Starting /dee2/code/volunteer_pipeline.sh SRR4237641 current disk space = 3050920857600 free memory = 1581879948 SRR4237641 SRAfilesize 0c900001df32473ca7ee43aa1a391f09 SRR4237641.sra SRR4237641.sra file validated SRR4237641 is paired end SRR4237641 is conventional basespace SRR4237641 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237641_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.90875 34.0 33.0 34.0 2.0 34.0 2 32.5595 34.0 33.0 34.0 28.0 34.0 3 32.791 34.0 33.0 34.0 30.0 34.0 4 33.0025 34.0 33.0 34.0 32.0 34.0 5 33.13225 34.0 33.0 34.0 32.0 34.0 6 36.79225 38.0 37.0 38.0 35.0 38.0 7 37.22275 38.0 38.0 38.0 36.0 38.0 8 37.31075 38.0 38.0 38.0 37.0 38.0 9 37.50975 38.0 38.0 38.0 37.0 38.0 10-14 37.3781 38.0 38.0 38.0 37.0 38.0 15-19 37.36985 38.0 38.0 38.0 37.0 38.0 20-24 36.59035 38.0 37.0 38.0 32.2 38.0 25-29 35.5473 38.0 36.2 38.0 28.2 38.0 30-34 36.97814999999999 38.0 38.0 38.0 35.8 38.0 35-39 37.14450000000001 38.0 38.0 38.0 36.6 38.0 40-44 37.1985 38.0 38.0 38.0 36.6 38.0 45-49 37.2008 38.0 38.0 38.0 36.4 38.0 50-54 37.21554999999999 38.0 38.0 38.0 36.8 38.0 55-59 37.16029999999999 38.0 38.0 38.0 36.4 38.0 60-64 37.093849999999996 38.0 38.0 38.0 36.0 38.0 65-69 37.00265 38.0 38.0 38.0 36.0 38.0 70-74 35.5413 37.8 35.4 38.0 29.8 38.0 75-79 36.28885 38.0 37.4 38.0 32.4 38.0 80-84 36.924249999999994 38.0 38.0 38.0 35.6 38.0 85-89 36.94975000000001 38.0 38.0 38.0 35.8 38.0 90-94 36.818850000000005 38.0 38.0 38.0 35.2 38.0 95-99 36.784749999999995 38.0 38.0 38.0 35.2 38.0 100-104 36.7091 38.0 38.0 38.0 35.0 38.0 105-109 36.66235 38.0 38.0 38.0 35.0 38.0 110-114 36.542350000000006 38.0 38.0 38.0 34.6 38.0 115-119 36.46249999999999 38.0 38.0 38.0 34.0 38.0 120-124 36.36945 38.0 38.0 38.0 34.0 38.0 125-129 35.336850000000005 38.0 36.2 38.0 28.2 38.0 130-134 34.7533 38.0 34.6 38.0 27.4 38.0 135-139 35.53705 38.0 36.6 38.0 30.8 38.0 140-144 35.1982 38.0 35.6 38.0 29.8 38.0 145-149 35.254549999999995 38.0 36.0 38.0 31.4 38.0 150 30.2855 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 1.0 13 0.0 14 0.0 15 1.0 16 0.0 17 3.0 18 1.0 19 3.0 20 7.0 21 4.0 22 4.0 23 9.0 24 7.0 25 10.0 26 15.0 27 22.0 28 25.0 29 34.0 30 47.0 31 48.0 32 78.0 33 115.0 34 160.0 35 257.0 36 681.0 37 2466.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.984717977215894 12.864684634620726 7.891080855793275 34.25951653237011 2 23.549999999999997 15.4 34.925 26.125 3 19.15 22.45 25.85 32.550000000000004 4 22.775000000000002 29.275000000000002 23.724999999999998 24.224999999999998 5 21.475 33.975 25.624999999999996 18.925 6 17.575 36.675000000000004 23.0 22.75 7 13.8 27.975 40.150000000000006 18.075 8 16.650000000000002 25.424999999999997 32.5 25.424999999999997 9 17.175 23.825 32.95 26.05 10-14 19.57 30.240000000000002 27.215 22.975 15-19 19.62 29.395 27.255000000000003 23.73 20-24 20.215 29.715000000000003 26.935 23.135 25-29 19.965 29.544999999999998 27.165 23.325000000000003 30-34 20.200000000000003 29.145 27.375 23.28 35-39 19.86 29.360000000000003 27.065 23.715 40-44 19.68 29.609999999999996 27.52 