Starting /dee2/code/volunteer_pipeline.sh SRR4237640 current disk space = 3051079880704 free memory = 1467732804 SRR4237640 SRAfilesize 34b9318b9ac488992a5fed0bdf38b580 SRR4237640.sra SRR4237640.sra file validated SRR4237640 is paired end SRR4237640 is conventional basespace SRR4237640 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237640_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.82125 33.0 33.0 34.0 18.0 34.0 2 31.8495 33.0 32.0 34.0 27.0 34.0 3 32.415 33.0 33.0 34.0 28.0 34.0 4 32.751 34.0 33.0 34.0 32.0 34.0 5 32.8985 34.0 33.0 34.0 32.0 34.0 6 35.7785 38.0 37.0 38.0 31.0 38.0 7 36.8275 38.0 37.0 38.0 35.0 38.0 8 37.11625 38.0 38.0 38.0 36.0 38.0 9 37.20825 38.0 38.0 38.0 36.0 38.0 10-14 37.2008 38.0 38.0 38.0 36.2 38.0 15-19 37.180899999999994 38.0 38.0 38.0 36.2 38.0 20-24 36.8045 38.0 37.8 38.0 34.6 38.0 25-29 37.06660000000001 38.0 38.0 38.0 36.0 38.0 30-34 37.06400000000001 38.0 38.0 38.0 36.0 38.0 35-39 36.9875 38.0 38.0 38.0 35.8 38.0 40-44 37.034949999999995 38.0 38.0 38.0 35.8 38.0 45-49 36.9572 38.0 38.0 38.0 35.8 38.0 50-54 36.87215 38.0 38.0 38.0 35.6 38.0 55-59 36.82145 38.0 38.0 38.0 35.2 38.0 60-64 36.86845 38.0 38.0 38.0 36.0 38.0 65-69 36.786449999999995 38.0 38.0 38.0 35.0 38.0 70-74 36.81965 38.0 38.0 38.0 35.2 38.0 75-79 36.261 38.0 37.6 38.0 33.0 38.0 80-84 33.38960000000001 37.0 29.4 38.0 23.8 38.0 85-89 36.457300000000004 38.0 37.6 38.0 34.0 38.0 90-94 36.35305 38.0 37.8 38.0 33.4 38.0 95-99 36.49345 38.0 38.0 38.0 34.0 38.0 100-104 36.27055 38.0 38.0 38.0 33.6 38.0 105-109 36.1009 38.0 37.6 38.0 33.2 38.0 110-114 36.1019 38.0 37.6 38.0 33.2 38.0 115-119 35.8309 38.0 37.0 38.0 32.2 38.0 120-124 35.672450000000005 38.0 36.8 38.0 30.8 38.0 125-129 35.62105 38.0 36.8 38.0 31.2 38.0 130-134 35.3295 38.0 36.0 38.0 29.6 38.0 135-139 34.90955 38.0 35.4 38.0 27.0 38.0 140-144 32.95309999999999 37.4 31.4 38.0 21.2 38.0 145-149 34.41665 38.0 35.6 38.0 27.4 38.0 150 29.803 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 0.0 16 2.0 17 3.0 18 3.0 19 9.0 20 6.0 21 3.0 22 4.0 23 11.0 24 15.0 25 17.0 26 23.0 27 25.0 28 34.0 29 44.0 30 64.0 31 73.0 32 98.0 33 112.0 34 178.0 35 313.0 36 701.0 37 2256.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.51728907330567 12.309820193637622 8.686030428769017 36.48686030428769 2 22.575 15.7 33.925 27.800000000000004 3 20.1 19.625 25.55 34.725 4 21.85 29.75 22.2 26.200000000000003 5 21.775 33.900000000000006 24.525 19.8 6 17.7 35.925000000000004 24.875 21.5 7 13.600000000000001 26.125 42.15 18.125 8 15.925 24.575 33.85 25.650000000000002 9 16.7 25.35 33.2 24.75 10-14 20.075000000000003 30.64 26.445 22.84 15-19 19.375 29.794999999999998 27.389999999999997 23.44 20-24 19.53 29.255 27.634999999999998 23.580000000000002 25-29 19.41 29.24 27.76 23.59 30-34 19.145 28.935 27.97 23.95 35-39 19.78 29.555 26.884999999999998 23.78 40-44 19.57 30.014999999999997 27.0 23.415 45-49 20.07 29.48 27.16 23.29 50-54 20.19 28.965000000000003 27.250000000000004 