02 28.249999999999996 20.5 95-99 23.400000000000002 27.284999999999997 28.804999999999996 20.51 100-104 24.349999999999998 27.575 27.565 20.51 105-109 23.810000000000002 27.894999999999996 28.035 20.26 110-114 24.175 27.55 28.310000000000002 19.965 115-119 23.89 27.445000000000004 28.965000000000003 19.7 120-124 23.25 27.689999999999998 28.77 20.29 125-129 24.125 27.685 28.205000000000002 19.985 130-134 24.279999999999998 28.060000000000002 27.325 20.335 135-139 24.6 27.6 28.03 19.77 140-144 24.610000000000003 28.16 27.705000000000002 19.525000000000002 145-149 25.990000000000002 27.37 27.439999999999998 19.2 150 25.45 27.075 27.725 19.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 1.0 23 2.5 24 2.5 25 3.0 26 3.5 27 4.5 28 7.0 29 8.5 30 13.5 31 19.5 32 23.0 33 39.5 34 58.5 35 64.0 36 76.5 37 99.0 38 136.0 39 166.5 40 194.0 41 228.0 42 271.0 43 283.5 44 272.0 45 271.5 46 286.5 47 279.0 48 233.0 49 200.0 50 173.5 51 130.0 52 103.5 53 90.5 54 64.5 55 53.5 56 41.0 57 29.0 58 19.0 59 11.0 60 8.5 61 7.0 62 4.0 63 3.5 64 3.5 65 2.5 66 0.5 67 2.0 68 2.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 1.975 0.0 0.0 0.0 0.0 118-119 2.1875 0.0 0.0 0.0 0.0 120-121 2.3499999999999996 0.0 0.0 0.0 0.0 122-123 2.6875 0.0 0.0 0.0 0.0 124-125 3.2 0.0 0.0 0.0 0.0 126-127 3.6125 0.0 0.0 0.0 0.0 128-129 4.1625 0.0 0.0 0.0 0.0 130-131 4.4 0.0 0.0 0.0 0.0 132-133 4.987500000000001 0.0 0.0 0.0 0.0 134-135 5.550000000000001 0.0 0.0 0.0 0.0 136-137 6.025 0.0 0.0 0.0 0.0 138 6.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3487562 spots for SRR4237633.sra Written 3487562 spots for SRR4237633.sra Read 3487562 spots for SRR4237633.sra Written 3487562 spots for SRR4237633.sra Read 3487562 spots for SRR4237633.sra Written 3487562 spots for SRR4237633.sra Read 3487562 spots for SRR4237633.sra Written 3487562 spots for SRR4237633.sra Read 3487562 spots for SRR4237633.sra Written 3487562 spots for SRR4237633.sra Read 3487562 spots for SRR4237633.sra Written 3487562 spots for SRR4237633.sra Read 3487562 spots for SRR4237633.sra Written 3487562 spots for SRR4237633.sra Read 3487562 spots for SRR4237633.sra Written 3487562 spots for SRR4237633.sra Read 3487562 spots for SRR4237633.sra Written 3487562 spots for SRR4237633.sra Read 3487562 spots for SRR4237633.sra Written 3487562 spots for SRR4237633.sra Read 3487562 spots for SRR4237633.sra Written 3487562 spots for SRR4237633.sra Read 3487562 spots for SRR4237633.sra Written 3487562 spots for SRR4237633.sra Read 3487562 spots for SRR4237633.sra Written 3487562 spots for SRR4237633.sra Read 3487562 spots for SRR4237633.sra Written 3487562 spots for SRR4237633.sra Read 3487562 spots for SRR4237633.sra Written 3487562 spots for SRR4237633.sra Read 3487562 spots for SRR4237633.sra Written 3487562 spots for SRR4237633.sra Read 3487562 spots for SRR4237633.sra Written 3487562 spots for SRR4237633.sra Read 3487562 spots for SRR4237633.sra Written 3487562 spots for SRR4237633.sra Read 3487572 spots for SRR4237633.sra Written 3487572 spots for SRR4237633.sra Read 3487562 spots for SRR4237633.sra Written 3487562 spots for SRR4237633.sra SRR ids: ['SRR4237633.