23.189999999999998 45-49 20.4 28.849999999999998 27.605 23.145 50-54 20.205000000000002 29.81 26.55 23.435 55-59 20.155 29.770000000000003 26.825 23.25 60-64 20.41 29.509999999999998 27.07 23.01 65-69 19.905 29.255 27.245 23.595 70-74 20.14 29.459999999999997 27.02 23.380000000000003 75-79 20.255000000000003 29.349999999999998 26.834999999999997 23.56 80-84 20.560000000000002 29.549999999999997 26.465 23.425 85-89 20.505000000000003 29.365000000000002 27.150000000000002 22.98 90-94 20.565 28.735 27.38 23.32 95-99 20.385 29.56 26.669999999999998 23.385 100-104 20.150000000000002 29.049999999999997 27.24 23.56 105-109 20.185 28.845 27.139999999999997 23.830000000000002 110-114 20.65 28.7 27.255000000000003 23.395 115-119 20.715 29.110000000000003 26.825 23.35 120-124 20.625 28.384999999999998 27.185 23.805 125-129 21.195 29.035 26.235000000000003 23.535 130-134 20.669999999999998 28.65 26.82 23.86 135-139 20.285 29.035 26.525 24.154999999999998 140-144 20.61 28.625 26.619999999999997 24.145 145-149 20.435 29.07 25.995 24.5 150 20.65 27.200000000000003 26.924999999999997 25.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.5 23 1.5 24 1.5 25 3.0 26 7.0 27 10.0 28 15.0 29 19.0 30 25.5 31 30.0 32 38.0 33 60.0 34 70.5 35 84.0 36 107.0 37 119.5 38 133.5 39 154.0 40 184.0 41 203.0 42 223.5 43 257.5 44 270.5 45 269.5 46 253.5 47 237.5 48 230.0 49 207.5 50 165.0 51 135.5 52 117.0 53 91.0 54 73.0 55 48.0 56 30.5 57 29.5 58 25.0 59 19.0 60 11.0 61 6.5 62 7.5 63 5.5 64 2.5 65 2.5 66 2.0 67 1.0 68 1.0 69 2.5 70 2.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.7375 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.5125 0.0 0.0 0.0 0.0 118-119 2.825 0.0 0.0 0.0 0.0 120-121 3.2 0.0 0.0 0.0 0.0 122-123 3.75 0.0 0.0 0.0 0.0 124-125 4.1875 0.0 0.0 0.0 0.0 126-127 4.575 0.0 0.0 0.0 0.0 128-129 4.95 0.0 0.0 0.0 0.0 130-131 5.375 0.0 0.0 0.0 0.0 132-133 5.987500000000001 0.0 0.0 0.0 0.0 134-135 6.574999999999999 0.0 0.0 0.0 0.0 136-137 7.2875 0.0 0.0 0.0 0.0 138 7.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237641 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237641_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5465 33.0 33.0 34.0 32.0 34.0 2 32.67725 33.0 33.0 34.0 32.0 34.0 3 32.66175 33.0 33.0 34.0 32.0 34.0 4 32.64725 33.0 33.0 34.0 32.0 34.0 5 32.50875 33.0 33.0 34.0 32.0 34.0 6 34.021 38.0 34.0 38.0 16.0 38.0 7 35.97925 38.0 37.0 38.0 31.0 38.0 8 36.17475 38.0 37.0 38.0 33.0 38.0 9 35.9925 38.0 37.0 38.0 31.0 38.0 10-14 36.65585 38.0 38.0 38.0 34.8 38.0 15-19 35.42975 38.0 35.6 38.0 29.0 38.0 20-24 36.465 38.0 38.0 38.0 34.4 38.0 25-29 36.600699999999996 38.0 38.0 38.0 35.0 38.0 30-34 36.55105 38.0 38.0 38.0 34.8 38.0 35-39 35.7578 38.0 37.0 38.0 29.8 38.0 40-44 36.60080000000001 38.0 38.0 38.0 35.0 38.0 45-49 36.4692 38.0 38.0 38.0 34.4 38.0 50-54 36.5743 38.0 38.0 38.0 35.0 38.0 55-59 36.62865000000001 38.0 38.0 38.0 35.2 38.0 60-64 36.525850000000005 38.0 38.0 38.0 34.6 38.0 65-69 36.45485 38.0 38.0 38.0 34.6 38.0 70-74 36.431650000000005 38.0 38.0 38.0 34.4 38.0 75-79 