Starting /dee2/code/volunteer_pipeline.sh SRR4237634 current disk space = 3051161288704 free memory = 1578073708 SRR4237634 SRAfilesize a7dc0aec1b0cd8dba99eacb38e60e4f5 SRR4237634.sra SRR4237634.sra file validated SRR4237634 is paired end SRR4237634 is conventional basespace SRR4237634 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237634_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3205 34.0 33.0 34.0 33.0 34.0 2 33.348 34.0 33.0 34.0 33.0 34.0 3 33.382 34.0 33.0 34.0 33.0 34.0 4 33.429 34.0 34.0 34.0 33.0 34.0 5 33.43675 34.0 33.0 34.0 33.0 34.0 6 35.34625 38.0 37.0 38.0 33.0 38.0 7 36.68875 38.0 38.0 38.0 33.0 38.0 8 37.00075 38.0 38.0 38.0 35.0 38.0 9 37.3145 38.0 38.0 38.0 37.0 38.0 10-14 37.40625 38.0 38.0 38.0 37.2 38.0 15-19 37.4645 38.0 38.0 38.0 37.0 38.0 20-24 37.357899999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.4267 38.0 38.0 38.0 37.0 38.0 30-34 37.4247 38.0 38.0 38.0 37.2 38.0 35-39 37.2204 38.0 38.0 38.0 36.8 38.0 40-44 37.3214 38.0 38.0 38.0 37.0 38.0 45-49 36.9051 38.0 38.0 38.0 35.6 38.0 50-54 37.170399999999994 38.0 38.0 38.0 36.4 38.0 55-59 37.117000000000004 38.0 38.0 38.0 36.2 38.0 60-64 37.1026 38.0 38.0 38.0 36.2 38.0 65-69 37.1 38.0 38.0 38.0 36.0 38.0 70-74 37.0793 38.0 38.0 38.0 36.0 38.0 75-79 37.0067 38.0 38.0 38.0 36.0 38.0 80-84 36.993500000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.92995 38.0 38.0 38.0 36.0 38.0 90-94 36.79875 38.0 38.0 38.0 35.2 38.0 95-99 36.80055 38.0 38.0 38.0 35.4 38.0 100-104 36.5103 38.0 38.0 38.0 34.0 38.0 105-109 36.64335 38.0 38.0 38.0 34.6 38.0 110-114 35.8559 38.0 37.0 38.0 30.6 38.0 115-119 36.292100000000005 38.0 37.8 38.0 33.8 38.0 120-124 36.410900000000005 38.0 38.0 38.0 34.0 38.0 125-129 36.26049999999999 38.0 38.0 38.0 34.0 38.0 130-134 36.23265 38.0 38.0 38.0 33.8 38.0 135-139 35.81515 38.0 36.6 38.0 32.2 38.0 140-144 35.855000000000004 38.0 37.4 38.0 33.0 38.0 145-149 35.4172 38.0 36.2 38.0 32.6 38.0 150 30.8685 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 3.0 19 1.0 20 4.0 21 4.0 22 2.0 23 3.0 24 11.0 25 10.0 26 13.0 27 16.0 28 23.0 29 23.0 30 40.0 31 49.0 32 69.0 33 93.0 34 102.0 35 209.0 36 454.0 37 2866.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.9549662246685 11.033274956217163 10.783087315486615 38.22867150362772 2 23.175 15.7 34.5 26.625 3 21.224999999999998 21.375 24.375 33.025 4 22.525000000000002 30.375000000000004 22.625 24.474999999999998 5 22.475 34.875 23.125 19.525000000000002 6 17.61467889908257 38.03407601572739 24.770642201834864 19.580602883355176 7 13.850000000000001 25.575 43.1 17.474999999999998 8 16.625 25.8 32.074999999999996 25.5 9 17.8 25.174999999999997 32.625 24.4 10-14 20.52 30.415 26.255 22.81 15-19 19.950000000000003 29.585 27.395000000000003 23.07 20-24 19.755 29.720000000000002 27.54 22.985 25-29 19.56 29.375 27.465 23.599999999999998 30-34 19.765 29.125 27.155 23.955000000000002 35-39 19.785 29.654999999999998 27.529999999999998 23.03 40-44 20.27 