Starting /dee2/code/volunteer_pipeline.sh SRR4237638 current disk space = 3051056177152 free memory = 1575102224 SRR4237638 SRAfilesize 49595c76028ed6860871ba625a4795e0 SRR4237638.sra SRR4237638.sra file validated SRR4237638 is paired end SRR4237638 is conventional basespace SRR4237638 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237638_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.444 34.0 33.0 34.0 33.0 34.0 2 33.4175 34.0 34.0 34.0 33.0 34.0 3 33.486 34.0 34.0 34.0 33.0 34.0 4 33.4775 34.0 34.0 34.0 33.0 34.0 5 33.114 34.0 34.0 34.0 33.0 34.0 6 37.08925 38.0 38.0 38.0 36.0 38.0 7 37.39225 38.0 38.0 38.0 37.0 38.0 8 37.6025 38.0 38.0 38.0 37.0 38.0 9 37.65275 38.0 38.0 38.0 38.0 38.0 10-14 37.61635 38.0 38.0 38.0 38.0 38.0 15-19 37.62585 38.0 38.0 38.0 38.0 38.0 20-24 37.5647 38.0 38.0 38.0 38.0 38.0 25-29 37.5389 38.0 38.0 38.0 38.0 38.0 30-34 37.43625000000001 38.0 38.0 38.0 37.6 38.0 35-39 37.4327 38.0 38.0 38.0 37.2 38.0 40-44 37.3871 38.0 38.0 38.0 37.0 38.0 45-49 37.418549999999996 38.0 38.0 38.0 37.2 38.0 50-54 37.245349999999995 38.0 38.0 38.0 36.8 38.0 55-59 37.20985 38.0 38.0 38.0 36.4 38.0 60-64 37.1808 38.0 38.0 38.0 36.4 38.0 65-69 36.473850000000006 38.0 37.4 38.0 31.4 38.0 70-74 37.00115000000001 38.0 38.0 38.0 36.0 38.0 75-79 37.01505 38.0 38.0 38.0 36.0 38.0 80-84 36.8924 38.0 38.0 38.0 35.4 38.0 85-89 36.80685 38.0 38.0 38.0 35.2 38.0 90-94 36.951350000000005 38.0 38.0 38.0 35.8 38.0 95-99 36.82605 38.0 38.0 38.0 35.4 38.0 100-104 35.54565000000001 38.0 36.8 38.0 29.2 38.0 105-109 36.4158 38.0 37.4 38.0 33.6 38.0 110-114 36.6771 38.0 38.0 38.0 34.8 38.0 115-119 36.6065 38.0 38.0 38.0 34.6 38.0 120-124 36.567049999999995 38.0 38.0 38.0 34.4 38.0 125-129 35.889050000000005 38.0 37.2 38.0 31.8 38.0 130-134 36.0304 38.0 37.6 38.0 32.8 38.0 135-139 35.9964 38.0 37.6 38.0 33.2 38.0 140-144 35.895300000000006 38.0 37.2 38.0 32.6 38.0 145-149 34.99229999999999 38.0 36.4 38.0 29.2 38.0 150 30.137 35.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 4.0 19 1.0 20 2.0 21 2.0 22 2.0 23 6.0 24 8.0 25 6.0 26 5.0 27 18.0 28 33.0 29 22.0 30 40.0 31 44.0 32 67.0 33 82.0 34 110.0 35 212.0 36 514.0 37 2818.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.525 12.25 8.649999999999999 39.574999999999996 2 22.27784730913642 15.844806007509387 35.39424280350438 26.48310387984981 3 19.675 19.775000000000002 25.8 34.75 4 22.95 29.349999999999998 21.45 26.25 5 21.213653603034132 34.15929203539823 25.082174462705435 19.5448798988622 6 16.35 38.05 23.7 21.9 7 13.575000000000001 27.400000000000002 41.575 17.45 8 16.975 25.95 31.225 25.85 9 17.05 24.349999999999998 34.025 24.575 10-14 19.064999999999998 31.25 27.005000000000003 22.68 15-19 19.555 29.815 27.125 23.505000000000003 20-24 19.56 29.744999999999997 27.725 22.97 25-29 19.25 29.965000000000003 27.435 23.35 30-34 19.015 29.799999999999997 27.089999999999996 24.095 35-39 19.400000000000002 30.080000000000002 26.865 23.655 40-44 19.605 29.715000000000003 27.42 23.26 45-49 19.56 29.835 27.279999999999998 23.325000000000003 50-54 19.71 29.544999999999998 27.065 23.68 55-59 20.04 29.404999999999998 26.915 23.64 60-64 19.755 29.595 27.200000000000003 23.45 65-69 19.095000000000002 29.849999999999998 26.805 24.25 70-74 19.965 29.535 26.650000000000002 23.849999999999998 