35.662349999999996 38.0 37.0 38.0 29.0 38.0 80-84 36.24255 38.0 38.0 38.0 34.0 38.0 85-89 36.25385 38.0 38.0 38.0 34.0 38.0 90-94 35.13015 37.8 35.4 38.0 30.0 38.0 95-99 35.5033 38.0 36.8 38.0 30.8 38.0 100-104 35.91805000000001 38.0 38.0 38.0 33.0 38.0 105-109 35.8293 38.0 38.0 38.0 32.6 38.0 110-114 35.8702 38.0 38.0 38.0 33.0 38.0 115-119 35.7189 38.0 37.6 38.0 31.8 38.0 120-124 35.47760000000001 38.0 37.4 38.0 30.6 38.0 125-129 35.24225 38.0 36.8 38.0 30.0 38.0 130-134 34.845699999999994 38.0 36.0 38.0 27.4 38.0 135-139 34.69115 38.0 35.8 38.0 27.0 38.0 140-144 34.27545 38.0 35.4 38.0 24.2 38.0 145-149 33.5474 38.0 34.6 38.0 18.0 38.0 150 26.75825 33.0 21.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 7.0 4 2.0 5 2.0 6 1.0 7 2.0 8 2.0 9 4.0 10 2.0 11 5.0 12 1.0 13 3.0 14 6.0 15 1.0 16 4.0 17 4.0 18 2.0 19 8.0 20 6.0 21 6.0 22 11.0 23 12.0 24 19.0 25 22.0 26 22.0 27 35.0 28 40.0 29 50.0 30 52.0 31 76.0 32 101.0 33 105.0 34 169.0 35 264.0 36 548.0 37 2394.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.5 21.275 12.1 23.125 2 28.875 24.75 31.275 15.1 3 21.975 26.875 32.324999999999996 18.825 4 25.6 35.15 22.375 16.875 5 25.624999999999996 36.3 22.1 15.975 6 20.3 38.625 23.875 17.2 7 20.349999999999998 21.125 41.175 17.349999999999998 8 22.975 24.175 28.025 24.825 9 21.8 25.724999999999998 29.849999999999998 22.625 10-14 23.915 29.25 26.39 20.445 15-19 23.035 28.315 28.410000000000004 20.24 20-24 23.73 27.889999999999997 27.915 20.465 25-29 23.13 28.499999999999996 28.199999999999996 20.169999999999998 30-34 23.630000000000003 27.58 28.625 20.165 35-39 23.49 27.42 28.42 20.669999999999998 40-44 23.54 27.779999999999998 28.32 20.36 45-49 23.49 27.195000000000004 28.23 21.085 50-54 23.415 27.715 27.85 21.02 55-59 23.7 27.935 28.1 20.265 60-64 23.605 27.445000000000004 28.625 20.325 65-69 23.775 27.155 27.85 21.22 70-74 23.48 27.465 28.175 20.880000000000003 75-79 22.939999999999998 27.99 28.585 20.485 80-84 23.345 27.63 28.34 20.685000000000002 85-89 23.655 27.92 27.775 20.65 90-94 23.405 27.21 28.975 20.41 95-99 23.31 27.189999999999998 28.935 20.565 100-104 24.005000000000003 26.955000000000002 28.48 20.560000000000002 105-109 23.65 27.875 28.065 20.41 110-114 23.93 27.345000000000002 28.310000000000002 20.415 115-119 23.985 27.625 28.110000000000003 20.28 120-124 24.21 27.389999999999997 28.175 20.225 125-129 24.474999999999998 27.395000000000003 28.065 20.064999999999998 130-134 24.990000000000002 28.07 27.485 19.455 135-139 24.945 27.725 27.445000000000004 19.885 140-144 25.165 27.534999999999997 27.62 19.68 145-149 25.330000000000002 27.345000000000002 27.82 19.505 150 26.325 26.200000000000003 27.775 19.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 1.5 22 0.5 23 1.0 24 2.0 25 3.0 26 3.5 27 4.5 28 6.5 29 12.0 30 17.5 31 21.0 32 28.5 33 32.0 34 43.0 35 63.5 36 85.0 37 109.5 38 137.5 39 161.5 40 179.5 41 223.0 42 267.0 43 280.0 44 279.5 45 280.0 46 285.0 47 250.5 48 210.5 49 203.0 50 183.0 51 153.5 52 120.0 53 90.5 54 69.0 55 56.0 56 40.5 57 24.0 58 17.0 59 8.5 60 7.0 61 9.5 62 8.0 63 4.5 64 2.0 65 1.5 66 3.0 67 3.