Starting /dee2/code/volunteer_pipeline.sh SRR4237637 current disk space = 3051049377792 free memory = 1580347792 SRR4237637 SRAfilesize 873efcadf5d1dc0696d267341157f650 SRR4237637.sra SRR4237637.sra file validated SRR4237637 is paired end SRR4237637 is conventional basespace SRR4237637 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237637_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4985 34.0 33.0 34.0 32.0 34.0 2 32.98925 34.0 33.0 34.0 32.0 34.0 3 33.16925 34.0 33.0 34.0 32.0 34.0 4 33.2625 34.0 33.0 34.0 32.0 34.0 5 33.1615 34.0 33.0 34.0 33.0 34.0 6 37.0285 38.0 37.0 38.0 36.0 38.0 7 37.31475 38.0 38.0 38.0 37.0 38.0 8 37.50725 38.0 38.0 38.0 37.0 38.0 9 37.5585 38.0 38.0 38.0 38.0 38.0 10-14 37.5593 38.0 38.0 38.0 38.0 38.0 15-19 37.48094999999999 38.0 38.0 38.0 37.8 38.0 20-24 37.355450000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.484249999999996 38.0 38.0 38.0 37.8 38.0 30-34 37.36985 38.0 38.0 38.0 37.2 38.0 35-39 37.401300000000006 38.0 38.0 38.0 37.2 38.0 40-44 37.195949999999996 38.0 38.0 38.0 36.4 38.0 45-49 37.2141 38.0 38.0 38.0 36.6 38.0 50-54 37.20845 38.0 38.0 38.0 36.6 38.0 55-59 37.181850000000004 38.0 38.0 38.0 36.4 38.0 60-64 37.1554 38.0 38.0 38.0 36.4 38.0 65-69 37.08165 38.0 38.0 38.0 36.2 38.0 70-74 36.640750000000004 38.0 37.8 38.0 34.2 38.0 75-79 37.05765 38.0 38.0 38.0 36.0 38.0 80-84 36.9637 38.0 38.0 38.0 36.0 38.0 85-89 37.0223 38.0 38.0 38.0 36.0 38.0 90-94 36.92355 38.0 38.0 38.0 35.6 38.0 95-99 36.8215 38.0 38.0 38.0 35.4 38.0 100-104 36.721799999999995 38.0 38.0 38.0 35.0 38.0 105-109 36.60795 38.0 38.0 38.0 34.6 38.0 110-114 36.43005 38.0 38.0 38.0 34.0 38.0 115-119 36.365449999999996 38.0 38.0 38.0 34.2 38.0 120-124 36.25885 38.0 38.0 38.0 33.8 38.0 125-129 36.06075 38.0 37.8 38.0 33.6 38.0 130-134 36.032149999999994 38.0 38.0 38.0 33.6 38.0 135-139 35.5217 38.0 36.6 38.0 31.2 38.0 140-144 35.5176 38.0 36.2 38.0 32.0 38.0 145-149 34.0362 38.0 35.0 38.0 22.6 38.0 150 29.92125 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 3.0 17 2.0 18 1.0 19 3.0 20 3.0 21 2.0 22 5.0 23 4.0 24 8.0 25 15.0 26 15.0 27 14.0 28 27.0 29 39.0 30 43.0 31 49.0 32 60.0 33 84.0 34 113.0 35 179.0 36 493.0 37 2835.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.50238980350505 11.125862984599044 9.506107275624004 40.86563993627191 2 22.458688032048073 15.523284927391087 34.57686529794692 27.44116174261392 3 21.55 18.525 25.074999999999996 34.849999999999994 4 21.75 28.999999999999996 23.125 26.125 5 22.325231771485843 33.675770483588074 24.429967426710096 19.569030318215987 6 18.35 36.25 24.825 20.575 7 13.175 27.6 42.0 17.224999999999998 8 16.25 26.525 32.275 24.95 9 15.7 24.5 34.875 24.925 10-14 18.61 31.31 27.13 22.95 15-19 18.98 29.86 28.005000000000003 23.155 20-24 19.445 30.415 27.01 23.13 25-29 19.18 29.720000000000002 27.334999999999997 23.765 30-34 18.915000000000003 30.365 27.02 23.7 35-39 19.695 30.09 27.235 22.98 40-44 19.6019601960196 30.218021802180218 26.997699769976997 23.18231823182318 45-49 19.845 30.245 26.325 23.585 50-54 20.16 29.73 27.500000000000004 22.61 55-59 19.825 29.755 27.529999999999998 22.89 60-64 19.8 29.255 