75-79 19.66 29.205 27.43 23.705000000000002 80-84 20.165 29.13 27.584999999999997 23.119999999999997 85-89 19.73 29.134999999999998 27.345000000000002 23.79 90-94 19.400000000000002 29.45 27.18 23.97 95-99 19.82 29.12 27.12 23.94 100-104 20.055 29.225 27.215 23.505000000000003 105-109 19.89 28.799999999999997 27.315 23.995 110-114 19.845 28.875 27.229999999999997 24.05 115-119 20.16 29.544999999999998 26.590000000000003 23.705000000000002 120-124 19.994999999999997 29.104999999999997 27.389999999999997 23.51 125-129 19.98999749937484 28.842210552638157 27.191797949487373 23.975993998499625 130-134 20.724999999999998 28.7 26.765 23.810000000000002 135-139 20.320080020005 29.097274318579647 26.696674168542135 23.885971492873217 140-144 21.200300075018756 28.527131782945737 26.056514128532132 24.216054013503378 145-149 20.735 29.145 26.355 23.765 150 20.39688520472243 28.96257221803567 25.62170308967596 25.018839487565934 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 1.0 19 2.0 20 1.5 21 3.0 22 2.5 23 1.5 24 2.0 25 2.5 26 4.0 27 6.5 28 12.0 29 18.5 30 28.0 31 43.0 32 52.0 33 59.5 34 74.5 35 98.0 36 118.0 37 127.5 38 145.5 39 166.0 40 190.0 41 216.0 42 236.0 43 251.0 44 253.5 45 255.0 46 238.5 47 222.0 48 198.5 49 167.0 50 153.5 51 130.0 52 108.0 53 94.5 54 81.5 55 55.5 56 35.0 57 33.0 58 28.0 59 23.5 60 17.0 61 8.0 62 5.0 63 4.0 64 5.0 65 6.0 66 4.0 67 4.0 68 3.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 1.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.025 130-134 0.0 135-139 0.025 140-144 0.025 145-149 0.0 150 0.475 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.4021110831867303 0.8 3 0.025131942699170642 0.075 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.5499999999999998 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.425 0.0 0.0 0.0 0.0 116-117 2.8499999999999996 0.0 0.0 0.0 0.0 118-119 3.3 0.0 0.0 0.0 0.0 120-121 3.675 0.0 0.0 0.0 0.0 122-123 4.2625 0.0 0.0 0.0 0.0 124-125 5.025 0.0 0.0 0.0 0.0 126-127 5.6875 0.0 0.0 0.0 0.0 128-129 6.3125 0.0 0.0 0.0 0.0 130-131 7.074999999999999 0.0 0.0 0.0 0.0 132-133 7.887499999999999 0.0 0.0 0.0 0.0 134-135 8.662500000000001 0.0 0.0 0.0 0.0 136-137 9.525 0.0 0.0 0.0 0.0 138 10.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGAAAC 10 0.006465634 147.64102 1 GTTGGTT 10 0.006465634 147.64102 1 >>END_MODULE SRR4237638 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237638_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.935 33.0 33.0 34.0 32.0 34.0 2 33.03575 34.0 33.0 34.0 32.0 34.0 3 33.03725 34.0 33.0 34.0 32.0 34.0 4 33.108 34.0 33.0 34.0 33.0 34.0 5 32.9905 34.0 33.0 34.0 32.0 34.0 6 37.19275 38.0 38.0 38.0 37.0 38.0 7 37.1885 38.0 38.0 38.0 37.0 38.0 8 37.16975 38.0 38.0 38.0 37.0 38.0 9 36.97575 38.0 38.0 38.0 37.0 38.0 10-14 36.9483 38.0 38.0 38.0 36.0 38.0 15-19 37.0697 38.0 38.0 38.0 36.6 38.0 20-24 36.6772 38.0 37.8 38.0 34.8 38.0 25-29 35.4474 38.0 35.4 38.0 27.0 38.0 30-34 36.9366 38.0 38.0 38.0 36.2 38.0 35-39 36.4647 38.0 37.6 38.0 32.0 38.0 40-44 36.860850000000006 38.0 37.8 38.0 35.8 38.0 45-49 36.8772 38.0 38.0 38.0 36.2 38.0 50-54 36.96145 38.0 38.0 38.0 36.8 38.0 55-59 37.035 38.0 38.0 38.0 37.0 38.0 60-64 36.53535000000001 38.0 38.0 38.0 34.4 38.0 65-69 36.16365 38.0 37.6 38.0 32.4 38.0 70-74 36.460750000000004 