23.595 55-59 19.915 30.195 26.479999999999997 23.41 60-64 19.765 29.509999999999998 27.255000000000003 23.47 65-69 19.744999999999997 29.29 27.54 23.425 70-74 19.62 29.93 26.935 23.515 75-79 20.175 29.585 26.66 23.580000000000002 80-84 19.695 28.945 27.765 23.595 85-89 19.735 29.21 27.61 23.445 90-94 19.830000000000002 29.044999999999998 26.979999999999997 24.145 95-99 20.044999999999998 28.994999999999997 27.345000000000002 23.615 100-104 20.59 29.189999999999998 26.784999999999997 23.435 105-109 20.13 28.875 27.22 23.775 110-114 20.695 28.965000000000003 26.939999999999998 23.400000000000002 115-119 20.965 28.485 26.8 23.75 120-124 20.585 29.265 26.435 23.715 125-129 20.64 28.71 26.755000000000003 23.895 130-134 21.055 28.62 26.915 23.41 135-139 21.029999999999998 28.935 26.424999999999997 23.61 140-144 20.549999999999997 28.384999999999998 26.57 24.495 145-149 20.64 28.345 26.33 24.685000000000002 150 20.724999999999998 27.500000000000004 27.0 24.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 1.0 21 1.0 22 0.0 23 0.5 24 2.5 25 3.0 26 3.5 27 7.0 28 8.5 29 16.0 30 21.0 31 27.0 32 38.5 33 46.0 34 59.5 35 84.0 36 109.5 37 126.5 38 142.5 39 156.5 40 188.5 41 223.5 42 240.0 43 256.5 44 284.0 45 305.5 46 288.5 47 258.0 48 218.5 49 178.0 50 147.5 51 125.0 52 108.5 53 82.0 54 63.0 55 53.5 56 43.0 57 30.5 58 16.5 59 8.0 60 4.5 61 3.0 62 4.0 63 4.0 64 2.0 65 1.0 66 2.0 67 1.0 68 0.0 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.725 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.2374999999999998 0.0 0.0 0.0 0.0 100-101 1.425 0.0 0.0 0.0 0.0 102-103 1.6375000000000002 0.0 0.0 0.0 0.0 104-105 1.9 0.0 0.0 0.0 0.0 106-107 2.1875 0.0 0.0 0.0 0.0 108-109 2.5125 0.0 0.0 0.0 0.0 110-111 3.0374999999999996 0.0 0.0 0.0 0.0 112-113 3.425 0.0 0.0 0.0 0.0 114-115 3.925 0.0 0.0 0.0 0.0 116-117 4.3625 0.0 0.0 0.0 0.0 118-119 4.925 0.0 0.0 0.0 0.0 120-121 5.4 0.0 0.0 0.0 0.0 122-123 5.737500000000001 0.0 0.0 0.0 0.0 124-125 6.1375 0.0 0.0 0.0 0.0 126-127 6.625 0.0 0.0 0.0 0.0 128-129 7.25 0.0 0.0 0.0 0.0 130-131 8.125 0.0 0.0 0.0 0.0 132-133 8.8125 0.0 0.0 0.0 0.0 134-135 9.3875 0.0 0.0 0.0 0.0 136-137 9.912500000000001 0.0 0.0 0.0 0.0 138 10.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATAAAT 10 0.0069863307 143.91249 8 GCCAGTC 10 0.0069863307 143.91249 2 TGATAAA 10 0.0069863307 143.91249 7 ATAAAAC 10 0.0069863307 143.91249 3 >>END_MODULE SRR4237640 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237640_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.03175 33.0 32.0 34.0 30.0 34.0 2 30.597 33.0 31.0 34.0 18.0 34.0 3 31.838 33.0 32.0 34.0 27.0 34.0 4 32.198 33.0 33.0 34.0 31.0 34.0 5 32.3255 33.0 33.0 34.0 31.0 34.0 6 36.0495 38.0 38.0 38.0 32.0 38.0 7 36.47575 38.0 38.0 38.0 34.0 38.0 8 36.5365 38.0 38.0 38.0 34.0 38.0 9 36.39425 38.0 38.0 38.0 34.0 38.0 10-14 36.43345 38.0 38.0 38.0 34.0 38.0 15-19 36.5447 38.0 38.0 38.0 34.6 38.0 20-24 35.6814 38.0 36.6 38.0 29.2 38.0 25-29 35.534800000000004 38.0 