29.39 26.865 23.474999999999998 45-49 20.330000000000002 28.93 27.925 22.814999999999998 50-54 19.580000000000002 29.435 27.33 23.655 55-59 19.955000000000002 29.235 27.265 23.544999999999998 60-64 19.465 29.345 27.165 24.025 65-69 19.765 29.32 27.47 23.445 70-74 19.37 29.335 27.62 23.674999999999997 75-79 19.57 29.375 27.615000000000002 23.44 80-84 19.744999999999997 29.154999999999998 27.6 23.5 85-89 19.715 28.705000000000002 27.860000000000003 23.72 90-94 20.26 29.365000000000002 26.640000000000004 23.735 95-99 19.725 28.765 27.82 23.69 100-104 19.725 29.509999999999998 27.515 23.25 105-109 20.265 29.15 27.485 23.1 110-114 20.54 28.87 26.575 24.015 115-119 20.665 29.580000000000002 27.215 22.54 120-124 20.349999999999998 28.494999999999997 27.034999999999997 24.12 125-129 20.715 28.49 27.205000000000002 23.59 130-134 20.525 28.084999999999997 27.68 23.71 135-139 20.59 28.895 27.13 23.385 140-144 20.66 29.075 25.965 24.3 145-149 20.685000000000002 28.99 26.295 24.03 150 20.825 30.3 25.174999999999997 23.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.5 22 0.5 23 1.5 24 2.5 25 3.0 26 5.0 27 7.0 28 11.0 29 18.0 30 22.0 31 36.5 32 50.5 33 53.0 34 64.0 35 85.5 36 104.5 37 123.5 38 143.5 39 154.0 40 193.0 41 225.0 42 234.0 43 246.5 44 252.0 45 261.5 46 260.0 47 248.0 48 229.0 49 199.5 50 172.5 51 143.5 52 113.0 53 89.0 54 64.0 55 47.5 56 38.5 57 27.0 58 19.5 59 16.0 60 11.5 61 7.0 62 3.0 63 1.5 64 1.0 65 0.5 66 2.0 67 2.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 4.625 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.1625 0.0 0.0 0.0 0.0 112-113 2.3375 0.0 0.0 0.0 0.0 114-115 2.5375 0.0 0.0 0.0 0.0 116-117 2.7875 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.4375 0.0 0.0 0.0 0.0 122-123 3.9625 0.0 0.0 0.0 0.0 124-125 4.2875 0.0 0.0 0.0 0.0 126-127 4.8375 0.0 0.0 0.0 0.0 128-129 5.525 0.0 0.0 0.0 0.0 130-131 5.9375 0.0 0.0 0.0 0.0 132-133 6.5 0.0 0.0 0.0 0.0 134-135 7.175000000000001 0.0 0.0 0.0 0.0 136-137 7.7875 0.0 0.0 0.0 0.0 138 8.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATTAG 10 0.005780073 153.2 4 AGGGGTG 10 0.0070282277 143.625 9 AAAAAAA 20 0.006217962 28.724998 140-144 >>END_MODULE SRR4237634 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237634_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86925 33.0 33.0 34.0 32.0 34.0 2 32.962 34.0 33.0 34.0 32.0 34.0 3 32.982 34.0 33.0 34.0 32.0 34.0 4 32.96975 34.0 33.0 34.0 32.0 34.0 5 32.97775 34.0 33.0 34.0 32.0 34.0 6 37.09275 38.0 38.0 38.0 37.0 38.0 7 37.21375 38.0 38.0 38.0 37.0 38.0 8 37.08575 38.0 38.0 38.0 37.0 38.0 9 37.131 38.0 38.0 38.0 37.0 38.0 10-14 37.07430000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.0389 38.0 38.0 38.0 36.8 38.0 20-24 37.05045 38.0 38.0 38.0 37.0 38.0 25-29 36.9713 38.0 38.0 38.0 36.8 38.0 30-34 36.93405 38.0 38.0 38.0 36.8 38.0 35-39 36.99905 38.0 38.0 38.0 37.0 38.0 40-44 36.92595 38.0 38.0 38.0 36.8 38.0 45-49 36.952600000000004 38.0 38.0 38.0 36.6 38.0 