Starting /dee2/code/volunteer_pipeline.sh SRR4237636 current disk space = 3051071361024 free memory = 1571379864 SRR4237636 SRAfilesize c743f1bcc868a0c7ac15b89502a85c8d SRR4237636.sra SRR4237636.sra file validated SRR4237636 is paired end SRR4237636 is conventional basespace SRR4237636 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237636_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.16975 34.0 33.0 34.0 2.0 34.0 2 32.77225 34.0 33.0 34.0 28.0 34.0 3 33.034 34.0 33.0 34.0 32.0 34.0 4 33.303 34.0 33.0 34.0 32.0 34.0 5 33.34625 34.0 33.0 34.0 33.0 34.0 6 37.03225 38.0 37.0 38.0 36.0 38.0 7 37.32375 38.0 38.0 38.0 37.0 38.0 8 37.5245 38.0 38.0 38.0 37.0 38.0 9 37.554 38.0 38.0 38.0 38.0 38.0 10-14 37.155100000000004 38.0 38.0 38.0 36.2 38.0 15-19 37.49849999999999 38.0 38.0 38.0 37.6 38.0 20-24 37.52034999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.4765 38.0 38.0 38.0 37.6 38.0 30-34 37.484700000000004 38.0 38.0 38.0 37.4 38.0 35-39 37.505250000000004 38.0 38.0 38.0 37.4 38.0 40-44 37.356700000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.3694 38.0 38.0 38.0 37.0 38.0 50-54 37.264250000000004 38.0 38.0 38.0 36.6 38.0 55-59 37.194750000000006 38.0 38.0 38.0 36.0 38.0 60-64 37.169349999999994 38.0 38.0 38.0 36.0 38.0 65-69 37.1102 38.0 38.0 38.0 36.0 38.0 70-74 37.1199 38.0 38.0 38.0 36.0 38.0 75-79 37.0711 38.0 38.0 38.0 36.0 38.0 80-84 37.01925 38.0 38.0 38.0 36.0 38.0 85-89 35.7438 38.0 36.0 38.0 29.8 38.0 90-94 36.89815 38.0 38.0 38.0 35.6 38.0 95-99 36.85385 38.0 38.0 38.0 35.6 38.0 100-104 36.7615 38.0 38.0 38.0 35.0 38.0 105-109 36.55435 38.0 38.0 38.0 34.4 38.0 110-114 36.52855000000001 38.0 38.0 38.0 34.2 38.0 115-119 36.517399999999995 38.0 38.0 38.0 34.2 38.0 120-124 36.354699999999994 38.0 38.0 38.0 34.0 38.0 125-129 36.234950000000005 38.0 38.0 38.0 34.0 38.0 130-134 36.1249 38.0 37.6 38.0 33.6 38.0 135-139 35.827749999999995 38.0 36.4 38.0 32.2 38.0 140-144 35.6929 38.0 36.0 38.0 32.2 38.0 145-149 35.2412 38.0 36.0 38.0 31.6 38.0 150 30.12375 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 1.0 18 0.0 19 2.0 20 2.0 21 4.0 22 3.0 23 5.0 24 4.0 25 13.0 26 13.0 27 14.0 28 20.0 29 30.0 30 25.0 31 37.0 32 61.0 33 91.0 34 133.0 35 197.0 36 560.0 37 2781.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.80892608089261 11.157601115760112 8.423988842398884 39.609483960948396 2 22.330582645661416 15.228807201800452 35.8589647411853 26.581645411352838 3 20.825 19.400000000000002 26.150000000000002 33.625 4 23.1 29.075 21.7 26.125 5 22.99023290758828 34.710743801652896 23.09040821437516 19.208615076383673 6 17.175 37.625 24.25 20.95 7 14.025000000000002 26.200000000000003 42.25 17.525 8 17.299999999999997 25.775 31.275 25.650000000000002 9 16.875 23.3 35.875 23.95 10-14 19.900000000000002 29.705 26.985 23.41 15-19 19.495 28.93 27.565 24.01 20-24 19.45 28.78 28.07 23.7 25-29 19.13 29.255 27.884999999999998 23.73 30-34 19.645000000000003 29.189999999999998 27.295 23.87 35-39 19.78 29.459999999999997 26.86 23.9 40-44 19.68 28.9 27.845 23.575 45-49 19.509999999999998 28.439999999999998 28.055000000000003 23.995 50-54 19.62 28.625 27.389999999999997 24.365000000000002 55-59 20.115 29.285 26.96 23.64 60-64 19.575 28.435 27.52 24.47 65-69 20.424999999999997 29.054999999999996 27.35 23.169999999999998 70-74 19.470000000000002 29.080000000000002 27.505000000000003 23.945 75-79 19.74 28.599999999999998 27.92 23.74 80-84 20.3 28.225 27.445000000000004 24.03 85-89 19.939999999999998 28.810000000000002 27.43 23.82 90-94 19.994999999999997 28.735 27.54 23.73 95-99 20.605 28.255000000000003 27.07 24.07 100-104 19.595000000000002 28.89 27.584999999999997 23.93 105-109 19.950000000000003 28.050000000000004 27.79 24.21 110-114 