27.555000000000003 23.39 65-69 20.195 29.81 27.150000000000002 22.845 70-74 19.915 29.735 26.735 23.615 75-79 19.81 29.845 27.139999999999997 23.205000000000002 80-84 19.986998699869986 29.21792179217922 27.462746274627463 23.332333233323332 85-89 19.66 29.909999999999997 26.56 23.87 90-94 19.985 29.67 26.8 23.544999999999998 95-99 20.349999999999998 29.599999999999998 26.865 23.185 100-104 19.735 29.64 27.08 23.544999999999998 105-109 20.215 28.77 27.72 23.294999999999998 110-114 19.78 29.265 26.91 24.044999999999998 115-119 20.23 29.18 27.025 23.565 120-124 20.150000000000002 28.87 26.865 24.115000000000002 125-129 20.362036203620363 29.422942294229422 26.872687268726875 23.342334233423344 130-134 20.349999999999998 29.37 26.534999999999997 23.745 135-139 20.015 28.83 27.245 23.91 140-144 20.49 29.020000000000003 26.99 23.5 145-149 20.525 28.884999999999998 26.840000000000003 23.75 150 19.964753272910375 28.600201409869086 27.064451158106746 24.370594159113796 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 2.0 23 4.5 24 4.5 25 3.5 26 7.5 27 14.0 28 18.0 29 21.0 30 26.5 31 38.0 32 48.5 33 60.5 34 71.0 35 81.5 36 110.5 37 127.0 38 145.0 39 169.5 40 179.0 41 214.5 42 255.5 43 275.5 44 276.5 45 246.0 46 230.5 47 231.0 48 216.0 49 192.5 50 163.5 51 132.5 52 109.5 53 92.0 54 65.5 55 41.0 56 27.0 57 20.0 58 18.0 59 15.0 60 9.0 61 8.0 62 5.0 63 2.5 64 4.0 65 4.5 66 2.5 67 1.0 68 1.5 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.8500000000000005 2 0.15 3 0.0 4 0.0 5 0.22499999999999998 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.7000000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.775 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.1125 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.625 0.0 0.0 0.0 0.0 120-121 1.8125 0.0 0.0 0.0 0.0 122-123 2.0375 0.0 0.0 0.0 0.0 124-125 2.2625 0.0 0.0 0.0 0.0 126-127 2.5375 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.4125 0.0 0.0 0.0 0.0 132-133 3.775 0.0 0.0 0.0 0.0 134-135 4.1 0.0 0.0 0.0 0.0 136-137 4.4375 0.0 0.0 0.0 0.0 138 4.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237637 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237637_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9375 33.0 33.0 34.0 32.0 34.0 2 33.046 34.0 33.0 34.0 32.0 34.0 3 33.12275 34.0 33.0 34.0 32.0 34.0 4 33.10375 34.0 33.0 34.0 32.0 34.0 5 33.1155 34.0 33.0 34.0 33.0 34.0 6 37.3035 38.0 38.0 38.0 37.0 38.0 7 37.30975 38.0 38.0 38.0 37.0 38.0 8 37.2335 38.0 38.0 38.0 37.0 38.0 9 37.2295 38.0 38.0 38.0 37.0 38.0 10-14 37.16015 38.0 38.0 38.0 37.0 38.0 15-19 36.9292 38.0 38.0 38.0 36.0 38.0 20-24 37.05225 38.0 38.0 38.0 36.8 38.0 25-29 37.1389 38.0 38.0 38.0 37.0 38.0 30-34 37.157349999999994 38.0 38.0 38.0 37.0 38.0 35-39 37.20224999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.09665 38.0 38.0 38.0 37.0 38.0 45-49 37.0572 38.0 38.0 38.0 37.0 38.0 50-54 37.0863 38.0 38.0 38.0 37.0 38.0 55-59 36.19955 38.0 37.0 38.0 31.0 38.0 60-64 37.00025 38.0 38.0 38.0 36.4 38.0 65-69 36.9625 38.0 38.0 38.0 36.4 38.0 70-74 36.9394 38.0 38.0 38.0 36.4 38.0 75-79 36.8995 38.0 38.0 38.0 36.2 38.0 80-84 36.90515 38.0 38.0 