36.6 38.0 28.8 38.0 30-34 35.87325 38.0 37.2 38.0 31.2 38.0 35-39 36.2741 38.0 38.0 38.0 33.6 38.0 40-44 36.445550000000004 38.0 38.0 38.0 34.2 38.0 45-49 36.1878 38.0 38.0 38.0 33.6 38.0 50-54 36.3894 38.0 38.0 38.0 33.8 38.0 55-59 36.291000000000004 38.0 38.0 38.0 33.8 38.0 60-64 36.357600000000005 38.0 38.0 38.0 34.0 38.0 65-69 35.736149999999995 38.0 37.2 38.0 30.8 38.0 70-74 36.08005 38.0 37.8 38.0 32.8 38.0 75-79 34.088449999999995 37.8 33.4 38.0 22.6 38.0 80-84 35.13785 38.0 36.0 38.0 28.2 38.0 85-89 35.694 38.0 37.4 38.0 30.8 38.0 90-94 35.83595 38.0 37.4 38.0 32.2 38.0 95-99 35.67295 38.0 37.2 38.0 31.2 38.0 100-104 35.59425 38.0 37.0 38.0 30.2 38.0 105-109 35.24855 38.0 36.8 38.0 28.6 38.0 110-114 35.3575 38.0 37.0 38.0 29.6 38.0 115-119 35.286049999999996 38.0 37.0 38.0 29.0 38.0 120-124 35.0679 38.0 36.4 38.0 28.2 38.0 125-129 34.8346 38.0 36.0 38.0 27.2 38.0 130-134 34.48545 38.0 35.8 38.0 24.8 38.0 135-139 34.3399 38.0 35.0 38.0 23.8 38.0 140-144 33.55135 38.0 34.2 38.0 19.0 38.0 145-149 32.554 38.0 33.8 38.0 8.8 38.0 150 25.45025 33.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 3.0 4 2.0 5 1.0 6 3.0 7 2.0 8 2.0 9 0.0 10 5.0 11 2.0 12 0.0 13 2.0 14 3.0 15 5.0 16 2.0 17 3.0 18 8.0 19 9.0 20 7.0 21 17.0 22 10.0 23 34.0 24 17.0 25 21.0 26 32.0 27 44.0 28 55.0 29 67.0 30 68.0 31 84.0 32 113.0 33 144.0 34 217.0 35 288.0 36 593.0 37 2123.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.05 22.2 12.174999999999999 23.575 2 28.050000000000004 24.349999999999998 32.175 15.425 3 22.25 27.1 32.05 18.6 4 25.3 34.65 22.75 17.299999999999997 5 24.425 38.925 21.175 15.475 6 19.55 40.45 23.875 16.125 7 19.3 21.025 39.6 20.075000000000003 8 22.325 24.175 28.9 24.6 9 22.15 25.874999999999996 29.275000000000002 22.7 10-14 24.19 28.57 26.695 20.544999999999998 15-19 23.515 28.215 27.705000000000002 20.565 20-24 23.330000000000002 27.644999999999996 28.32 20.705000000000002 25-29 23.855 27.860000000000003 28.110000000000003 20.175 30-34 23.275000000000002 27.415 28.939999999999998 20.369999999999997 35-39 23.315 27.51 28.155 21.02 40-44 23.57 27.91 27.99 20.53 45-49 23.225 28.04 28.125 20.61 50-54 23.215 27.805000000000003 28.444999999999997 20.535 55-59 23.544999999999998 27.555000000000003 28.335 20.565 60-64 23.685000000000002 28.48 27.87 19.965 65-69 23.86 27.665 28.560000000000002 19.915 70-74 23.494999999999997 27.875 28.32 20.31 75-79 23.535 27.450000000000003 28.49 20.525 80-84 23.615 28.26 28.485 19.64 85-89 23.595 27.474999999999998 28.83 20.1 90-94 23.465 27.575 28.645 20.315 95-99 23.385 28.15 28.084999999999997 20.380000000000003 100-104 23.605 28.07 28.4 19.925 105-109 24.285 27.584999999999997 28.28 19.85 110-114 24.07 27.639999999999997 28.4 19.89 115-119 24.57 27.775 27.755000000000003 19.900000000000002 120-124 24.654999999999998 27.439999999999998 28.494999999999997 19.41 125-129 24.94 27.295 28.189999999999998 19.575 130-134 25.255 27.93 27.405 19.41 135-139 24.98 27.99 27.57 19.46 140-144 25.415 28.610000000000003 26.505000000000003 19.470000000000002 145-149 25.990000000000002 26.99 27.455000000000002 19.564999999999998 150 25.825 27.525 27.3 19.