Starting /dee2/code/volunteer_pipeline.sh SRR4237639 current disk space = 3051026944000 free memory = 1539022796 SRR4237639 SRAfilesize 68c908bc72901948fcbaaf65a44e3c8b SRR4237639.sra SRR4237639.sra file validated SRR4237639 is paired end SRR4237639 is conventional basespace SRR4237639 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237639_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.2885 34.0 33.0 34.0 18.0 34.0 2 32.57775 34.0 33.0 34.0 28.0 34.0 3 32.77875 34.0 33.0 34.0 31.0 34.0 4 33.0825 34.0 33.0 34.0 32.0 34.0 5 33.05775 34.0 33.0 34.0 32.0 34.0 6 36.7885 38.0 37.0 38.0 35.0 38.0 7 37.1205 38.0 38.0 38.0 36.0 38.0 8 37.2795 38.0 38.0 38.0 36.0 38.0 9 37.34175 38.0 38.0 38.0 37.0 38.0 10-14 37.32305 38.0 38.0 38.0 37.0 38.0 15-19 37.32 38.0 38.0 38.0 36.8 38.0 20-24 36.52485 38.0 37.0 38.0 32.2 38.0 25-29 35.383 38.0 35.4 38.0 26.0 38.0 30-34 36.963350000000005 38.0 38.0 38.0 35.8 38.0 35-39 37.09815 38.0 38.0 38.0 36.4 38.0 40-44 37.1126 38.0 38.0 38.0 36.0 38.0 45-49 37.132600000000004 38.0 38.0 38.0 36.0 38.0 50-54 37.086149999999996 38.0 38.0 38.0 36.0 38.0 55-59 37.066050000000004 38.0 38.0 38.0 36.0 38.0 60-64 37.02595 38.0 38.0 38.0 36.0 38.0 65-69 36.9476 38.0 38.0 38.0 36.0 38.0 70-74 35.437250000000006 38.0 35.4 38.0 29.6 38.0 75-79 36.2007 38.0 37.4 38.0 32.2 38.0 80-84 36.82065 38.0 38.0 38.0 35.2 38.0 85-89 36.9014 38.0 38.0 38.0 35.6 38.0 90-94 36.7842 38.0 38.0 38.0 35.0 38.0 95-99 36.819599999999994 38.0 38.0 38.0 35.0 38.0 100-104 36.68075 38.0 38.0 38.0 34.6 38.0 105-109 36.64149999999999 38.0 38.0 38.0 34.6 38.0 110-114 36.492999999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.4196 38.0 38.0 38.0 34.0 38.0 120-124 36.31165 38.0 38.0 38.0 34.0 38.0 125-129 35.321 38.0 36.0 38.0 28.6 38.0 130-134 34.669500000000006 38.0 34.2 38.0 26.8 38.0 135-139 35.41245 38.0 36.0 38.0 30.4 38.0 140-144 35.07430000000001 38.0 35.6 38.0 28.6 38.0 145-149 35.226299999999995 38.0 36.0 38.0 31.0 38.0 150 29.918 35.0 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 1.0 17 0.0 18 3.0 19 1.0 20 3.0 21 4.0 22 8.0 23 10.0 24 7.0 25 6.0 26 20.0 27 23.0 28 19.0 29 38.0 30 58.0 31 64.0 32 90.0 33 106.0 34 153.0 35 257.0 36 751.0 37 2375.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.22158312791016 12.407559572719803 10.682004930156122 35.68885236921391 2 23.075000000000003 15.725 33.5 27.700000000000003 3 19.85 19.650000000000002 27.3 33.2 4 23.549999999999997 28.349999999999998 23.175 24.925 5 20.575 35.0 23.674999999999997 20.75 6 18.125 36.55 24.425 20.9 7 14.299999999999999 26.775 41.9 17.025000000000002 8 16.650000000000002 25.2 31.974999999999998 26.174999999999997 9 17.175 24.975 33.800000000000004 24.05 10-14 19.855 30.714999999999996 26.91 22.52 15-19 19.265 30.214999999999996 27.165 23.355 20-24 19.215 29.49 27.715 23.580000000000002 25-29 19.814999999999998 29.110000000000003 27.74 23.335 30-34 19.49 29.635 