38.0 36.0 38.0 85-89 36.854699999999994 38.0 38.0 38.0 36.0 38.0 90-94 36.767399999999995 38.0 38.0 38.0 35.8 38.0 95-99 36.72834999999999 38.0 38.0 38.0 36.0 38.0 100-104 36.68395 38.0 38.0 38.0 35.8 38.0 105-109 36.53925 38.0 38.0 38.0 34.8 38.0 110-114 36.53395 38.0 38.0 38.0 35.0 38.0 115-119 36.08265 38.0 37.8 38.0 33.0 38.0 120-124 36.1352 38.0 38.0 38.0 33.8 38.0 125-129 36.155950000000004 38.0 38.0 38.0 34.0 38.0 130-134 35.741949999999996 38.0 37.6 38.0 32.4 38.0 135-139 35.7903 38.0 38.0 38.0 33.4 38.0 140-144 35.5402 38.0 38.0 38.0 32.2 38.0 145-149 34.88825 38.0 36.6 38.0 31.0 38.0 150 29.2725 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 2.0 5 1.0 6 1.0 7 2.0 8 0.0 9 0.0 10 1.0 11 1.0 12 3.0 13 1.0 14 0.0 15 1.0 16 3.0 17 8.0 18 5.0 19 9.0 20 3.0 21 8.0 22 14.0 23 8.0 24 10.0 25 11.0 26 17.0 27 25.0 28 29.0 29 26.0 30 31.0 31 53.0 32 50.0 33 74.0 34 87.0 35 160.0 36 339.0 37 3014.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.4 20.125 14.149999999999999 28.325 2 28.249999999999996 24.375 31.574999999999996 15.8 3 19.75 27.725 32.574999999999996 19.950000000000003 4 24.0 32.975 24.224999999999998 18.8 5 25.2 37.175000000000004 21.825 15.8 6 20.275000000000002 40.1 22.05 17.575 7 20.349999999999998 22.325 39.125 18.2 8 21.775 25.624999999999996 29.5 23.1 9 22.55 25.224999999999998 29.9 22.325 10-14 23.863124718595227 29.211066086347493 26.299464705588072 20.626344489469208 15-19 23.774264558735243 27.911747048228936 28.126876125675405 20.187112267360416 20-24 23.186593296648326 28.45422711355678 27.6288144072036 20.730365182591296 25-29 23.589153492095257 27.806684010406247 28.10686411847108 20.497298379027416 30-34 23.727118135440634 27.738321496448936 28.053416024807444 20.48114434330299 35-39 23.663014658061936 28.56571114112762 27.4951223172745 20.276151883535945 40-44 23.553843074459568 28.002401921537228 27.942353883106485 20.501401120896716 45-49 23.44962210320837 27.593973672355975 28.670103608789226 20.28630061564643 50-54 23.659574468085108 27.904881101376724 28.540675844806007 19.894868585732166 55-59 23.64073295283869 27.63592670471613 28.36187043156103 20.36146991088415 60-64 23.01996297593436 27.923150047530893 28.54855656176515 20.508330414769603 65-69 23.72686343171586 27.6288144072036 28.51425712856428 20.13006503251626 70-74 23.375518983542594 27.947576409384222 28.592866790055528 20.08403781701766 75-79 22.99649824912456 27.32366183091546 29.094547273636817 20.58529264632316 80-84 23.490268674638514 27.237704507930154 28.99884925201381 20.273177565417523 85-89 23.625081319121254 27.393284291647902 28.889556122704295 20.09207826652655 90-94 23.429286608260323 27.148936170212767 29.09136420525657 20.330413016270338 95-99 23.95317424583521 27.655210365701137 28.43063685026765 19.96097853819601 100-104 23.990000000000002 27.474999999999998 29.049999999999997 19.485 105-109 23.827382738273826 27.357735773577357 28.68786878687869 20.12701270127013 110-114 23.90478095619124 27.360472094418885 28.775755151030207 19.95899179835967 115-119 23.887166149844955 27.673301990597178 28.4185255576673 20.02100630189057 120-124 23.98 27.334999999999997 28.78 