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.5 16 1.0 17 0.0 18 1.0 19 2.5 20 2.0 21 0.5 22 0.0 23 0.0 24 0.0 25 1.5 26 3.5 27 6.0 28 9.5 29 11.5 30 11.5 31 15.5 32 28.0 33 41.0 34 49.0 35 65.0 36 83.0 37 91.5 38 126.0 39 186.0 40 225.5 41 226.0 42 247.0 43 274.0 44 280.0 45 281.5 46 285.0 47 266.0 48 228.0 49 204.0 50 166.0 51 144.5 52 121.0 53 85.5 54 63.5 55 45.0 56 34.0 57 26.5 58 12.5 59 9.5 60 12.0 61 8.0 62 5.0 63 2.5 64 2.0 65 1.0 66 0.5 67 1.5 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.3624999999999998 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.775 0.0 0.0 0.0 0.0 106-107 2.0875000000000004 0.0 0.0 0.0 0.0 108-109 2.4125 0.0 0.0 0.0 0.0 110-111 2.9125 0.0 0.0 0.0 0.0 112-113 3.275 0.0 0.0 0.0 0.0 114-115 3.7750000000000004 0.0 0.0 0.0 0.0 116-117 4.225 0.0 0.0 0.0 0.0 118-119 4.7375 0.0 0.0 0.0 0.0 120-121 5.2 0.0 0.0 0.0 0.0 122-123 5.5375 0.0 0.0 0.0 0.0 124-125 5.925 0.0 0.0 0.0 0.0 126-127 6.4125 0.0 0.0 0.0 0.0 128-129 7.0875 0.0 0.0 0.0 0.0 130-131 8.0 0.0 0.0 0.0 0.0 132-133 8.6875 0.0 0.0 0.0 0.0 134-135 9.325 0.0 0.0 0.0 0.0 136-137 9.8875 0.0 0.0 0.0 0.0 138 10.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3532544 spots for SRR4237640.sra Written 3532544 spots for SRR4237640.sra Read 3532544 spots for SRR4237640.sra Written 3532544 spots for SRR4237640.sra Read 3532544 spots for SRR4237640.sra Written 3532544 spots for SRR4237640.sra Read 3532544 spots for SRR4237640.sra Written 3532544 spots for SRR4237640.sra Read 3532544 spots for SRR4237640.sra Written 3532544 spots for SRR4237640.sra Read 3532544 spots for SRR4237640.sra Written 3532544 spots for SRR4237640.sra Read 3532544 spots for SRR4237640.sra Written 3532544 spots for SRR4237640.sra Read 3532544 spots for SRR4237640.sra Written 3532544 spots for SRR4237640.sra Read 3532544 spots for SRR4237640.sra Written 3532544 spots for SRR4237640.sra Read 3532544 spots for SRR4237640.sra Written 3532544 spots for SRR4237640.sra Read 3532544 spots for SRR4237640.sra Written 3532544 spots for SRR4237640.sra Read 3532544 spots for SRR4237640.sra Written 3532544 spots for SRR4237640.sra Read 3532544 spots for SRR4237640.sra Written 3532544 spots for SRR4237640.sra Read 3532559 spots for SRR4237640.sra Written 3532559 spots for SRR4237640.sra Read 3532544 spots for SRR4237640.sra Written 3532544 spots for SRR4237640.sra Read 3532544 spots for SRR4237640.sra Written 3532544 spots for SRR4237640.sra Read 3532544 spots for SRR4237640.sra Written 3532544 spots for SRR4237640.sra Read 3532544 spots for SRR4237640.sra Written 3532544 spots for SRR4237640.sra Read 3532544 spots for SRR4237640.sra Written 3532544 spots for SRR4237640.sra Read 3532544 spots for SRR4237640.sra Written 3532544 spots for SRR4237640.sra SRR ids: ['SRR4237640.