Starting /dee2/code/volunteer_pipeline.sh SRR4237635 current disk space = 3051302604800 free memory = 1487768520 SRR4237635 SRAfilesize 65ebdacd5ed6c009dee86d6c52d14b1e SRR4237635.sra SRR4237635.sra file validated SRR4237635 is paired end SRR4237635 is conventional basespace SRR4237635 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237635_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4375 34.0 33.0 34.0 32.0 34.0 2 32.96375 34.0 33.0 34.0 31.0 34.0 3 33.16025 34.0 33.0 34.0 32.0 34.0 4 33.2875 34.0 33.0 34.0 32.0 34.0 5 33.334 34.0 33.0 34.0 33.0 34.0 6 37.02 38.0 37.0 38.0 36.0 38.0 7 37.38825 38.0 38.0 38.0 37.0 38.0 8 37.47525 38.0 38.0 38.0 37.0 38.0 9 37.52675 38.0 38.0 38.0 38.0 38.0 10-14 37.43194999999999 38.0 38.0 38.0 37.4 38.0 15-19 37.00045 38.0 37.8 38.0 35.2 38.0 20-24 37.4094 38.0 38.0 38.0 37.0 38.0 25-29 37.40535 38.0 38.0 38.0 37.0 38.0 30-34 37.0235 38.0 38.0 38.0 35.6 38.0 35-39 37.330149999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.2969 38.0 38.0 38.0 36.8 38.0 45-49 37.133050000000004 38.0 38.0 38.0 36.0 38.0 50-54 37.111149999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.63095 38.0 37.8 38.0 34.0 38.0 60-64 37.093900000000005 38.0 38.0 38.0 36.0 38.0 65-69 37.06355 38.0 38.0 38.0 36.0 38.0 70-74 37.053399999999996 38.0 38.0 38.0 35.8 38.0 75-79 36.97535 38.0 38.0 38.0 36.0 38.0 80-84 36.012 38.0 36.8 38.0 30.0 38.0 85-89 36.737649999999995 38.0 37.8 38.0 35.0 38.0 90-94 36.77445 38.0 38.0 38.0 34.8 38.0 95-99 36.67775 38.0 38.0 38.0 34.8 38.0 100-104 36.61985 38.0 38.0 38.0 34.6 38.0 105-109 36.50305 38.0 38.0 38.0 34.0 38.0 110-114 36.463800000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.34295 38.0 38.0 38.0 34.0 38.0 120-124 36.32379999999999 38.0 38.0 38.0 34.0 38.0 125-129 36.22165 38.0 37.8 38.0 34.0 38.0 130-134 35.91375000000001 38.0 36.8 38.0 32.6 38.0 135-139 35.68745 38.0 36.0 38.0 31.8 38.0 140-144 35.592949999999995 38.0 36.0 38.0 31.8 38.0 145-149 35.09315 38.0 36.0 38.0 31.0 38.0 150 30.29475 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 2.0 16 1.0 17 2.0 18 5.0 19 4.0 20 2.0 21 1.0 22 3.0 23 4.0 24 9.0 25 5.0 26 10.0 27 12.0 28 17.0 29 25.0 30 50.0 31 54.0 32 67.0 33 94.0 34 131.0 35 243.0 36 590.0 37 2666.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.240735803785654 12.63663023193815 6.744868035190615 33.37776592908558 2 23.25 15.825 35.075 25.85 3 19.2 21.975 27.250000000000004 31.574999999999996 4 24.425 29.25 22.2 24.125 5 22.84784784784785 34.68468468468468 23.34834834834835 19.11911911911912 6 17.97949487371843 36.284071017754435 24.55613903475869 21.180295073768445 7 13.850000000000001 26.8 41.325 18.025 8 17.325 25.8 30.675 26.200000000000003 9 17.875 23.549999999999997 33.95 24.625 10-14 19.605 30.349999999999998 26.66 23.385 15-19 20.14 28.585 27.865000000000002 23.41 20-24 20.119999999999997 29.34 26.99 23.549999999999997 25-29 19.805 28.83 27.77 23.595 30-34 19.695 29.075 27.71 23.52 35-39 19.945 29.160000000000004 27.54 23.355 40-44 19.994999999999997 29.665000000000003 26.884999999999998 23.455000000000002 45-49 19.96 28.985 27.029999999999998 24.025 50-54 19.93 28.804999999999996 27.47 23.794999999999998 55-59 20.405 28.904999999999998 27.215 23.474999999999998 60-64 20.495 28.435 27.42 23.65 65-69 20.105 28.575 27.169999999999998 24.15 70-74 20.18 28.804999999999996 27.505000000000003 23.51 75-79 20.349999999999998 28.49 27.589999999999996 23.57 80-84 19.84 28.57 27.644999999999996 23.945 85-89 20.22 28.565 27.785 23.43 90-94 21.055 28.29 27.27 23.385 95-99 20.445 28.16 27.47 23.925 100-104 19.85 