50-54 36.9317 38.0 38.0 38.0 36.8 38.0 55-59 36.80945 38.0 38.0 38.0 36.2 38.0 60-64 36.81315 38.0 38.0 38.0 36.2 38.0 65-69 36.785999999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.7568 38.0 38.0 38.0 36.0 38.0 75-79 36.71985 38.0 38.0 38.0 36.0 38.0 80-84 36.67985 38.0 38.0 38.0 36.0 38.0 85-89 36.530649999999994 38.0 38.0 38.0 35.4 38.0 90-94 36.466300000000004 38.0 38.0 38.0 35.0 38.0 95-99 36.423249999999996 38.0 38.0 38.0 35.0 38.0 100-104 36.4349 38.0 38.0 38.0 34.8 38.0 105-109 36.312 38.0 38.0 38.0 34.2 38.0 110-114 36.30174999999999 38.0 38.0 38.0 34.2 38.0 115-119 36.1139 38.0 38.0 38.0 34.0 38.0 120-124 36.00834999999999 38.0 38.0 38.0 34.0 38.0 125-129 35.9845 38.0 38.0 38.0 33.8 38.0 130-134 35.8782 38.0 38.0 38.0 33.6 38.0 135-139 35.56955 38.0 38.0 38.0 32.6 38.0 140-144 35.3202 38.0 37.8 38.0 31.8 38.0 145-149 34.79545 38.0 36.6 38.0 30.2 38.0 150 29.8135 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 11.0 4 3.0 5 1.0 6 1.0 7 1.0 8 2.0 9 2.0 10 2.0 11 2.0 12 0.0 13 3.0 14 1.0 15 3.0 16 2.0 17 9.0 18 4.0 19 6.0 20 6.0 21 6.0 22 9.0 23 10.0 24 9.0 25 11.0 26 15.0 27 27.0 28 34.0 29 22.0 30 35.0 31 35.0 32 50.0 33 80.0 34 89.0 35 146.0 36 328.0 37 3027.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.074999999999996 19.950000000000003 14.249999999999998 26.724999999999998 2 27.825 24.6 30.925000000000004 16.650000000000002 3 20.9 27.6 32.15 19.35 4 24.55 34.449999999999996 23.325000000000003 17.675 5 24.2 36.675000000000004 23.05 16.075 6 20.599999999999998 37.925 24.725 16.75 7 19.725 19.650000000000002 40.8 19.825 8 21.8 24.425 29.5 24.275 9 22.275 24.975 29.599999999999998 23.150000000000002 10-14 23.56 28.32 26.865 21.255 15-19 23.235 27.93 28.475 20.36 20-24 23.064999999999998 28.389999999999997 28.255000000000003 20.29 25-29 22.994999999999997 28.744999999999997 27.810000000000002 20.45 30-34 23.025000000000002 27.83 28.87 20.275000000000002 35-39 22.900000000000002 28.194999999999997 28.105000000000004 20.8 40-44 23.505000000000003 27.650000000000002 28.51 20.335 45-49 22.655 28.060000000000002 29.054999999999996 20.23 50-54 23.49 27.339999999999996 28.585 20.585 55-59 22.88 28.494999999999997 28.410000000000004 20.215 60-64 23.62 27.889999999999997 28.525 19.965 65-69 23.474999999999998 28.04 28.62 19.865 70-74 22.68 27.615000000000002 29.195 20.51 75-79 23.125 27.534999999999997 28.98 20.36 80-84 23.13 27.834999999999997 28.205000000000002 20.830000000000002 85-89 23.28 27.805000000000003 28.425 20.49 90-94 23.14 27.155 28.925 20.78 95-99 23.595 27.29 28.83 20.285 100-104 23.145 28.244999999999997 28.07 20.54 105-109 23.79 27.435 28.185 20.59 110-114 23.72 27.950000000000003 28.494999999999997 19.835 115-119 24.26 27.905 28.205000000000002 19.63 120-124 23.79 27.805000000000003 28.355000000000004 20.05 125-129 24.27 27.785 28.444999999999997 19.5 130-134 24.825 28.349999999999998 27.57 19.255 135-139 24.715 28.084999999999997 27.650000000000002 19.55 140-144 25.130000000000003 27.834999999999997 27.595 19.439999999999998 145-149 25.014999999999997 27.325 28.060000000000002 19.6 150 26.05 27.125 28.449999999999996 18.