27.395000000000003 23.48 35-39 19.615 28.67 27.805000000000003 23.91 40-44 19.605 29.310000000000002 27.169999999999998 23.915 45-49 20.11 29.505 26.565 23.82 50-54 19.7 29.154999999999998 27.6 23.544999999999998 55-59 19.515 29.385 27.175 23.925 60-64 19.17 28.794999999999998 27.705000000000002 24.33 65-69 19.77 29.220000000000002 27.634999999999998 23.375 70-74 19.845 28.799999999999997 27.474999999999998 23.880000000000003 75-79 19.91 29.065 27.265 23.76 80-84 19.865 29.235 27.05 23.849999999999998 85-89 19.455 29.115000000000002 27.900000000000002 23.53 90-94 19.46 28.625 27.725 24.19 95-99 19.755 28.835 27.495000000000005 23.915 100-104 20.25 29.09 27.400000000000002 23.26 105-109 19.91 28.345 27.68 24.065 110-114 19.919999999999998 28.910000000000004 27.639999999999997 23.53 115-119 20.455000000000002 29.085 27.1 23.36 120-124 20.07 28.754999999999995 27.05 24.125 125-129 20.095 28.965000000000003 27.439999999999998 23.5 130-134 20.974999999999998 28.4 27.034999999999997 23.59 135-139 20.145 28.645 27.439999999999998 23.77 140-144 20.32 28.810000000000002 27.325 23.544999999999998 145-149 20.3 28.48 26.900000000000002 24.32 150 19.775000000000002 29.375 26.474999999999998 24.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.0 20 0.5 21 1.0 22 2.0 23 3.5 24 2.5 25 2.5 26 4.0 27 3.5 28 12.5 29 22.5 30 28.5 31 33.0 32 40.0 33 51.0 34 72.0 35 80.5 36 79.0 37 112.5 38 143.0 39 167.0 40 204.5 41 222.0 42 242.5 43 276.5 44 279.5 45 254.0 46 243.0 47 253.5 48 236.5 49 187.5 50 158.0 51 138.0 52 106.0 53 91.5 54 75.5 55 48.0 56 33.0 57 25.0 58 16.0 59 9.5 60 5.0 61 5.0 62 6.5 63 3.0 64 2.5 65 3.0 66 1.5 67 0.5 68 2.5 69 3.5 70 1.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.2625 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.8125 0.0 0.0 0.0 0.0 122-123 2.05 0.0 0.0 0.0 0.0 124-125 2.4000000000000004 0.0 0.0 0.0 0.0 126-127 2.6875 0.0 0.0 0.0 0.0 128-129 2.9875 0.0 0.0 0.0 0.0 130-131 3.375 0.0 0.0 0.0 0.0 132-133 3.8125 0.0 0.0 0.0 0.0 134-135 4.2 0.0 0.0 0.0 0.0 136-137 4.5875 0.0 0.0 0.0 0.0 138 4.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237639 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237639_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.49925 33.0 33.0 34.0 31.0 34.0 2 32.6825 33.0 33.0 34.0 32.0 34.0 3 32.666 33.0 33.0 34.0 32.0 34.0 4 32.5685 33.0 33.0 34.0 32.0 34.0 5 32.6 33.0 33.0 34.0 32.0 34.0 6 34.10825 38.0 34.0 38.0 16.0 38.0 7 35.92425 38.0 37.0 38.0 31.0 38.0 8 36.22825 38.0 38.0 38.0 33.0 38.0 9 35.9685 38.0 37.0 38.0 33.0 38.0 10-14 36.53195000000001 38.0 38.0 38.0 34.8 38.0 15-19 35.32965 38.0 35.6 38.0 29.0 38.0 20-24 36.32254999999999 38.0 38.0 38.0 34.6 38.0 25-29 36.515249999999995 38.0 38.0 38.0 35.0 38.0 30-34 36.46955 38.0 38.0 38.0 35.0 38.0 35-39 35.7741 38.0 37.0 38.0 29.8 38.0 40-44 36.49175 38.0 38.0 38.0 35.0 38.0 45-49 36.391200000000005 38.0 38.0 38.0 34.6 38.0 50-54 36.5006 38.0 38.0 38.0 