20.349999999999998 28.785 27.389999999999997 23.474999999999998 115-119 20.080000000000002 28.199999999999996 27.515 24.205 120-124 20.45 27.834999999999997 27.41 24.305 125-129 20.445 28.42 27.79 23.345 130-134 20.085 28.07 27.655 24.19 135-139 20.645 28.335 27.065 23.955000000000002 140-144 20.419999999999998 28.125 27.71 23.745 145-149 20.405 28.299999999999997 27.284999999999997 24.01 150 20.232088799192734 28.884964682139252 27.371342078708377 23.511604439959637 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 1.5 24 2.0 25 3.0 26 4.5 27 6.0 28 10.5 29 16.5 30 19.0 31 22.0 32 32.0 33 41.0 34 52.0 35 72.0 36 90.0 37 103.0 38 133.0 39 164.5 40 196.5 41 236.5 42 244.5 43 253.0 44 271.0 45 278.0 46 277.0 47 266.5 48 242.5 49 204.5 50 169.5 51 139.5 52 122.0 53 98.0 54 65.5 55 49.0 56 35.0 57 21.5 58 15.5 59 12.0 60 8.5 61 5.5 62 5.5 63 3.0 64 1.0 65 1.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.375 2 0.025 3 0.0 4 0.0 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.8999999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.07500000000000001 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.4875 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 0.9125000000000001 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.15 0.0 0.0 0.0 0.0 126-127 1.3375 0.0 0.0 0.0 0.0 128-129 1.5875 0.0 0.0 0.0 0.0 130-131 1.775 0.0 0.0 0.0 0.0 132-133 2.025 0.0 0.0 0.0 0.0 134-135 2.2625 0.0 0.0 0.0 0.0 136-137 2.6125 0.0 0.0 0.0 0.0 138 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCACACT 10 0.0069845165 143.925 3 >>END_MODULE SRR4237636 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237636_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01625 33.0 33.0 34.0 32.0 34.0 2 33.1625 34.0 33.0 34.0 33.0 34.0 3 33.09025 34.0 33.0 34.0 33.0 34.0 4 33.093 34.0 33.0 34.0 33.0 34.0 5 33.159 34.0 33.0 34.0 33.0 34.0 6 37.20925 38.0 38.0 38.0 37.0 38.0 7 37.316 38.0 38.0 38.0 37.0 38.0 8 37.21425 38.0 38.0 38.0 37.0 38.0 9 37.2495 38.0 38.0 38.0 37.0 38.0 10-14 37.21524999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.2273 38.0 38.0 38.0 37.0 38.0 20-24 37.20695 38.0 38.0 38.0 37.0 38.0 25-29 37.14745 38.0 38.0 38.0 37.0 38.0 30-34 37.212599999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.22025 38.0 38.0 38.0 37.0 38.0 40-44 37.19125 38.0 38.0 38.0 37.0 38.0 45-49 37.169650000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.139900000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.147000000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.0262 38.0 38.0 38.0 36.8 38.0 65-69 37.06545 38.0 38.0 38.0 37.0 38.0 70-74 37.03515 38.0 38.0 38.0 36.8 38.0 75-79 36.9864 38.0 38.0 38.0 36.2 38.0 80-84 36.96775 38.0 38.0 38.0 36.0 38.0 85-89 36.959649999999996 38.0 38.0 38.0 36.0 38.0 90-94 36.87985 38.0 38.0 38.0 36.0 38.0 95-99 36.7953 38.0 38.0 38.0 35.8 38.0 100-104 36.65875 38.0 38.0 38.0 35.4 38.0 105-109 36.64565 38.0 38.0 38.0 35.2 38.0 110-114 36.682550000000006 38.0 38.0 38.0 35.2 38.0 115-119 36.586349999999996 38.0 38.0 38.0 35.0 38.0 120-124 36.383250000000004 38.0 38.0 38.0 34.4 38.0 125-129 36.3071 38.0 38.0 38.0 34.0 38.0 130-134 36.2607 38.0 38.0 38.0 34.0 38.0 135-139 36.0259 38.0 38.0 38.0 33.8 38.0 140-144 35.73485 38.0 38.0 38.0 33.0 38.0 145-149 35.4237 38.0 38.0 38.0 33.0 38.0 150 30.3945 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 3.0 4 0.0 5 0.0 6 0.0 7 2.0 8 2.0 9 2.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 4.0 16 1.0 17 3.0 18 5.0 19 2.0 20 7.0 21 5.0 22 11.0 23 13.0 24 12.0 25 10.0 26 18.0 27 15.0 28 15.0 29 26.0 30 38.0 31 42.0 32 50.0 33 55.0 34 100.0 35 137.0 36 303.0 37 3117.