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.5 20 1.5 21 2.0 22 2.0 23 1.0 24 1.5 25 3.0 26 2.5 27 7.0 28 10.0 29 9.5 30 16.0 31 23.5 32 35.5 33 43.0 34 52.5 35 70.5 36 85.0 37 109.5 38 148.0 39 170.5 40 194.5 41 225.5 42 253.0 43 279.5 44 277.0 45 288.0 46 297.5 47 272.0 48 234.5 49 193.0 50 160.0 51 133.0 52 96.5 53 72.0 54 62.0 55 43.5 56 28.0 57 22.5 58 20.0 59 12.5 60 10.5 61 8.5 62 3.0 63 2.5 64 3.5 65 2.0 66 1.5 67 2.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.2375 0.0 0.0 0.0 0.0 112-113 2.4125 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.8875 0.0 0.0 0.0 0.0 118-119 3.2125 0.0 0.0 0.0 0.0 120-121 3.5375 0.0 0.0 0.0 0.0 122-123 4.0625 0.0 0.0 0.0 0.0 124-125 4.3625 0.0 0.0 0.0 0.0 126-127 4.9125 0.0 0.0 0.0 0.0 128-129 5.6 0.0 0.0 0.0 0.0 130-131 6.0375 0.0 0.0 0.0 0.0 132-133 6.6 0.0 0.0 0.0 0.0 134-135 7.300000000000001 0.0 0.0 0.0 0.0 136-137 7.9 0.0 0.0 0.0 0.0 138 8.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTATTGG 10 0.006973645 144.0 8 >>END_MODULE Read 2069840 spots for SRR4237634.sra Written 2069840 spots for SRR4237634.sra Read 2069840 spots for SRR4237634.sra Written 2069840 spots for SRR4237634.sra Read 2069840 spots for SRR4237634.sra Written 2069840 spots for SRR4237634.sra Read 2069840 spots for SRR4237634.sra Written 2069840 spots for SRR4237634.sra Read 2069840 spots for SRR4237634.sra Written 2069840 spots for SRR4237634.sra Read 2069840 spots for SRR4237634.sra Written 2069840 spots for SRR4237634.sra Read 2069840 spots for SRR4237634.sra Written 2069840 spots for SRR4237634.sra Read 2069840 spots for SRR4237634.sra Written 2069840 spots for SRR4237634.sra Read 2069840 spots for SRR4237634.sra Written 2069840 spots for SRR4237634.sra Read 2069840 spots for SRR4237634.sra Written 2069840 spots for SRR4237634.sra Read 2069840 spots for SRR4237634.sra Written 2069840 spots for SRR4237634.sra Read 2069840 spots for SRR4237634.sra Written 2069840 spots for SRR4237634.sra Read 2069840 spots for SRR4237634.sra Written 2069840 spots for SRR4237634.sra Read 2069840 spots for SRR4237634.sra Written 2069840 spots for SRR4237634.sra Read 2069840 spots for SRR4237634.sra Written 2069840 spots for SRR4237634.sra Read 2069840 spots for SRR4237634.sra Written 2069840 spots for SRR4237634.sra Read 2069840 spots for SRR4237634.sra Written 2069840 spots for SRR4237634.sra Read 2069840 spots for SRR4237634.sra Written 2069840 spots for SRR4237634.sra Read 2069841 spots for SRR4237634.sra Written 2069841 spots for SRR4237634.sra Read 2069840 spots for SRR4237634.sra Written 2069840 spots for SRR4237634.sra SRR ids: ['SRR4237634.