29.39 27.12 23.64 105-109 20.19 28.075 27.805000000000003 23.93 110-114 20.28 27.905 28.125 23.69 115-119 20.915 28.205000000000002 27.375 23.505000000000003 120-124 20.599999999999998 29.145 27.07 23.185 125-129 20.57 28.610000000000003 27.6 23.22 130-134 20.65 28.050000000000004 27.474999999999998 23.825 135-139 20.805 27.96 27.785 23.45 140-144 20.54 28.384999999999998 27.189999999999998 23.885 145-149 20.96 28.49 26.939999999999998 23.61 150 20.539994953318192 28.110017663386323 27.706283118849356 23.64370426444613 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 2.0 24 3.5 25 3.5 26 5.0 27 7.0 28 9.0 29 8.5 30 13.0 31 25.0 32 34.5 33 43.0 34 57.0 35 64.5 36 83.0 37 105.5 38 120.5 39 156.5 40 189.0 41 235.0 42 262.0 43 257.5 44 277.5 45 286.0 46 271.5 47 251.5 48 234.0 49 209.0 50 173.0 51 144.0 52 115.5 53 95.5 54 78.0 55 54.0 56 33.0 57 24.5 58 21.5 59 11.5 60 7.5 61 7.0 62 5.5 63 3.5 64 2.0 65 1.5 66 0.5 67 1.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.225 2 0.0 3 0.0 4 0.0 5 0.1 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.9249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.7875000000000001 0.0 0.0 0.0 0.0 116-117 0.9125 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.5125000000000002 0.0 0.0 0.0 0.0 126-127 1.825 0.0 0.0 0.0 0.0 128-129 2.0625 0.0 0.0 0.0 0.0 130-131 2.25 0.0 0.0 0.0 0.0 132-133 2.4 0.0 0.0 0.0 0.0 134-135 2.6625 0.0 0.0 0.0 0.0 136-137 2.825 0.0 0.0 0.0 0.0 138 2.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCACAC 10 0.0069772652 143.975 3 CATTTTA 10 0.0069772652 143.975 4 >>END_MODULE SRR4237635 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237635_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6145 33.0 33.0 34.0 32.0 34.0 2 32.819 34.0 33.0 34.0 32.0 34.0 3 32.8675 34.0 33.0 34.0 32.0 34.0 4 32.6975 34.0 33.0 34.0 32.0 34.0 5 32.767 34.0 33.0 34.0 32.0 34.0 6 36.9795 38.0 38.0 38.0 36.0 38.0 7 37.03125 38.0 38.0 38.0 36.0 38.0 8 37.1235 38.0 38.0 38.0 36.0 38.0 9 37.039 38.0 38.0 38.0 37.0 38.0 10-14 37.058749999999996 38.0 38.0 38.0 36.6 38.0 15-19 36.9844 38.0 38.0 38.0 36.2 38.0 20-24 36.98075 38.0 38.0 38.0 36.2 38.0 25-29 36.9523 38.0 38.0 38.0 36.0 38.0 30-34 36.9425 38.0 38.0 38.0 36.2 38.0 35-39 36.8877 38.0 38.0 38.0 36.0 38.0 40-44 36.94735000000001 38.0 38.0 38.0 36.2 38.0 45-49 36.844550000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.87669999999999 38.0 38.0 38.0 36.0 38.0 55-59 36.80415000000001 38.0 38.0 38.0 36.0 38.0 60-64 36.78165 38.0 38.0 38.0 35.8 38.0 65-69 36.745050000000006 38.0 38.0 38.0 35.6 38.0 70-74 36.678 38.0 38.0 38.0 35.2 38.0 75-79 36.669 38.0 38.0 38.0 35.2 38.0 80-84 36.60365 38.0 38.0 38.0 34.6 38.0 85-89 36.51520000000001 38.0 38.0 38.0 34.4 38.0 90-94 36.5942 38.0 38.0 38.0 34.8 38.0 95-99 36.41245 38.0 38.0 38.0 34.4 38.0 100-104 36.30025 38.0 38.0 38.0 34.0 38.0 105-109 36.22195000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.1706 38.0 38.0 38.0 34.0 38.0 115-119 36.02595 38.0 38.0 38.0 33.2 38.0 120-124 35.9619 38.0 38.0 38.0 33.4 38.0 125-129 35.72709999999999 38.0 37.6 38.0 32.6 38.0 130-134 35.46155 38.0 37.0 38.0 31.0 38.0 135-139 35.428399999999996 38.0 37.0 38.0 31.4 38.0 140-144 33.740300000000005 37.2 31.8 38.0 27.6 38.0 145-149 33.281549999999996 37.6 32.8 38.0 22.0 38.0 150 28.8125 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 1.0 5 2.0 6 1.0 7 2.0 8 3.0 9 2.0 10 1.0 11 1.0 12 2.0 13 1.0 14 4.0 15 5.0 16 1.0 17 5.0 18 7.0 19 8.0 20 5.0 21 10.0 22 11.0 23 13.0 24 8.0 25 23.0 26 20.0 27 24.0 28 30.0 29 38.0 30 43.0 31 45.0 32 77.0 33 77.0 34 127.0 35 195.0 36 451.0 37 2753.