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p1ryrt_9 SRR4237633.sra spots: 69751250 blocks: [[1, 3487562], [3487563, 6975124], [6975125, 10462686], [10462687, 13950248], [13950249, 17437810], [17437811, 20925372], [20925373, 24412934], [24412935, 27900496], [27900497, 31388058], [31388059, 34875620], [34875621, 38363182], [38363183, 41850744], [41850745, 45338306], [45338307, 48825868], [48825869, 52313430], [52313431, 55800992], [55800993, 59288554], [59288555, 62776116], [62776117, 66263678], [66263679, 69751250]] SRR4237633 file size 23478476 SRR4237633 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237633 SRR4237633_1.fastq SRR4237633_2.fastq Input file: SRR4237633_1.fastq Paired file: SRR4237633_2.fastq trimmed: SRR4237633-trimmed-pair1.fastq, SRR4237633-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:43:13 2025 >> started Wed Feb 12 18:44:36 2025 >> done (83.078s) 69751250 read pairs processed; of these: 97349 ( 0.14%) short read pairs filtered out after trimming by size control 31699 ( 0.05%) empty read pairs filtered out after trimming by size control 69622202 (99.81%) read pairs available; of these: 23513478 (33.77%) trimmed read pairs available after processing 46108724 (66.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 7 0.00% 20 11 0.00% 21 8 0.00% 22 8 0.00% 23 7 0.00% 24 10 0.00% 25 9 0.00% 26 11 0.00% 27 12 0.00% 28 13 0.00% 29 23 0.00% 30 16 0.00% 31 27 0.00% 32 25 0.00% 33 18 0.00% 34 35 0.00% 35 20 0.00% 36 32 0.00% 37 42 0.00% 38 57 0.00% 39 44 0.00% 40 64 0.00% 41 69 0.00% 42 61 0.00% 43 95 0.00% 44 81 0.00% 45 88 0.00% 46 107 0.00% 47 119 0.00% 48 130 0.00% 49 152 0.00% 50 157 0.00% 51 185 0.00% 52 216 0.00% 53 231 0.00% 54 266 0.00% 55 316 0.00% 56 324 0.00% 57 404 0.00% 58 352 0.00% 59 465 0.00% 60 494 0.00% 61 580 0.00% 62 699 0.00% 63 746 0.00% 64 823 0.00% 65 989 0.00% 66 1044 0.00% 67 1279 0.00% 68 1443 0.00% 69 3503 0.01% 70 3092 0.00% 71 2134 0.00% 72 2223 0.00% 73 2640 0.00% 74 2723 0.00% 75 3234 0.00% 76 3609 0.01% 77 3985 0.01% 78 4368 0.01% 79 4824 0.01% 80 5773 0.01% 81 6429 0.01% 82 7458 0.01% 83 9229 0.01% 84 24624 0.04% 85 15355 0.02% 86 18361 0.03% 87 19908 0.03% 88 19223 0.03% 89 18442 0.03% 90 22365 0.03% 91 25079 0.04% 92 27618 0.04% 93 28070 0.04% 94 29009 0.04% 95 30725 0.04% 96 33525 0.05% 97 36034 0.05% 98 38845 0.06% 99 41289 0.06% 100 45041 0.06% 101 47902 0.07% 102 51447 0.07% 103 56159 0.08% 104 59436 0.09% 105 64082 0.09% 106 68984 0.10% 107 72657 0.10% 108 76941 0.11% 109 82066 0.12% 110 85558 0.12% 111 89753 0.13% 112 95694 0.14% 113 100319 0.14% 114 105990 0.15% 115 112804 0.16% 116 118199 0.17% 117 124626 0.18% 118 132729 0.19% 119 137287 0.20% 120 138788 0.20% 121 145702 0.21% 122 149428 0.21% 123 155868 0.22% 124 163479 0.23% 125 170571 0.24% 126 176763 0.25% 127 185253 0.27% 128 192706 0.28% 129 201304 0.29% 130 208060 0.30% 131 213908 0.31% 132 221308 0.32% 133 230326 0.33% 134 237308 0.34% 135 247814 0.36% 136 261074 0.37% 137 273322 0.39% 138 288572 0.41% 139 304178 0.44% 140 323484 0.46% 141 343419 0.49% 142 370783 0.53% 143 411538 0.59% 144 460443 0.66% 145 544727 0.78% 146 676583 0.97% 147 948640 1.36% 148 1682192 2.42% 149 11352142 16.31% 