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ng8_61ny SRR4237634.sra spots: 41396801 blocks: [[1, 2069840], [2069841, 4139680], [4139681, 6209520], [6209521, 8279360], [8279361, 10349200], [10349201, 12419040], [12419041, 14488880], [14488881, 16558720], [16558721, 18628560], [18628561, 20698400], [20698401, 22768240], [22768241, 24838080], [24838081, 26907920], [26907921, 28977760], [28977761, 31047600], [31047601, 33117440], [33117441, 35187280], [35187281, 37257120], [37257121, 39326960], [39326961, 41396801]] SRR4237634 file size 13925464 SRR4237634 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237634 SRR4237634_1.fastq SRR4237634_2.fastq Input file: SRR4237634_1.fastq Paired file: SRR4237634_2.fastq trimmed: SRR4237634-trimmed-pair1.fastq, SRR4237634-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:11:35 2025 >> started Wed Feb 12 19:12:18 2025 >> done (43.241s) 41396801 read pairs processed; of these: 76822 ( 0.19%) short read pairs filtered out after trimming by size control 27651 ( 0.07%) empty read pairs filtered out after trimming by size control 41292328 (99.75%) read pairs available; of these: 13017145 (31.52%) trimmed read pairs available after processing 28275183 (68.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 14 0.00% 20 10 0.00% 21 5 0.00% 22 11 0.00% 23 6 0.00% 24 10 0.00% 25 6 0.00% 26 7 0.00% 27 15 0.00% 28 8 0.00% 29 8 0.00% 30 16 0.00% 31 13 0.00% 32 18 0.00% 33 28 0.00% 34 14 0.00% 35 22 0.00% 36 31 0.00% 37 37 0.00% 38 44 0.00% 39 38 0.00% 40 48 0.00% 41 70 0.00% 42 55 0.00% 43 75 0.00% 44 73 0.00% 45 92 0.00% 46 103 0.00% 47 120 0.00% 48 117 0.00% 49 147 0.00% 50 157 0.00% 51 193 0.00% 52 199 0.00% 53 220 0.00% 54 203 0.00% 55 300 0.00% 56 317 0.00% 57 332 0.00% 58 398 0.00% 59 479 0.00% 60 568 0.00% 61 598 0.00% 62 703 0.00% 63 772 0.00% 64 914 0.00% 65 894 0.00% 66 1145 0.00% 67 1380 0.00% 68 1978 0.00% 69 4164 0.01% 70 4174 0.01% 71 2494 0.01% 72 2358 0.01% 73 2669 0.01% 74 2911 0.01% 75 3240 0.01% 76 3621 0.01% 77 4049 0.01% 78 4405 0.01% 79 5019 0.01% 80 5650 0.01% 81 6324 0.02% 82 7264 0.02% 83 9139 0.02% 84 19858 0.05% 85 15264 0.04% 86 17318 0.04% 87 16232 0.04% 88 15614 0.04% 89 16790 0.04% 90 18199 0.04% 91 19496 0.05% 92 21800 0.05% 93 24122 0.06% 94 30845 0.07% 95 29815 0.07% 96 28932 0.07% 97 33162 0.08% 98 32348 0.08% 99 34736 0.08% 100 37253 0.09% 101 39438 0.10% 102 42082 0.10% 103 44578 0.11% 104 47100 0.11% 105 50113 0.12% 106 52073 0.13% 107 54408 0.13% 108 57442 0.14% 109 60701 0.15% 110 62600 0.15% 111 64404 0.16% 112 67863 0.16% 113 70807 0.17% 114 74429 0.18% 115 77537 0.19% 116 80282 0.19% 117 83628 0.20% 118 86500 0.21% 119 87814 0.21% 120 91403 0.22% 121 93777 0.23% 122 97082 0.24% 123 100002 0.24% 124 103512 0.25% 125 106895 0.26% 126 111245 0.27% 127 114044 0.28% 128 117686 0.29% 129 122445 0.30% 130 124432 0.30% 131 126040 0.31% 132 131515 0.32% 133 136036 0.33% 134 140084 0.34% 135 145436 0.35% 136 151249 0.37% 137 156047 0.38% 138 164375 0.40% 139 173362 0.42% 140 182457 0.44% 141 194020 0.47% 142 208267 0.50% 143 228448 0.55% 144 258604 0.63% 145 301132 0.73% 146 372442 0.90% 147 516786 1.25% 