35.0 38.0 55-59 36.43194999999999 38.0 38.0 38.0 34.8 38.0 60-64 36.3967 38.0 38.0 38.0 34.4 38.0 65-69 36.335800000000006 38.0 38.0 38.0 34.6 38.0 70-74 36.3442 38.0 38.0 38.0 34.2 38.0 75-79 35.510749999999994 38.0 37.0 38.0 28.6 38.0 80-84 36.08475 38.0 38.0 38.0 34.0 38.0 85-89 36.0751 38.0 38.0 38.0 33.8 38.0 90-94 35.05605 37.8 35.4 38.0 30.2 38.0 95-99 35.33964999999999 38.0 36.6 38.0 30.6 38.0 100-104 35.74315 38.0 38.0 38.0 32.4 38.0 105-109 35.6596 38.0 38.0 38.0 32.0 38.0 110-114 35.6447 38.0 38.0 38.0 32.4 38.0 115-119 35.54385 38.0 37.6 38.0 31.4 38.0 120-124 35.3399 38.0 37.2 38.0 30.6 38.0 125-129 35.2024 38.0 37.0 38.0 30.2 38.0 130-134 34.82055 38.0 36.0 38.0 27.8 38.0 135-139 34.62335 38.0 36.0 38.0 26.8 38.0 140-144 34.1925 38.0 35.8 38.0 23.8 38.0 145-149 33.61465 38.0 35.0 38.0 18.0 38.0 150 27.45875 33.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 5.0 4 9.0 5 1.0 6 1.0 7 2.0 8 5.0 9 1.0 10 1.0 11 5.0 12 3.0 13 4.0 14 7.0 15 7.0 16 1.0 17 6.0 18 6.0 19 7.0 20 12.0 21 5.0 22 9.0 23 12.0 24 13.0 25 25.0 26 20.0 27 23.0 28 40.0 29 38.0 30 56.0 31 82.0 32 65.0 33 125.0 34 157.0 35 245.0 36 561.0 37 2420.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.925 22.05 12.75 24.275 2 29.725 24.625 30.45 15.2 3 20.95 29.25 32.175 17.625 4 24.425 34.4 23.075000000000003 18.099999999999998 5 24.65 35.6 23.150000000000002 16.6 6 20.925 38.074999999999996 24.275 16.725 7 20.05 19.75 41.075 19.125 8 21.5 24.45 29.4 24.65 9 22.5 25.224999999999998 28.625 23.65 10-14 23.64 29.42 26.834999999999997 20.105 15-19 23.895 27.565 28.310000000000002 20.23 20-24 23.59 28.015 28.095 20.3 25-29 23.150000000000002 28.389999999999997 28.58 19.88 30-34 22.564999999999998 28.449999999999996 28.62 20.365 35-39 23.9 27.575 28.465 20.06 40-44 23.674999999999997 27.675 27.800000000000004 20.849999999999998 45-49 22.85 28.09 28.555000000000003 20.505000000000003 50-54 23.48 27.639999999999997 29.085 19.794999999999998 55-59 23.235 28.255000000000003 28.125 20.385 60-64 24.14 28.255000000000003 27.705000000000002 19.900000000000002 65-69 23.315 27.415 28.689999999999998 20.580000000000002 70-74 23.3 27.815 28.935 19.950000000000003 75-79 23.41 27.48 28.415000000000003 20.695 80-84 23.69 27.63 28.37 20.31 85-89 23.775 28.225 27.785 20.215 90-94 23.815 27.744999999999997 28.83 19.61 95-99 23.3 27.515 28.725 20.46 100-104 24.095 27.215 28.965000000000003 19.725 105-109 24.29 27.485 28.525 19.7 110-114 23.595 28.015 28.205000000000002 20.185 115-119 23.895 27.605 28.425 20.075000000000003 120-124 24.535 27.800000000000004 28.185 19.48 125-129 23.9 28.265 27.96 19.875 130-134 23.935000000000002 28.305000000000003 27.685 20.075000000000003 135-139 24.505 27.37 27.935 20.19 140-144 24.86 27.605 27.705000000000002 19.830000000000002 145-149 25.025 27.644999999999996 28.08 19.25 150 25.374999999999996 26.974999999999998 28.175 19.