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.9718026183283 21.6515609264854 10.045317220543806 22.331319234642496 2 27.7027027027027 25.650650650650654 31.006006006006004 15.64064064064064 3 21.32132132132132 28.053053053053052 31.83183183183183 18.793793793793796 4 25.426278836509532 35.38114343029088 21.865596790371114 17.326980942828484 5 25.269221136989735 38.96819434009517 20.63611319809667 15.126471324818432 6 19.650000000000002 39.975 22.8 17.575 7 20.025000000000002 20.225 41.125 18.625 8 20.65 25.7 29.049999999999997 24.6 9 22.225 24.224999999999998 29.65 23.9 10-14 23.65 28.599999999999998 26.22 21.529999999999998 15-19 23.494999999999997 27.125 28.185 21.195 20-24 22.93 27.955000000000002 28.044999999999998 21.07 25-29 23.78 28.185 27.73 20.305 30-34 23.195 27.450000000000003 28.384999999999998 20.97 35-39 22.79 28.455000000000002 27.96 20.794999999999998 40-44 23.13 28.105000000000004 27.800000000000004 20.965 45-49 23.64 28.000000000000004 27.855 20.505000000000003 50-54 23.015 27.92 28.065 21.0 55-59 23.46 27.950000000000003 27.584999999999997 21.005 60-64 23.330000000000002 27.215 28.46 20.995 65-69 23.74 27.229999999999997 28.660000000000004 20.369999999999997 70-74 23.244999999999997 27.865000000000002 28.34 20.549999999999997 75-79 23.685000000000002 26.995 28.725 20.595 80-84 23.635 27.485 28.165000000000003 20.715 85-89 23.517351735173516 28.412841284128415 27.642764276427645 20.427042704270427 90-94 23.305 27.845 28.449999999999996 20.4 95-99 23.400000000000002 27.615000000000002 28.310000000000002 20.674999999999997 100-104 24.04 27.71 27.735 20.515 105-109 23.69 27.450000000000003 28.37 20.49 110-114 23.28 27.55 28.599999999999998 20.57 115-119 23.57 27.73 28.525 20.175 120-124 24.07 27.205000000000002 28.349999999999998 20.375 125-129 23.525 28.055000000000003 27.839999999999996 20.580000000000002 130-134 23.915 28.044999999999998 27.655 20.385 135-139 23.875 27.97 27.505000000000003 20.65 140-144 24.373998397435898 27.624198717948715 28.064903846153843 19.93689903846154 145-149 24.52 27.725 27.445000000000004 20.31 150 24.70290771175727 28.268015170670036 27.762326169405817 19.266750948166877 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 0.0 23 0.0 24 0.5 25 1.0 26 4.0 27 4.0 28 4.0 29 9.0 30 12.0 31 11.5 32 19.0 33 28.0 34 48.5 35 68.0 36 74.5 37 99.5 38 131.5 39 164.5 40 191.5 41 226.0 42 266.5 43 282.0 44 293.0 45 303.0 46 298.5 47 273.5 48 239.5 49 201.5 50 160.0 51 126.0 52 116.0 53 104.0 54 62.5 55 37.5 56 39.5 57 36.5 58 22.0 59 10.5 60 6.0 61 4.5 62 4.0 63 3.5 64 1.5 65 3.0 66 2.5 67 0.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.1 3 0.1 4 0.3 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.16 145-149 0.0 150 1.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.7875000000000001 0.0 0.0 0.0 0.0 116-117 0.9125 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.5125000000000002 0.0 0.0 0.0 0.0 126-127 1.825 0.0 0.0 0.0 0.0 128-129 2.0625 0.0 0.0 0.0 0.0 130-131 2.25 0.0 0.0 0.0 0.0 132-133 2.4 0.0 0.0 0.0 0.0 134-135 2.6625 0.0 0.0 0.0 0.0 136-137 2.7750000000000004 0.0 0.0 0.0 0.0 138 2.