38.0 37.8 38.0 33.6 38.0 75-79 35.8557 38.0 36.8 38.0 30.0 38.0 80-84 36.81134999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.23855 38.0 37.6 38.0 33.4 38.0 90-94 36.68015 38.0 38.0 38.0 35.8 38.0 95-99 36.71445 38.0 38.0 38.0 36.0 38.0 100-104 36.488099999999996 38.0 38.0 38.0 35.0 38.0 105-109 35.2094 38.0 35.6 38.0 28.6 38.0 110-114 36.36095 38.0 38.0 38.0 34.4 38.0 115-119 36.2279 38.0 38.0 38.0 34.0 38.0 120-124 36.1736 38.0 38.0 38.0 34.0 38.0 125-129 36.033049999999996 38.0 38.0 38.0 33.6 38.0 130-134 35.998149999999995 38.0 38.0 38.0 34.0 38.0 135-139 35.696749999999994 38.0 37.8 38.0 32.8 38.0 140-144 35.3544 38.0 36.8 38.0 31.8 38.0 145-149 34.97165 38.0 36.4 38.0 31.2 38.0 150 29.15375 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 7.0 4 2.0 5 1.0 6 0.0 7 0.0 8 5.0 9 0.0 10 3.0 11 2.0 12 3.0 13 0.0 14 1.0 15 2.0 16 4.0 17 2.0 18 4.0 19 6.0 20 1.0 21 5.0 22 8.0 23 6.0 24 16.0 25 14.0 26 21.0 27 17.0 28 24.0 29 40.0 30 57.0 31 43.0 32 56.0 33 94.0 34 137.0 35 216.0 36 527.0 37 2673.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.775 20.474999999999998 14.124999999999998 27.625 2 28.449999999999996 23.5 34.025 14.025000000000002 3 22.75 26.724999999999998 32.05 18.475 4 25.75 33.525 22.125 18.6 5 25.5 37.574999999999996 21.75 15.174999999999999 6 20.846905537459286 38.86244049110499 22.90152843898772 17.38912553244801 7 21.457185778668002 20.756134201301954 38.883324987481224 18.903355032548824 8 20.555833750625936 25.43815723585378 30.120180270405612 23.885828743114672 9 22.86287290047631 23.18876911506643 30.960140386061667 22.98821759839559 10-14 24.97242001805235 28.65810851469261 26.707451609668038 19.662019857587 15-19 24.189751039422934 27.285478134548914 27.926664329008666 20.598106497019486 20-24 23.41895748835812 28.095738821290873 28.125782384457466 20.359521305893548 25-29 24.073331997595673 27.795031055900623 27.92526547786015 20.206371468643557 30-34 23.753504205046056 27.50800961153384 28.52923508209852 20.209251101321584 35-39 23.350533540403788 27.93447222083062 28.11983367566755 20.59516056309804 40-44 23.887775551102205 28.421843687374746 27.77555110220441 19.914829659318638 45-49 24.019263569780275 27.204775760008026 28.800040132437044 19.975920537774655 50-54 23.907700025081517 27.915726109857037 28.66817155756208 19.508402307499374 55-59 23.715534126864547 28.31098387825825 27.984531163678366 19.988950831198835 60-64 23.477998794454493 28.044002411091018 28.365481213582477 20.112517580872012 65-69 23.796630565583634 28.32430806257521 27.822904131568393 20.056157240272764 70-74 24.246527255403443 27.521187503134247 27.751868010631362 20.480417230830952 75-79 23.786115569823433 27.171950240770464 28.92255216693419 20.11938202247191 80-84 23.752004811547714 27.896952686447474 28.042301523656775 20.308740978348037 85-89 23.3304901911595 27.760774672620542 28.663890421955745 20.24484471426421 90-94 23.5128758596456 26.996636715024348 28.91923096230109 20.571256463028963 95-99 23.403507008993618 27.37778224388283 28.91021454052153 20.30849620660202 100-104 24.083454536335825 27.473795074978685 28.847986358393097 19.594764030292392 105-109 23.785409877162195 27.164702933065932 28.85936324893457 20.190523940837302 110-114 23.85588117221999 27.373544761140106 28.472501003613004 20.298073063026898 