150 46108724 66.23% 69622202 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=83.31 fanout-score-rank=3 prefix-density=0.68 prefix-fanout=15.8 sequence=CCACCACCAACA criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=207.98 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=18.3 sequence=TCTGCTTCTTTTGGCTCTTCATGAGTTACTGCCTCTGGTGCTGCAGTGACCGCTTCTTCTGTGGTGGTCTCAACCTTGATTGGTTGTTCATTTTTTTCCTCTACAAGTGCATTCTGCGCTGACACAACCTCAACAGTGGCCATTGGAACTAGAAGGAAAATAAAGCACAGCTGGGATACAAAAGAAA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=5.14 fanout-score-rank=25 prefix-density=0.34 prefix-fanout=2.3 sequence=TGTTGAGGTTGTGTCAGCGCAGAATGCACTTGTAGAGGAAAAAAATGAACAACCAATCAAGGTTGAGACCACCACAGAAGAAGCGGTCACTGCAGCACCAGAGGCAGTAACTCATGAAGAGCCAAAAGAAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=42 fanout-score=184.68 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=15.9 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR4237633 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:45:23 Started mapping on | Feb 12 18:45:23 Finished on | Feb 12 18:52:37 Mapping speed, Million of reads per hour | 577.51 Number of input reads | 69622202 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 67056937 Uniquely mapped reads % | 96.32% Average mapped length | 293.29 Number of splices: Total | 59809795 Number of splices: Annotated (sjdb) | 58697109 Number of splices: GT/AG | 58901645 Number of splices: GC/AG | 704363 Number of splices: AT/AC | 55181 Number of splices: Non-canonical | 148606 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1369371 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 79604 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.58% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1240603 1240603 1240603 N_multimapping 1369371 1369371 1369371 N_noFeature 1987769 66268751 2397190 N_ambiguous 663614 3667 282280 UnstrandedReadsAssigned:64405554 PositiveStrandReadsAssigned:784519 NegativeStrandReadsAssigned:64377467 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237633 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237633-trimmed-pair1.fastq SRR4237633-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 69,622,202 reads, 63,933,004 reads pseudoaligned [quant] estimated average fragment length: 229.976 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,316 rounds 52401 SRR4237633.ke.tsv 34699 SRR4237633.se.tsv 87100 total ==> SRR4237633.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.02 1563 14.11 Potri.005G024800.1.v4.1 1035 806.024 138 2.76513 Potri.004G059700.1.v4.1 961 732.046 59 1.30166 Potri.007G009000.2.v4.1 1416 1187.02 0 0 Potri.003G141000.2.v4.1 2943 2714.02 965.426 5.74499 Potri.016G087400.1.v4.1 270 83.3337 6990.29 1354.75 Potri.015G069301.1.v4.1 564 338.633 0 0 Potri.010G195200.1.v4.1 1773 1544.02 324 3.38903 Potri.012G127500.1.v4.1 977 748.029 14337 309.545 ==> SRR4237633.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9186 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 1142 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 54 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR4237633 completed mapping pipeline successfully