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.007966741 18.0 95-99 >>END_MODULE Read 2234565 spots for SRR4237635.sra Written 2234565 spots for SRR4237635.sra Read 2234565 spots for SRR4237635.sra Written 2234565 spots for SRR4237635.sra Read 2234565 spots for SRR4237635.sra Written 2234565 spots for SRR4237635.sra Read 2234565 spots for SRR4237635.sra Written 2234565 spots for SRR4237635.sra Read 2234565 spots for SRR4237635.sra Written 2234565 spots for SRR4237635.sra Read 2234565 spots for SRR4237635.sra Written 2234565 spots for SRR4237635.sra Read 2234565 spots for SRR4237635.sra Written 2234565 spots for SRR4237635.sra Read 2234565 spots for SRR4237635.sra Written 2234565 spots for SRR4237635.sra Read 2234565 spots for SRR4237635.sra Written 2234565 spots for SRR4237635.sra Read 2234565 spots for SRR4237635.sra Written 2234565 spots for SRR4237635.sra Read 2234565 spots for SRR4237635.sra Written 2234565 spots for SRR4237635.sra Read 2234565 spots for SRR4237635.sra Written 2234565 spots for SRR4237635.sra Read 2234565 spots for SRR4237635.sra Written 2234565 spots for SRR4237635.sra Read 2234584 spots for SRR4237635.sra Written 2234584 spots for SRR4237635.sra Read 2234565 spots for SRR4237635.sra Written 2234565 spots for SRR4237635.sra Read 2234565 spots for SRR4237635.sra Written 2234565 spots for SRR4237635.sra Read 2234565 spots for SRR4237635.sra Written 2234565 spots for SRR4237635.sra Read 2234565 spots for SRR4237635.sra Written 2234565 spots for SRR4237635.sra Read 2234565 spots for SRR4237635.sra Written 2234565 spots for SRR4237635.sra Read 2234565 spots for SRR4237635.sra Written 2234565 spots for SRR4237635.sra SRR ids: ['SRR4237635.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_htzoxo3k SRR4237635.sra spots: 44691319 blocks: [[1, 2234565], [2234566, 4469130], [4469131, 6703695], [6703696, 8938260], [8938261, 11172825], [11172826, 13407390], [13407391, 15641955], [15641956, 17876520], [17876521, 20111085], [20111086, 22345650], [22345651, 24580215], [24580216, 26814780], [26814781, 29049345], [29049346, 31283910], [31283911, 33518475], [33518476, 35753040], [35753041, 37987605], [37987606, 40222170], [40222171, 42456735], [42456736, 44691319]] SRR4237635 file size 15035433 SRR4237635 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237635 SRR4237635_1.fastq SRR4237635_2.fastq Input file: SRR4237635_1.fastq Paired file: SRR4237635_2.fastq trimmed: SRR4237635-trimmed-pair1.fastq, SRR4237635-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:39:47 2025 >> started Wed Feb 12 18:40:35 2025 >> done (47.053s) 44691319 read pairs processed; of these: 41628 ( 0.09%) short read pairs filtered out after trimming by size control 30188 ( 0.07%) empty read pairs filtered out after trimming by size control 44619503 (99.84%) read pairs available; of these: 12992813 (29.12%) trimmed read pairs available after processing 31626690 (70.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 9 0.00% 20 5 0.00% 21 9 0.00% 22 6 0.00% 23 12 0.00% 24 12 0.00% 25 9 0.00% 26 12 0.00% 27 13 0.00% 28 8 0.00% 29 9 0.00% 30 21 0.00% 31 24 0.00% 32 23 0.00% 33 14 0.00% 34 20 0.00% 35 17 0.00% 36 26 0.00% 37 41 0.00% 38 26 0.00% 39 44 0.00% 40 48 0.00% 41 34 0.00% 42 54 0.00% 43 44 0.00% 44 56 0.00% 45 55 0.00% 46 58 0.00% 47 70 0.00% 48 72 0.00% 49 82 0.00% 50 74 0.00% 51 92 0.00% 52 97 0.00% 53 99 0.00% 54 125 0.00% 55 141 0.00% 56 146 0.00% 57 184 0.00% 58 181 0.00% 59 172 0.00% 60 230 0.00% 61 237 0.00% 62 279 0.00% 63 329 0.00% 64 362 0.00% 65 394 0.00% 66 425 0.00% 67 544 0.00% 68 766 0.00% 69 1240 0.00% 70 1118 0.00% 71 833 0.00% 72 833 0.00% 73 935 0.00% 74 1046 0.00% 75 1150 0.00% 76 1306 0.00% 77 1491 0.00% 78 1600 0.00% 79 1817 0.00% 80 2044 0.00% 81 2262 0.01% 82 2679 0.01% 83 3317 0.01% 84 6202 0.01% 85 6654 0.01% 86 6960 0.02% 87 7328 0.02% 88 7819 0.02% 89 9230 0.02% 90 8682 0.02% 91 10300 0.02% 92 9624 0.02% 93 10381 0.02% 94 11078 0.02% 95 11852 0.03% 96 12681 0.03% 97 13540 0.03% 98 14421 0.03% 99 15277 