19.905 125-129 23.903585537830672 28.09921488223234 28.254238135720357 19.742961444216633 130-134 23.95359303895584 27.499124868730306 28.754313146972045 19.7929689453418 135-139 23.7023702370237 27.827782778277825 28.52785278527853 19.94199419941994 140-144 24.188539370867563 27.454417952314163 28.5013023442196 19.85574033259868 145-149 24.495922349527195 27.597938660129085 28.523540301195776 19.382598689147944 150 25.069356872635563 27.137452711223204 28.650693568726354 19.14249684741488 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 0.5 23 2.0 24 3.0 25 2.5 26 3.5 27 5.5 28 7.5 29 12.0 30 17.0 31 23.0 32 31.0 33 38.5 34 46.0 35 73.5 36 96.0 37 105.5 38 124.0 39 159.5 40 203.5 41 222.5 42 260.0 43 286.5 44 287.5 45 299.0 46 282.0 47 261.5 48 241.0 49 192.0 50 156.0 51 135.5 52 98.5 53 76.5 54 64.0 55 45.5 56 38.0 57 28.0 58 19.0 59 12.0 60 6.0 61 3.5 62 3.0 63 3.0 64 3.0 65 5.0 66 3.0 67 0.5 68 2.0 69 2.5 70 1.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.055 15-19 0.06 20-24 0.05 25-29 0.06 30-34 0.03 35-39 0.055 40-44 0.08 45-49 0.105 50-54 0.125 55-59 0.13 60-64 0.065 65-69 0.05 70-74 0.045 75-79 0.05 80-84 0.065 85-89 0.08499999999999999 90-94 0.125 95-99 0.055 100-104 0.0 105-109 0.01 110-114 0.02 115-119 0.03 120-124 0.0 125-129 0.015 130-134 0.015 135-139 0.01 140-144 0.18 145-149 0.065 150 0.8750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.9624999999999999 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.1375 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.8375 0.0 0.0 0.0 0.0 122-123 2.0625 0.0 0.0 0.0 0.0 124-125 2.2875 0.0 0.0 0.0 0.0 126-127 2.55 0.0 0.0 0.0 0.0 128-129 2.9375 0.0 0.0 0.0 0.0 130-131 3.3875 0.0 0.0 0.0 0.0 132-133 3.75 0.0 0.0 0.0 0.0 134-135 4.0625 0.0 0.0 0.0 0.0 136-137 4.4125 0.0 0.0 0.0 0.0 138 4.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCGATG 10 0.006973645 144.0 2 CATCGAT 10 0.006973645 144.0 1 >>END_MODULE Read 2333486 spots for SRR4237637.sra Written 2333486 spots for SRR4237637.sra Read 2333486 spots for SRR4237637.sra Written 2333486 spots for SRR4237637.sra Read 2333486 spots for SRR4237637.sra Written 2333486 spots for SRR4237637.sra Read 2333486 spots for SRR4237637.sra Written 2333486 spots for SRR4237637.sra Read 2333486 spots for SRR4237637.sra Written 2333486 spots for SRR4237637.sra Read 2333486 spots for SRR4237637.sra Written 2333486 spots for SRR4237637.sra Read 2333486 spots for SRR4237637.sra Written 2333486 spots for SRR4237637.sra Read 2333486 spots for SRR4237637.sra Written 2333486 spots for SRR4237637.sra Read 2333486 spots for SRR4237637.sra Written 2333486 spots for SRR4237637.sra Read 2333486 spots for SRR4237637.sra Written 2333486 spots for SRR4237637.sra Read 2333486 spots for SRR4237637.sra Written 2333486 spots for SRR4237637.sra Read 2333486 spots for SRR4237637.sra Written 2333486 spots for SRR4237637.sra Read 2333486 spots for SRR4237637.sra Written 2333486 spots for SRR4237637.sra Read 2333486 spots for SRR4237637.sra Written 2333486 spots for SRR4237637.sra Read 2333486 spots for SRR4237637.sra Written 2333486 spots for SRR4237637.sra Read 2333486 spots for SRR4237637.sra Written 2333486 spots for SRR4237637.sra Read 2333486 spots for SRR4237637.sra Written 2333486 spots for SRR4237637.sra Read 2333486 spots for SRR4237637.sra Written 2333486 spots for SRR4237637.sra Read 2333495 spots for SRR4237637.sra Written 2333495 spots for SRR4237637.sra Read 2333486 spots for SRR4237637.sra Written 2333486 spots for SRR4237637.sra SRR ids: ['SRR4237637.