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.85 21.425 12.6 27.125 2 27.025 25.825 32.725 14.424999999999999 3 21.15 27.275 30.475 21.099999999999998 4 23.375 34.35 22.725 19.55 5 25.874999999999996 36.375 22.05 15.7 6 19.975 40.1 21.775 18.15 7 20.8 20.8 40.5 17.9 8 21.525 24.6 29.725 24.15 9 22.325 24.575 29.975 23.125 10-14 23.655 28.535 26.935 20.875 15-19 23.248487273090966 28.34425163774566 27.65414812221833 20.753112966945043 20-24 23.71 28.134999999999998 27.82 20.335 25-29 24.15603900975244 28.06201550387597 27.7569392348087 20.02500625156289 30-34 23.850962740685173 27.486871717929485 28.192048012003003 20.470117529382346 35-39 23.195 28.37 28.305000000000003 20.13 40-44 23.04 28.43 27.800000000000004 20.73 45-49 23.955000000000002 27.265 27.779999999999998 21.0 50-54 23.364345738295317 28.266306522609042 28.391356542617046 19.97799119647859 55-59 23.721186059302966 27.75638781939097 28.10140507025351 20.421021051052552 60-64 23.21 28.294999999999998 28.299999999999997 20.195 65-69 24.121206060303017 27.27636381819091 28.176408820441022 20.426021301065052 70-74 23.674999999999997 27.700000000000003 28.499999999999996 20.125 75-79 23.315 27.55 28.675 20.46 80-84 23.369999999999997 28.465 27.845 20.32 85-89 23.91097774443611 28.28207051762941 28.377094273568392 19.42985746436609 90-94 23.635636036216297 27.137211745285377 28.47281276574459 20.75433945275374 95-99 23.16695008502551 27.838351505451637 28.863659097729315 20.13103931179354 100-104 23.855 27.175 28.335 20.635 105-109 23.54 27.845 28.185 20.43 110-114 23.635 27.92 28.18 20.265 115-119 23.579715943188635 27.440488097619525 28.540708141628322 20.43908781756351 120-124 23.86738673867387 27.27272727272727 28.377837783778375 20.482048204820483 125-129 24.22 27.77 28.199999999999996 19.81 130-134 23.91 27.245 28.58 20.265 135-139 23.799999999999997 27.855 28.28 20.064999999999998 140-144 24.284640440992234 27.84765722876472 27.717364069155597 20.150338261087448 145-149 24.181209060453025 27.85139256962848 27.87139356967848 20.09600480024001 150 24.67762326169406 27.357774968394438 27.534766118836917 20.42983565107459 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 3.0 24 2.5 25 4.0 26 5.0 27 3.5 28 6.0 29 7.0 30 8.0 31 13.0 32 21.5 33 31.5 34 41.5 35 64.0 36 94.0 37 109.5 38 120.0 39 164.5 40 219.5 41 247.0 42 261.0 43 281.0 44 287.5 45 289.0 46 293.0 47 269.5 48 232.0 49 197.5 50 159.0 51 133.5 52 120.0 53 96.5 54 65.0 55 39.5 56 26.0 57 21.5 58 20.5 59 13.5 60 8.0 61 5.0 62 4.5 63 3.5 64 1.5 65 0.5 66 0.5 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.015 20-24 0.0 25-29 0.025 30-34 0.025 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.04 55-59 0.005 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.025 90-94 0.045 95-99 0.03 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.02 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.22499999999999998 145-149 0.005 150 1.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.07500000000000001 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.5874999999999999 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.8875 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.2875 0.0 0.0 0.0 0.0 128-129 1.525 0.0 0.0 0.0 0.0 130-131 1.7 0.0 0.0 0.0 0.0 132-133 1.9749999999999999 0.0 0.0 0.0 0.0 134-135 2.2125 0.0 0.0 0.0 0.0 136-137 2.5625 0.0 0.0 0.0 0.0 138 2.825 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCTTG 10 0.006973645 144.0 9 GGCTTTG 10 0.006973645 144.0 1 CTGGAAT 10 0.006973645 144.0 7 TTTGCTA 10 0.006973645 144.0 8 TCGAGAT 10 0.006973645 144.0 3 >>END_MODULE Read 2342444 spots for SRR4237636.sra Written 2342444 spots for SRR4237636.sra Read 2342444 spots for SRR4237636.sra Written 2342444 spots for SRR4237636.sra Read 2342444 spots for SRR4237636.sra Written 