115-119 23.570747377403002 27.90744365808362 29.006675701450586 19.515133263062793 120-124 24.681448780977224 27.67131534062406 27.882010635095817 19.7652252433029 125-129 24.548374146928946 27.98073063026897 27.759935768767562 19.710959454034523 130-134 25.271970722414398 27.59312177269765 27.62320148393242 19.511706020955533 135-139 25.459475745706538 27.844732349101136 27.24716280004017 19.448629105152154 140-144 25.762984564332044 28.271909095479913 27.150686309015033 18.81442003117301 145-149 26.229919678714857 27.65060240963855 26.912650602409638 19.20682730923695 150 26.927939317319847 26.447534766118835 27.206068268015173 19.418457648546145 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 2.0 4 2.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 1.0 12 1.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 4.0 25 4.5 26 4.0 27 6.0 28 11.5 29 16.0 30 19.0 31 24.5 32 30.0 33 38.0 34 50.0 35 65.0 36 90.0 37 114.5 38 147.5 39 182.0 40 197.5 41 216.0 42 248.5 43 270.0 44 271.0 45 263.0 46 255.0 47 240.5 48 212.5 49 207.0 50 175.0 51 127.5 52 114.0 53 96.5 54 71.5 55 54.5 56 45.5 57 30.5 58 21.0 59 14.5 60 9.0 61 9.5 62 7.5 63 4.0 64 4.5 65 4.0 66 2.0 67 1.5 68 2.5 69 2.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.22499999999999998 7 0.15 8 0.15 9 0.27499999999999997 10-14 0.29 15-19 0.185 20-24 0.145 25-29 0.18 30-34 0.12 35-39 0.19499999999999998 40-44 0.2 45-49 0.33 50-54 0.325 55-59 0.445 60-64 0.45999999999999996 65-69 0.27999999999999997 70-74 0.295 75-79 0.32 80-84 0.24 85-89 0.345 90-94 0.395 95-99 0.485 100-104 0.305 105-109 0.27499999999999997 110-114 0.36 115-119 0.385 120-124 0.33 125-129 0.36 130-134 0.265 135-139 0.43 140-144 0.555 145-149 0.4 150 1.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.175 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114-115 2.5 0.0 0.0 0.0 0.0 116-117 2.95 0.0 0.0 0.0 0.0 118-119 3.4 0.0 0.0 0.0 0.0 120-121 3.75 0.0 0.0 0.0 0.0 122-123 4.3375 0.0 0.0 0.0 0.0 124-125 5.1 0.0 0.0 0.0 0.0 126-127 5.7625 0.0 0.0 0.0 0.0 128-129 6.35 0.0 0.0 0.0 0.0 130-131 7.125 0.0 0.0 0.0 0.0 132-133 7.9375 0.0 0.0 0.0 0.0 134-135 8.712499999999999 0.0 0.0 0.0 0.0 136-137 9.525 0.0 0.0 0.0 0.0 138 10.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACAAT 10 0.006973645 144.0 1 GATGACT 10 0.006973645 144.0 2 TCCACCA 10 0.006973645 144.0 8 >>END_MODULE Read 2476638 spots for SRR4237638.sra Written 2476638 spots for SRR4237638.sra Read 2476638 spots for SRR4237638.sra Written 2476638 spots for SRR4237638.sra Read 2476638 spots for SRR4237638.sra Written 2476638 spots for SRR4237638.sra Read 2476638 spots for SRR4237638.sra Written 2476638 spots for SRR4237638.sra Read 2476638 spots for SRR4237638.sra Written 2476638 spots for SRR4237638.sra Read 2476638 spots for SRR4237638.sra Written 2476638 spots for SRR4237638.sra Read 2476638 spots for SRR4237638.sra Written 2476638 spots for SRR4237638.sra Read 2476638 spots for SRR4237638.sra Written 2476638 spots for SRR4237638.sra Read 2476638 spots for SRR4237638.sra Written 2476638 spots for SRR4237638.sra Read 2476638 spots for SRR4237638.sra Written 2476638 spots for SRR4237638.sra Read 2476638 spots for SRR4237638.sra Written 2476638 spots for SRR4237638.sra Read 2476638 spots for SRR4237638.sra Written 2476638 spots