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qmr_cpgz SRR4237637.sra spots: 46669729 blocks: [[1, 2333486], [2333487, 4666972], [4666973, 7000458], [7000459, 9333944], [9333945, 11667430], [11667431, 14000916], [14000917, 16334402], [16334403, 18667888], [18667889, 21001374], [21001375, 23334860], [23334861, 25668346], [25668347, 28001832], [28001833, 30335318], [30335319, 32668804], [32668805, 35002290], [35002291, 37335776], [37335777, 39669262], [39669263, 42002748], [42002749, 44336234], [44336235, 46669729]] SRR4237637 file size 15701987 SRR4237637 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237637 SRR4237637_1.fastq SRR4237637_2.fastq Input file: SRR4237637_1.fastq Paired file: SRR4237637_2.fastq trimmed: SRR4237637-trimmed-pair1.fastq, SRR4237637-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:48:49 2025 >> started Wed Feb 12 19:49:37 2025 >> done (47.604s) 46669729 read pairs processed; of these: 26941 ( 0.06%) short read pairs filtered out after trimming by size control 44655 ( 0.10%) empty read pairs filtered out after trimming by size control 46598133 (99.85%) read pairs available; of these: 13833583 (29.69%) trimmed read pairs available after processing 32764550 (70.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 3 0.00% 20 5 0.00% 21 3 0.00% 22 10 0.00% 23 3 0.00% 24 3 0.00% 25 11 0.00% 26 8 0.00% 27 15 0.00% 28 20 0.00% 29 12 0.00% 30 25 0.00% 31 19 0.00% 32 15 0.00% 33 23 0.00% 34 23 0.00% 35 23 0.00% 36 29 0.00% 37 33 0.00% 38 44 0.00% 39 46 0.00% 40 35 0.00% 41 40 0.00% 42 59 0.00% 43 58 0.00% 44 50 0.00% 45 71 0.00% 46 77 0.00% 47 91 0.00% 48 82 0.00% 49 115 0.00% 50 111 0.00% 51 129 0.00% 52 149 0.00% 53 145 0.00% 54 164 0.00% 55 168 0.00% 56 201 0.00% 57 259 0.00% 58 271 0.00% 59 256 0.00% 60 290 0.00% 61 313 0.00% 62 382 0.00% 63 419 0.00% 64 506 0.00% 65 591 0.00% 66 669 0.00% 67 959 0.00% 68 1333 0.00% 69 2868 0.01% 70 2643 0.01% 71 1274 0.00% 72 1223 0.00% 73 1413 0.00% 74 1562 0.00% 75 1650 0.00% 76 1851 0.00% 77 2004 0.00% 78 2295 0.00% 79 2560 0.01% 80 2880 0.01% 81 3283 0.01% 82 3708 0.01% 83 4262 0.01% 84 6197 0.01% 85 6781 0.01% 86 7579 0.02% 87 8336 0.02% 88 9316 0.02% 89 9570 0.02% 90 10432 0.02% 91 11711 0.03% 92 13824 0.03% 93 13359 0.03% 94 14185 0.03% 95 15578 0.03% 96 17481 0.04% 97 17975 0.04% 98 19083 0.04% 99 20073 0.04% 100 22178 0.05% 101 23052 0.05% 102 24621 0.05% 103 26826 0.06% 104 28759 0.06% 105 30692 0.07% 106 32834 0.07% 107 34819 0.07% 108 36900 0.08% 109 38707 0.08% 110 40352 0.09% 111 42286 0.09% 112 45398 0.10% 113 47192 0.10% 114 50279 0.11% 115 53626 0.12% 116 56485 0.12% 117 60908 0.13% 118 62912 0.14% 119 64486 0.14% 120 67287 0.14% 121 70192 0.15% 122 73175 0.16% 123 76317 0.16% 124 80219 0.17% 125 84080 0.18% 126 87674 0.19% 