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8zmuqrdp SRR4237640.sra spots: 70650895 blocks: [[1, 3532544], [3532545, 7065088], [7065089, 10597632], [10597633, 14130176], [14130177, 17662720], [17662721, 21195264], [21195265, 24727808], [24727809, 28260352], [28260353, 31792896], [31792897, 35325440], [35325441, 38857984], [38857985, 42390528], [42390529, 45923072], [45923073, 49455616], [49455617, 52988160], [52988161, 56520704], [56520705, 60053248], [60053249, 63585792], [63585793, 67118336], [67118337, 70650895]] SRR4237640 file size 23781579 SRR4237640 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237640 SRR4237640_1.fastq SRR4237640_2.fastq Input file: SRR4237640_1.fastq Paired file: SRR4237640_2.fastq trimmed: SRR4237640-trimmed-pair1.fastq, SRR4237640-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 19:52:31 2025 >> started Wed Feb 12 19:53:58 2025 >> done (87.526s) 70650895 read pairs processed; of these: 76201 ( 0.11%) short read pairs filtered out after trimming by size control 67355 ( 0.10%) empty read pairs filtered out after trimming by size control 70507339 (99.80%) read pairs available; of these: 28554020 (40.50%) trimmed read pairs available after processing 41953319 (59.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 11 0.00% 20 8 0.00% 21 16 0.00% 22 20 0.00% 23 17 0.00% 24 18 0.00% 25 17 0.00% 26 23 0.00% 27 28 0.00% 28 21 0.00% 29 21 0.00% 30 37 0.00% 31 32 0.00% 32 52 0.00% 33 47 0.00% 34 66 0.00% 35 70 0.00% 36 83 0.00% 37 81 0.00% 38 101 0.00% 39 124 0.00% 40 172 0.00% 41 151 0.00% 42 203 0.00% 43 205 0.00% 44 214 0.00% 45 273 0.00% 46 275 0.00% 47 342 0.00% 48 404 0.00% 49 413 0.00% 50 486 0.00% 51 504 0.00% 52 605 0.00% 53 686 0.00% 54 748 0.00% 55 818 0.00% 56 987 0.00% 57 1061 0.00% 58 1193 0.00% 59 1359 0.00% 60 1647 0.00% 61 1931 0.00% 62 2036 0.00% 63 2283 0.00% 64 2639 0.00% 65 2918 0.00% 66 3374 0.00% 67 3844 0.01% 68 4520 0.01% 69 6765 0.01% 70 6608 0.01% 71 6236 0.01% 72 7033 0.01% 73 7908 0.01% 74 8946 0.01% 75 9913 0.01% 76 11006 0.02% 77 12119 0.02% 78 13587 0.02% 79 15043 0.02% 80 16708 0.02% 81 19043 0.03% 82 21471 0.03% 83 24537 0.03% 84 31630 0.04% 85 34890 0.05% 86 37281 0.05% 87 40297 0.06% 88 42801 0.06% 89 46127 0.07% 90 49886 0.07% 91 53671 0.08% 92 57916 0.08% 93 62249 0.09% 94 67924 0.10% 95 72933 0.10% 96 77626 0.11% 97 82252 0.12% 98 86625 0.12% 99 92477 0.13% 100 97455 0.14% 101 101774 0.14% 102 109429 0.16% 103 114834 0.16% 104 122060 0.17% 105 128895 0.18% 106 134960 0.19% 107 140140 0.20% 108 145342 0.21% 109 150750 0.21% 110 153519 0.22% 111 161090 0.23% 112 167809 0.24% 113 173672 0.25% 114 182319 0.26% 115 189592 0.27% 116 194067 0.28% 117 201860 0.29% 118 207921 0.29% 119 211034 0.30% 120 217521 0.31% 121 223490 0.32% 122 229248 0.33% 123 237231 0.34% 124 243566 0.35% 125 253033 0.36% 126 258494 0.37% 127 265558 0.38% 128 271819 0.39% 129 279318 0.40% 130 286796 0.41% 131 293852 0.42% 132 302749 0.43% 133 312600 0.44% 134 322356 0.46% 135 334730 0.47% 136 347986 