0.03% 100 16411 0.04% 101 17194 0.04% 102 18326 0.04% 103 19651 0.04% 104 20919 0.05% 105 22414 0.05% 106 23397 0.05% 107 25206 0.06% 108 26691 0.06% 109 28069 0.06% 110 29254 0.07% 111 31236 0.07% 112 33107 0.07% 113 35066 0.08% 114 37431 0.08% 115 39499 0.09% 116 42372 0.09% 117 44304 0.10% 118 46931 0.11% 119 48767 0.11% 120 51568 0.12% 121 54214 0.12% 122 56805 0.13% 123 59893 0.13% 124 62922 0.14% 125 65364 0.15% 126 69545 0.16% 127 72778 0.16% 128 76033 0.17% 129 80287 0.18% 130 84594 0.19% 131 88642 0.20% 132 94789 0.21% 133 100378 0.22% 134 106146 0.24% 135 113715 0.25% 136 121624 0.27% 137 130366 0.29% 138 140371 0.31% 139 151308 0.34% 140 162455 0.36% 141 178523 0.40% 142 198953 0.45% 143 224352 0.50% 144 264732 0.59% 145 321431 0.72% 146 407732 0.91% 147 593114 1.33% 148 1153730 2.59% 149 6908690 15.48% 150 31626690 70.88% 44619503 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=36 prefix-density=0.17 prefix-fanout=2.1 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=194.74 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=14.5 sequence=CTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=34 prefix-density=0.23 prefix-fanout=2.0 sequence=TGCATTTCGATT criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=270.68 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=30.4 sequence=AAGAAGAAGAAA SRR4237635 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:41:19 Started mapping on | Feb 12 18:41:20 Finished on | Feb 12 18:44:49 Mapping speed, Million of reads per hour | 768.57 Number of input reads | 44619503 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 42922828 Uniquely mapped reads % | 96.20% Average mapped length | 295.27 Number of splices: Total | 40750254 Number of splices: Annotated (sjdb) | 40055087 Number of splices: GT/AG | 40145523 Number of splices: GC/AG | 479574 Number of splices: AT/AC | 37488 Number of splices: Non-canonical | 87669 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 788122 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 39175 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.92% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 953573 953573 953573 N_multimapping 788122 788122 788122 N_noFeature 1137512 42430892 1389416 N_ambiguous 431588 2261 189930 UnstrandedReadsAssigned:41353728 PositiveStrandReadsAssigned:489675 NegativeStrandReadsAssigned:41343482 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR4237635 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237635-trimmed-pair1.fastq SRR4237635-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,619,503 reads, 41,052,802 reads pseudoaligned [quant] estimated average fragment length: 253.21 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,290 rounds 52401 SRR4237635.ke.tsv 34699 SRR4237635.se.tsv 87100 total ==> SRR4237635.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.79 1046 14.7157 Potri.005G024800.1.v4.1 1035 782.79 160 5.07766 Potri.004G059700.1.v4.1 961 708.835 28 0.981301 Potri.007G009000.2.v4.1 1416 1163.79 1 0.0213459 Potri.003G141000.2.v4.1 2943 2690.79 759.217 7.00931 Potri.016G087400.1.v4.1 270 71.0343 3603 1260.04 Potri.015G069301.1.v4.1 564 317.436 0 0 Potri.010G195200.1.v4.1 1773 1520.79 92 1.50282 Potri.012G127500.1.v4.1 977 724.813 16205 555.408 ==> SRR4237635.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3459 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 528 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 31 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR4237635 completed mapping pipeline successfully