127 92793 0.20% 128 96535 0.21% 129 100278 0.22% 130 105066 0.23% 131 109069 0.23% 132 113472 0.24% 133 119052 0.26% 134 124455 0.27% 135 131151 0.28% 136 139077 0.30% 137 147237 0.32% 138 156824 0.34% 139 168100 0.36% 140 179116 0.38% 141 192712 0.41% 142 211155 0.45% 143 237354 0.51% 144 279899 0.60% 145 349849 0.75% 146 405013 0.87% 147 625047 1.34% 148 1118621 2.40% 149 7024117 15.07% 150 32764550 70.31% 46598133 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=13.28 fanout-score-rank=9 prefix-density=0.35 prefix-fanout=7.0 sequence=GGTGCTGGTGCTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=369.49 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=19.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=7.69 fanout-score-rank=21 prefix-density=0.23 prefix-fanout=5.0 sequence=CAGCACCAGCACC criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=223.92 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=28.7 sequence=AAGAAGAAGAAA SRR4237637 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:50:20 Started mapping on | Feb 12 19:50:20 Finished on | Feb 12 19:53:59 Mapping speed, Million of reads per hour | 766.00 Number of input reads | 46598133 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 44868745 Uniquely mapped reads % | 96.29% Average mapped length | 294.63 Number of splices: Total | 36048045 Number of splices: Annotated (sjdb) | 35338180 Number of splices: GT/AG | 35475177 Number of splices: GC/AG | 432825 Number of splices: AT/AC | 38644 Number of splices: Non-canonical | 101399 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 953756 % of reads mapped to multiple loci | 2.05% Number of reads mapped to too many loci | 131601 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.32% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 802050 802050 802050 N_multimapping 953756 953756 953756 N_noFeature 1262051 44215761 1563161 N_ambiguous 541060 2875 187451 UnstrandedReadsAssigned:43065634 PositiveStrandReadsAssigned:650109 NegativeStrandReadsAssigned:43118133 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237637 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237637-trimmed-pair1.fastq SRR4237637-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 46,598,133 reads, 43,003,405 reads pseudoaligned [quant] estimated average fragment length: 238.819 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52401 SRR4237637.ke.tsv 34699 SRR4237637.se.tsv 87100 total ==> SRR4237637.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.18 911 11.0735 Potri.005G024800.1.v4.1 1035 797.181 168 4.5602 Potri.004G059700.1.v4.1 961 723.211 71 2.12435 Potri.007G009000.2.v4.1 1416 1178.18 0 0 Potri.003G141000.2.v4.1 2943 2705.18 575.156 4.60067 Potri.016G087400.1.v4.1 270 75.6119 5647 1616.07 Potri.015G069301.1.v4.1 564 329.515 0 0 Potri.010G195200.1.v4.1 1773 1535.18 366 5.15885 Potri.012G127500.1.v4.1 977 739.201 17459 511.079 ==> SRR4237637.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8074 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 853 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237637 completed mapping pipeline successfully