0.49% 137 363086 0.51% 138 381269 0.54% 139 399055 0.57% 140 418967 0.59% 141 446751 0.63% 142 480441 0.68% 143 524375 0.74% 144 590336 0.84% 145 689890 0.98% 146 851261 1.21% 147 1178747 1.67% 148 2069926 2.94% 149 11230348 15.93% 150 41953319 59.50% 70507339 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=40 prefix-density=0.17 prefix-fanout=2.1 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=254.76 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=18.0 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=40 prefix-density=0.15 prefix-fanout=2.2 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=275.51 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=28.5 sequence=AAGAAGAAGAAA SRR4237640 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 19:54:49 Started mapping on | Feb 12 19:54:49 Finished on | Feb 12 20:03:27 Mapping speed, Million of reads per hour | 490.01 Number of input reads | 70507339 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 67491419 Uniquely mapped reads % | 95.72% Average mapped length | 289.44 Number of splices: Total | 59470704 Number of splices: Annotated (sjdb) | 58359842 Number of splices: GT/AG | 58558233 Number of splices: GC/AG | 708182 Number of splices: AT/AC | 56904 Number of splices: Non-canonical | 147385 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1245733 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 110003 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.32% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1847887 1847887 1847887 N_multimapping 1245733 1245733 1245733 N_noFeature 1969217 66588585 2447879 N_ambiguous 701331 4382 273672 UnstrandedReadsAssigned:64820871 PositiveStrandReadsAssigned:898452 NegativeStrandReadsAssigned:64769868 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=148 echo kmer=143 SRR4237640 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237640-trimmed-pair1.fastq SRR4237640-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 70,507,339 reads, 64,519,780 reads pseudoaligned [quant] estimated average fragment length: 216.42 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,351 rounds 52401 SRR4237640.ke.tsv 34699 SRR4237640.se.tsv 87100 total ==> SRR4237640.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1802.58 1467 12.9889 Potri.005G024800.1.v4.1 1035 819.58 142 2.76526 Potri.004G059700.1.v4.1 961 745.585 64 1.37 Potri.007G009000.2.v4.1 1416 1200.58 0 0 Potri.003G141000.2.v4.1 2943 2727.58 1048.33 6.13422 Potri.016G087400.1.v4.1 270 91.2921 9234.66 1614.45 Potri.015G069301.1.v4.1 564 350.894 0 0 Potri.010G195200.1.v4.1 1773 1557.58 200 2.04936 Potri.012G127500.1.v4.1 977 761.58 24589 515.304 ==> SRR4237640.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8250 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 1180 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 49 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR4237640 completed mapping pipeline successfully