for SRR4237638.sra Read 2476638 spots for SRR4237638.sra Written 2476638 spots for SRR4237638.sra Read 2476638 spots for SRR4237638.sra Written 2476638 spots for SRR4237638.sra Read 2476638 spots for SRR4237638.sra Written 2476638 spots for SRR4237638.sra Read 2476638 spots for SRR4237638.sra Written 2476638 spots for SRR4237638.sra Read 2476638 spots for SRR4237638.sra Written 2476638 spots for SRR4237638.sra Read 2476638 spots for SRR4237638.sra Written 2476638 spots for SRR4237638.sra Read 2476654 spots for SRR4237638.sra Written 2476654 spots for SRR4237638.sra Read 2476638 spots for SRR4237638.sra Written 2476638 spots for SRR4237638.sra SRR ids: ['SRR4237638.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ohblnixh SRR4237638.sra spots: 49532776 blocks: [[1, 2476638], [2476639, 4953276], [4953277, 7429914], [7429915, 9906552], [9906553, 12383190], [12383191, 14859828], [14859829, 17336466], [17336467, 19813104], [19813105, 22289742], [22289743, 24766380], [24766381, 27243018], [27243019, 29719656], [29719657, 32196294], [32196295, 34672932], [34672933, 37149570], [37149571, 39626208], [39626209, 42102846], [42102847, 44579484], [44579485, 47056122], [47056123, 49532776]] SRR4237638 file size 16666588 SRR4237638 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237638 SRR4237638_1.fastq SRR4237638_2.fastq Input file: SRR4237638_1.fastq Paired file: SRR4237638_2.fastq trimmed: SRR4237638-trimmed-pair1.fastq, SRR4237638-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:34:00 2025 >> started Wed Feb 12 19:34:58 2025 >> done (57.408s) 49532776 read pairs processed; of these: 30158 ( 0.06%) short read pairs filtered out after trimming by size control 33889 ( 0.07%) empty read pairs filtered out after trimming by size control 49468729 (99.87%) read pairs available; of these: 18014619 (36.42%) trimmed read pairs available after processing 31454110 (63.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 10 0.00% 20 9 0.00% 21 4 0.00% 22 9 0.00% 23 12 0.00% 24 13 0.00% 25 18 0.00% 26 12 0.00% 27 20 0.00% 28 19 0.00% 29 8 0.00% 30 27 0.00% 31 11 0.00% 32 17 0.00% 33 29 0.00% 34 32 0.00% 35 44 0.00% 36 41 0.00% 37 43 0.00% 38 52 0.00% 39 55 0.00% 40 67 0.00% 41 73 0.00% 42 58 0.00% 43 76 0.00% 44 74 0.00% 45 84 0.00% 46 103 0.00% 47 127 0.00% 48 124 0.00% 49 150 0.00% 50 183 0.00% 51 187 0.00% 52 208 0.00% 53 215 0.00% 54 241 0.00% 55 287 0.00% 56 287 0.00% 57 376 0.00% 58 406 0.00% 59 493 0.00% 60 568 0.00% 61 633 0.00% 62 715 0.00% 63 781 0.00% 64 885 0.00% 65 1041 0.00% 66 1136 0.00% 67 1324 0.00% 68 1552 0.00% 69 2956 0.01% 70 3337 0.01% 71 2242 0.00% 72 2417 0.00% 73 2785 0.01% 74 3250 0.01% 75 3521 0.01% 76 4050 0.01% 77 4528 0.01% 78 4992 0.01% 79 5712 0.01% 80 6384 0.01% 81 7095 0.01% 82 8317 0.02% 83 9525 0.02% 84 11845 0.02% 85 13420 0.03% 86 14956 0.03% 87 17128 0.03% 88 18470 0.04% 89 19838 0.04% 90 22387 0.05% 91 23781 0.05% 92 25610 0.05% 93 28061 0.06% 94 31552 0.06% 95 36644 0.07% 96 38312 0.08% 97 42248 0.09% 98 42118 0.09% 99 45372 0.09% 100 48425 0.10% 101 51185 0.10% 102 55467 0.11% 103 59692 0.12% 104 64280 0.13% 105 69063 0.14% 106 74022 0.15% 107 78126 0.16% 108 81828 0.17% 109 86580 0.18% 110 89267 0.18% 111 93367 0.19% 112 98827 0.20% 113 103631 0.21% 114 109875 0.22% 115 115536 0.23% 116 122190 0.25% 