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 1.0 10 1.5 11 1.0 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.5 21 2.0 22 1.5 23 2.0 24 1.5 25 1.0 26 3.0 27 5.0 28 6.5 29 10.0 30 15.0 31 21.5 32 28.5 33 33.5 34 45.5 35 60.0 36 74.0 37 106.0 38 140.0 39 181.5 40 219.0 41 240.5 42 263.0 43 278.0 44 286.0 45 286.0 46 296.0 47 286.5 48 233.0 49 176.0 50 148.0 51 132.0 52 110.5 53 88.0 54 61.0 55 41.0 56 30.0 57 20.5 58 14.0 59 13.0 60 10.5 61 5.5 62 2.0 63 3.0 64 2.5 65 1.5 66 2.0 67 1.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.2625 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.525 0.0 0.0 0.0 0.0 120-121 1.85 0.0 0.0 0.0 0.0 122-123 2.1125 0.0 0.0 0.0 0.0 124-125 2.4749999999999996 0.0 0.0 0.0 0.0 126-127 2.8125 0.0 0.0 0.0 0.0 128-129 3.1375 0.0 0.0 0.0 0.0 130-131 3.55 0.0 0.0 0.0 0.0 132-133 3.9625 0.0 0.0 0.0 0.0 134-135 4.3125 0.0 0.0 0.0 0.0 136-137 4.775 0.0 0.0 0.0 0.0 138 4.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTGGT 10 0.006973645 144.0 5 GTACTAT 10 0.006973645 144.0 1 TGGAGAT 10 0.006973645 144.0 1 ATTGAGC 10 0.006973645 144.0 6 >>END_MODULE Read 2774426 spots for SRR4237639.sra Written 2774426 spots for SRR4237639.sra Read 2774426 spots for SRR4237639.sra Written 2774426 spots for SRR4237639.sra Read 2774426 spots for SRR4237639.sra Written 2774426 spots for SRR4237639.sra Read 2774426 spots for SRR4237639.sra Written 2774426 spots for SRR4237639.sra Read 2774426 spots for SRR4237639.sra Written 2774426 spots for SRR4237639.sra Read 2774426 spots for SRR4237639.sra Written 2774426 spots for SRR4237639.sra Read 2774426 spots for SRR4237639.sra Written 2774426 spots for SRR4237639.sra Read 2774426 spots for SRR4237639.sra Written 2774426 spots for SRR4237639.sra Read 2774426 spots for SRR4237639.sra Written 2774426 spots for SRR4237639.sra Read 2774426 spots for SRR4237639.sra Written 2774426 spots for SRR4237639.sra Read 2774426 spots for SRR4237639.sra Written 2774426 spots for SRR4237639.sra Read 2774426 spots for SRR4237639.sra Written 2774426 spots for SRR4237639.sra Read 2774426 spots for SRR4237639.sra Written 2774426 spots for SRR4237639.sra Read 2774426 spots for SRR4237639.sra Written 2774426 spots for SRR4237639.sra Read 2774431 spots for SRR4237639.sra Written 2774431 spots for SRR4237639.sra Read 2774426 spots for SRR4237639.sra Written 2774426 spots for SRR4237639.sra Read 2774426 spots for SRR4237639.sra Written 2774426 spots for SRR4237639.sra Read 2774426 spots for SRR4237639.sra Written 2774426 spots for SRR4237639.sra Read 2774426 spots for SRR4237639.sra Written 2774426 spots for SRR4237639.sra Read 2774426 spots for SRR4237639.sra Written 2774426 spots for SRR4237639.sra SRR ids: ['SRR4237639.