2342444 spots for SRR4237636.sra Read 2342444 spots for SRR4237636.sra Written 2342444 spots for SRR4237636.sra Read 2342444 spots for SRR4237636.sra Written 2342444 spots for SRR4237636.sra Read 2342444 spots for SRR4237636.sra Written 2342444 spots for SRR4237636.sra Read 2342444 spots for SRR4237636.sra Written 2342444 spots for SRR4237636.sra Read 2342444 spots for SRR4237636.sra Written 2342444 spots for SRR4237636.sra Read 2342444 spots for SRR4237636.sra Written 2342444 spots for SRR4237636.sra Read 2342444 spots for SRR4237636.sra Written 2342444 spots for SRR4237636.sra Read 2342444 spots for SRR4237636.sra Written 2342444 spots for SRR4237636.sra Read 2342444 spots for SRR4237636.sra Written 2342444 spots for SRR4237636.sra Read 2342444 spots for SRR4237636.sra Written 2342444 spots for SRR4237636.sra Read 2342444 spots for SRR4237636.sra Written 2342444 spots for SRR4237636.sra Read 2342444 spots for SRR4237636.sra Written 2342444 spots for SRR4237636.sra Read 2342453 spots for SRR4237636.sra Written 2342453 spots for SRR4237636.sra Read 2342444 spots for SRR4237636.sra Written 2342444 spots for SRR4237636.sra Read 2342444 spots for SRR4237636.sra Written 2342444 spots for SRR4237636.sra Read 2342444 spots for SRR4237636.sra Written 2342444 spots for SRR4237636.sra Read 2342444 spots for SRR4237636.sra Written 2342444 spots for SRR4237636.sra SRR ids: ['SRR4237636.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_afu3xftm SRR4237636.sra spots: 46848889 blocks: [[1, 2342444], [2342445, 4684888], [4684889, 7027332], [7027333, 9369776], [9369777, 11712220], [11712221, 14054664], [14054665, 16397108], [16397109, 18739552], [18739553, 21081996], [21081997, 23424440], [23424441, 25766884], [25766885, 28109328], [28109329, 30451772], [30451773, 32794216], [32794217, 35136660], [35136661, 37479104], [37479105, 39821548], [39821549, 42163992], [42163993, 44506436], [44506437, 46848889]] SRR4237636 file size 15762349 SRR4237636 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237636 SRR4237636_1.fastq SRR4237636_2.fastq Input file: SRR4237636_1.fastq Paired file: SRR4237636_2.fastq trimmed: SRR4237636-trimmed-pair1.fastq, SRR4237636-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:30:36 2025 >> started Wed Feb 12 19:31:32 2025 >> done (56.331s) 46848889 read pairs processed; of these: 27406 ( 0.06%) short read pairs filtered out after trimming by size control 20002 ( 0.04%) empty read pairs filtered out after trimming by size control 46801481 (99.90%) read pairs available; of these: 15537675 (33.20%) trimmed read pairs available after processing 31263806 (66.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 5 0.00% 21 8 0.00% 22 6 0.00% 23 3 0.00% 24 7 0.00% 25 10 0.00% 26 12 0.00% 27 9 0.00% 28 7 0.00% 29 20 0.00% 30 15 0.00% 31 12 0.00% 32 23 0.00% 33 19 0.00% 34 15 0.00% 35 19 0.00% 36 20 0.00% 37 23 0.00% 38 24 0.00% 39 33 0.00% 40 39 0.00% 41 29 0.00% 42 50 0.00% 43 48 0.00% 44 44 0.00% 45 48 0.00% 46 65 0.00% 47 68 0.00% 48 63 0.00% 49 75 0.00% 50 69 0.00% 51 87 0.00% 52 110 0.00% 53 113 0.00% 54 106 0.00% 55 133 0.00% 56 129 0.00% 57 162 0.00% 58 176 0.00% 59 192 0.00% 60 213 0.00% 61 233 0.00% 62 280 0.00% 63 271 0.00% 64 332 0.00% 65 371 0.00% 66 439 0.00% 67 568 0.00% 68 859 0.00% 69 1274 0.00% 70 1414 0.00% 71 895 0.00% 72 887 0.00% 73 961 0.00% 74 1085 0.00% 75 1122 0.00% 76 1314 0.00% 77 1407 0.00% 78 1688 0.00% 79 1832 0.00% 80 2007 0.00% 81 2280 0.00% 82 2681 0.01% 83 3129 0.01% 84 5152 0.01% 85 5696 0.01% 86 6082 0.01% 87 6867 0.01% 88 7406 0.02% 89 7920 0.02% 90 8115 0.02% 91 8754 0.02% 92 9571 0.02% 93 10228 0.02% 94 11122 0.02% 95 11931 0.03% 96 12991 0.03% 97 13688 0.03% 98 14528 0.03% 99 15429 0.03% 100 16928 