117 128770 0.26% 118 132242 0.27% 119 135048 0.27% 120 138865 0.28% 121 144381 0.29% 122 147738 0.30% 123 153293 0.31% 124 160703 0.32% 125 166614 0.34% 126 173253 0.35% 127 179872 0.36% 128 184355 0.37% 129 192833 0.39% 130 196746 0.40% 131 201746 0.41% 132 207325 0.42% 133 214159 0.43% 134 219811 0.44% 135 228283 0.46% 136 237381 0.48% 137 245192 0.50% 138 256523 0.52% 139 267942 0.54% 140 279988 0.57% 141 296486 0.60% 142 317886 0.64% 143 336168 0.68% 144 373425 0.75% 145 427185 0.86% 146 499626 1.01% 147 670001 1.35% 148 1341703 2.71% 149 7241918 14.64% 150 31454110 63.58% 49468729 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=41 prefix-density=0.12 prefix-fanout=2.7 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=156.54 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=20.2 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=6.99 fanout-score-rank=20 prefix-density=0.20 prefix-fanout=4.1 sequence=ATCCAGAAGGAGTCCAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=286.12 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=28.7 sequence=AAGAAGAAGAAA SRR4237638 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:35:39 Started mapping on | Feb 12 19:35:40 Finished on | Feb 12 19:41:22 Mapping speed, Million of reads per hour | 520.72 Number of input reads | 49468729 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 46597132 Uniquely mapped reads % | 94.20% Average mapped length | 291.05 Number of splices: Total | 37403154 Number of splices: Annotated (sjdb) | 36647674 Number of splices: GT/AG | 36796426 Number of splices: GC/AG | 457140 Number of splices: AT/AC | 37828 Number of splices: Non-canonical | 111760 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 979097 % of reads mapped to multiple loci | 1.98% Number of reads mapped to too many loci | 215717 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.31% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1920764 1920764 1920764 N_multimapping 979097 979097 979097 N_noFeature 1473644 45881009 1842776 N_ambiguous 544368 3113 195733 UnstrandedReadsAssigned:44579120 PositiveStrandReadsAssigned:713010 NegativeStrandReadsAssigned:44558623 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237638 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237638-trimmed-pair1.fastq SRR4237638-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 49,468,729 reads, 44,528,649 reads pseudoaligned [quant] estimated average fragment length: 215.933 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,212 rounds 52401 SRR4237638.ke.tsv 34699 SRR4237638.se.tsv 87100 total ==> SRR4237638.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.07 1031.5 12.6506 Potri.005G024800.1.v4.1 1035 820.067 72 1.9415 Potri.004G059700.1.v4.1 961 746.091 125 3.70486 Potri.007G009000.2.v4.1 1416 1201.07 0 0 Potri.003G141000.2.v4.1 2943 2728.07 825.049 6.68772 Potri.016G087400.1.v4.1 270 89.7943 5435 1338.46 Potri.015G069301.1.v4.1 564 351.856 0 0 Potri.010G195200.1.v4.1 1773 1558.07 202 2.86694 Potri.012G127500.1.v4.1 977 762.082 14448 419.237 ==> SRR4237638.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6901 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 917 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237638 completed mapping pipeline successfully