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vsxvqpn7 SRR4237639.sra spots: 55488525 blocks: [[1, 2774426], [2774427, 5548852], [5548853, 8323278], [8323279, 11097704], [11097705, 13872130], [13872131, 16646556], [16646557, 19420982], [19420983, 22195408], [22195409, 24969834], [24969835, 27744260], [27744261, 30518686], [30518687, 33293112], [33293113, 36067538], [36067539, 38841964], [38841965, 41616390], [41616391, 44390816], [44390817, 47165242], [47165243, 49939668], [49939669, 52714094], [52714095, 55488525]] SRR4237639 file size 18673164 SRR4237639 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237639 SRR4237639_1.fastq SRR4237639_2.fastq Input file: SRR4237639_1.fastq Paired file: SRR4237639_2.fastq trimmed: SRR4237639-trimmed-pair1.fastq, SRR4237639-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:40:28 2025 >> started Wed Feb 12 19:41:30 2025 >> done (61.118s) 55488525 read pairs processed; of these: 112454 ( 0.20%) short read pairs filtered out after trimming by size control 66566 ( 0.12%) empty read pairs filtered out after trimming by size control 55309505 (99.68%) read pairs available; of these: 19180311 (34.68%) trimmed read pairs available after processing 36129194 (65.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 8 0.00% 20 16 0.00% 21 7 0.00% 22 13 0.00% 23 5 0.00% 24 15 0.00% 25 19 0.00% 26 13 0.00% 27 26 0.00% 28 17 0.00% 29 18 0.00% 30 28 0.00% 31 29 0.00% 32 24 0.00% 33 24 0.00% 34 29 0.00% 35 30 0.00% 36 41 0.00% 37 35 0.00% 38 41 0.00% 39 48 0.00% 40 44 0.00% 41 60 0.00% 42 60 0.00% 43 64 0.00% 44 72 0.00% 45 71 0.00% 46 110 0.00% 47 123 0.00% 48 133 0.00% 49 115 0.00% 50 148 0.00% 51 191 0.00% 52 176 0.00% 53 231 0.00% 54 211 0.00% 55 243 0.00% 56 277 0.00% 57 304 0.00% 58 335 0.00% 59 357 0.00% 60 404 0.00% 61 473 0.00% 62 537 0.00% 63 561 0.00% 64 679 0.00% 65 727 0.00% 66 885 0.00% 67 1268 0.00% 68 2126 0.00% 69 6092 0.01% 70 3933 0.01% 71 1874 0.00% 72 1844 0.00% 73 1992 0.00% 74 2299 0.00% 75 2490 0.00% 76 2608 0.00% 77 2987 0.01% 78 3484 0.01% 79 3911 0.01% 80 4287 0.01% 81 4919 0.01% 82 5635 0.01% 83 7049 0.01% 84 15313 0.03% 85 15616 0.03% 86 16236 0.03% 87 17001 0.03% 88 17762 0.03% 89 18466 0.03% 90 19514 0.04% 91 20424 0.04% 92 21955 0.04% 93 23121 0.04% 94 24892 0.05% 95 26853 0.05% 96 28317 0.05% 97 30216 0.05% 98 31623 0.06% 99 33856 0.06% 100 35785 0.06% 101 37886 0.07% 102 40913 0.07% 103 43975 0.08% 104 46549 0.08% 105 49834 0.09% 106 52973 0.10% 107 55179 0.10% 108 58368 0.11% 109 60797 0.11% 110 63821 0.12% 111 66860 0.12% 112 71072 0.13% 113 73982 0.13% 114 77749 0.14% 115 82785 0.15% 116 85590 0.15% 117 90266 0.16% 118 93174 0.17% 119 95670 0.17% 120 99060 0.18% 121 102902 0.19% 122 106478 0.19% 123 111638 0.20% 124 116942 0.21% 125 121457 0.22% 126 127740 0.23% 127 131968 0.24% 128 137225 0.25% 129 143855 0.26% 130 148436 0.27% 131 153986 0.28% 132 160957 0.29% 133 169328 0.31% 134 175765 0.32% 135 185200 0.33% 136 196112 0.35% 137 205839 0.37% 138 220825 0.40% 139 234154 0.42% 140 251789 0.46% 141 273308 0.49% 142 299689 0.54% 143 334698 0.61% 144 385981 0.70% 145 464553 0.84% 146 596813 1.08% 147 855037 1.55% 148 