0.04% 101 17913 0.04% 102 19286 0.04% 103 20567 0.04% 104 21874 0.05% 105 23665 0.05% 106 25241 0.05% 107 26863 0.06% 108 28365 0.06% 109 30030 0.06% 110 32024 0.07% 111 33642 0.07% 112 35888 0.08% 113 37913 0.08% 114 40227 0.09% 115 42248 0.09% 116 44042 0.09% 117 46883 0.10% 118 49034 0.10% 119 50414 0.11% 120 53010 0.11% 121 56240 0.12% 122 58592 0.13% 123 62070 0.13% 124 65440 0.14% 125 68519 0.15% 126 71923 0.15% 127 75540 0.16% 128 79278 0.17% 129 84444 0.18% 130 88450 0.19% 131 92975 0.20% 132 97478 0.21% 133 103416 0.22% 134 109054 0.23% 135 116297 0.25% 136 124766 0.27% 137 133262 0.28% 138 143440 0.31% 139 154019 0.33% 140 167973 0.36% 141 184433 0.39% 142 205535 0.44% 143 232589 0.50% 144 275171 0.59% 145 340913 0.73% 146 432840 0.92% 147 641422 1.37% 148 1295167 2.77% 149 9095247 19.43% 150 31263806 66.80% 46801481 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=30 prefix-density=0.23 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=301.85 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=17.8 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=5.17 fanout-score-rank=18 prefix-density=0.31 prefix-fanout=3.5 sequence=TTCATGCTTTCCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=40 fanout-score=104.91 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=11.1 sequence=TCTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTCGACAGGTGAAACTCAGATGACTCCAACTCAGGTATCAGATGAAGAGGCACACCTCTTTGCCATGCAACTAGCCAGTGCTTCAGTTCTACCAATGATCCTCAAAACAGCCATTGAACTCGACCTTCTTGAAATCATGGCTAAAGCTGGCCCTGGTGCTTTCTTGTCCACATCT SRR4237636 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:32:15 Started mapping on | Feb 12 19:32:15 Finished on | Feb 12 19:36:40 Mapping speed, Million of reads per hour | 635.79 Number of input reads | 46801481 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 45164418 Uniquely mapped reads % | 96.50% Average mapped length | 295.43 Number of splices: Total | 42482771 Number of splices: Annotated (sjdb) | 41774217 Number of splices: GT/AG | 41882491 Number of splices: GC/AG | 471426 Number of splices: AT/AC | 41172 Number of splices: Non-canonical | 87682 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 773724 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 40486 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.74% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 892447 892447 892447 N_multimapping 773724 773724 773724 N_noFeature 1178630 44606413 1440993 N_ambiguous 492488 2269 195184 UnstrandedReadsAssigned:43493300 PositiveStrandReadsAssigned:555736 NegativeStrandReadsAssigned:43528241 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR4237636 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237636-trimmed-pair1.fastq SRR4237636-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 46,801,481 reads, 43,211,484 reads pseudoaligned [quant] estimated average fragment length: 253.654 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,328 rounds 52401 SRR4237636.ke.tsv 34699 SRR4237636.se.tsv 87100 total ==> SRR4237636.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.35 926 12.6897 Potri.005G024800.1.v4.1 1035 782.346 135 4.1745 Potri.004G059700.1.v4.1 961 708.409 18 0.614692 Potri.007G009000.2.v4.1 1416 1163.35 0 0 Potri.003G141000.2.v4.1 2943 2690.35 629.149 5.65737 Potri.016G087400.1.v4.1 270 72.5617 3744 1248.24 Potri.015G069301.1.v4.1 564 317.044 0 0 Potri.010G195200.1.v4.1 1773 1520.35 78 1.24114 Potri.012G127500.1.v4.1 977 724.388 9044 302.036 ==> SRR4237636.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4613 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 541 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR4237636 completed mapping pipeline successfully