148 916142 2.22% 149 5636100 13.65% 150 28275183 68.48% 41292328 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=38 prefix-density=0.18 prefix-fanout=2.3 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.06 sequence-density-rank=33 fanout-score=119.65 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=12.4 sequence=CAGCAGCAAGAAAACAAGTCAAATTATTCATCAAGGACCAATAAAACAGGCATCGAACTAAAGGGATATTATAAATCACTCAAGCTTGGGGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=36 prefix-density=0.17 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.12 sequence-density-rank=13 fanout-score=31.97 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=14.2 sequence=TTTTCTTCATTGC SRR4237634 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:13:00 Started mapping on | Feb 12 19:13:00 Finished on | Feb 12 19:16:01 Mapping speed, Million of reads per hour | 821.28 Number of input reads | 41292328 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 39891872 Uniquely mapped reads % | 96.61% Average mapped length | 292.41 Number of splices: Total | 33294762 Number of splices: Annotated (sjdb) | 32676205 Number of splices: GT/AG | 32801332 Number of splices: GC/AG | 383492 Number of splices: AT/AC | 31317 Number of splices: Non-canonical | 78621 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.46 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 741316 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 35547 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.49% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 700812 700812 700812 N_multimapping 741316 741316 741316 N_noFeature 1318621 39283395 1626811 N_ambiguous 464277 2720 161961 UnstrandedReadsAssigned:38108974 PositiveStrandReadsAssigned:605757 NegativeStrandReadsAssigned:38103100 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237634 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237634-trimmed-pair1.fastq SRR4237634-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,292,328 reads, 37,929,736 reads pseudoaligned [quant] estimated average fragment length: 235.223 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,217 rounds 52401 SRR4237634.ke.tsv 34699 SRR4237634.se.tsv 87100 total ==> SRR4237634.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.78 843 13.3906 Potri.005G024800.1.v4.1 1035 800.777 132 4.67062 Potri.004G059700.1.v4.1 961 726.803 12 0.467818 Potri.007G009000.2.v4.1 1416 1181.78 0 0 Potri.003G141000.2.v4.1 2943 2708.78 569.065 5.95252 Potri.016G087400.1.v4.1 270 84.0031 4020 1355.95 Potri.015G069301.1.v4.1 564 334.395 0 0 Potri.010G195200.1.v4.1 1773 1538.78 195 3.59064 Potri.012G127500.1.v4.1 977 742.793 4481 170.931 ==> SRR4237634.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6758 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 531 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 29 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR4237634 completed mapping pipeline successfully