1611883 2.91% 149 9345415 16.90% 150 36129194 65.32% 55309505 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=34 prefix-density=0.18 prefix-fanout=2.4 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=34 fanout-score=135.33 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=13.1 sequence=CAGCAGCAAGAAAACAAGTCAAATTATTCATCAAGGACCAATAAAACAGGCATCGAACTAAAGGGATATTATAAATCACTCAAGCTTGGGGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=19.99 fanout-score-rank=7 prefix-density=0.43 prefix-fanout=8.6 sequence=TGCTGAGATCATTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=7 fanout-score=59.79 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=14.7 sequence=TGTTGGTGGTGG SRR4237639 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:42:10 Started mapping on | Feb 12 19:42:10 Finished on | Feb 12 19:46:13 Mapping speed, Million of reads per hour | 819.40 Number of input reads | 55309505 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 53330228 Uniquely mapped reads % | 96.42% Average mapped length | 293.39 Number of splices: Total | 46039606 Number of splices: Annotated (sjdb) | 45176829 Number of splices: GT/AG | 45347342 Number of splices: GC/AG | 533154 Number of splices: AT/AC | 43238 Number of splices: Non-canonical | 115872 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1034105 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 90484 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.51% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1066451 1066451 1066451 N_multimapping 1034105 1034105 1034105 N_noFeature 1556472 52604396 1915680 N_ambiguous 606177 3174 237712 UnstrandedReadsAssigned:51167579 PositiveStrandReadsAssigned:722658 NegativeStrandReadsAssigned:51176836 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237639 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237639-trimmed-pair1.fastq SRR4237639-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 55,309,505 reads, 50,962,680 reads pseudoaligned [quant] estimated average fragment length: 242.571 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,286 rounds 52401 SRR4237639.ke.tsv 34699 SRR4237639.se.tsv 87100 total ==> SRR4237639.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.43 1155 12.6478 Potri.005G024800.1.v4.1 1035 793.429 78 1.91235 Potri.004G059700.1.v4.1 961 719.468 36 0.973358 Potri.007G009000.2.v4.1 1416 1174.43 0 0 Potri.003G141000.2.v4.1 2943 2701.43 874.205 6.29508 Potri.016G087400.1.v4.1 270 78.3796 5390 1337.73 Potri.015G069301.1.v4.1 564 326.843 0 0 Potri.010G195200.1.v4.1 1773 1531.43 160 2.03238 Potri.012G127500.1.v4.1 977 735.44 12285 324.944 ==> SRR4237639.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7603 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 818 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 28 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237639 completed mapping pipeline successfully