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0125 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.05 0.025 0.0 0.0 0.0 74-75 0.05 0.025 0.0 0.0 0.0 76-77 0.05 0.025 0.0 0.0 0.0 78-79 0.1 0.025 0.0 0.0 0.0 80-81 0.125 0.025 0.0 0.0 0.0 82-83 0.1375 0.025 0.0 0.0 0.0 84-85 0.175 0.025 0.0 0.0 0.0 86-87 0.21250000000000002 0.025 0.0 0.0 0.0 88-89 0.25 0.025 0.0 0.0 0.0 90-91 0.30000000000000004 0.025 0.0 0.0 0.0 92-93 0.36250000000000004 0.025 0.0 0.0 0.0 94-95 0.4375 0.025 0.0 0.0 0.0 96-97 0.5 0.025 0.0 0.0 0.0 98-99 0.7 0.025 0.0 0.0 0.0 100-101 0.8625 0.025 0.0 0.0 0.0 102-103 1.0 0.025 0.0 0.0 0.0 104-105 1.1375000000000002 0.025 0.0 0.0 0.0 106-107 1.2375 0.025 0.0 0.0 0.0 108-109 1.3875000000000002 0.025 0.0 0.0 0.0 110-111 1.6125 0.025 0.0 0.0 0.0 112-113 1.725 0.025 0.0 0.0 0.0 114-115 2.1125 0.025 0.0 0.0 0.0 116-117 2.45 0.025 0.0 0.0 0.0 118-119 2.7875 0.025 0.0 0.0 0.0 120-121 3.2125000000000004 0.025 0.0 0.0 0.0 122-123 3.7625 0.025 0.0 0.0 0.0 124-125 4.225 0.025 0.0 0.0 0.0 126-127 4.637499999999999 0.025 0.0 0.0 0.0 128-129 4.975 0.025 0.0 0.0 0.0 130-131 5.4 0.025 0.0 0.0 0.0 132-133 5.9625 0.025 0.0 0.0 0.0 134-135 6.550000000000001 0.025 0.0 0.0 0.0 136-137 7.275 0.025 0.0 0.0 0.0 138 7.725 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2921239 spots for SRR4237641.sra Written 2921239 spots for SRR4237641.sra Read 2921239 spots for SRR4237641.sra Written 2921239 spots for SRR4237641.sra Read 2921239 spots for SRR4237641.sra Written 2921239 spots for SRR4237641.sra Read 2921239 spots for SRR4237641.sra Written 2921239 spots for SRR4237641.sra Read 2921239 spots for SRR4237641.sra Written 2921239 spots for SRR4237641.sra Read 2921239 spots for SRR4237641.sra Written 2921239 spots for SRR4237641.sra Read 2921239 spots for SRR4237641.sra Written 2921239 spots for SRR4237641.sra Read 2921239 spots for SRR4237641.sra Written 2921239 spots for SRR4237641.sra Read 2921239 spots for SRR4237641.sra Written 2921239 spots for SRR4237641.sra Read 2921239 spots for SRR4237641.sra Written 2921239 spots for SRR4237641.sra Read 2921239 spots for SRR4237641.sra Written 2921239 spots for SRR4237641.sra Read 2921239 spots for SRR4237641.sra Written 2921239 spots for SRR4237641.sra Read 2921246 spots for SRR4237641.sra Written 2921246 spots for SRR4237641.sra Read 2921239 spots for SRR4237641.sra Written 2921239 spots for SRR4237641.sra Read 2921239 spots for SRR4237641.sra Written 2921239 spots for SRR4237641.sra Read 2921239 spots for SRR4237641.sra Written 2921239 spots for SRR4237641.sra Read 2921239 spots for SRR4237641.sra Written 2921239 spots for SRR4237641.sra Read 2921239 spots for SRR4237641.sra Written 2921239 spots for SRR4237641.sra Read 2921239 spots for SRR4237641.sra Written 2921239 spots for SRR4237641.sra Read 2921239 spots for SRR4237641.sra Written 2921239 spots for SRR4237641.sra SRR ids: ['SRR4237641.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ukodiiya SRR4237641.sra spots: 58424787 blocks: [[1, 2921239], [2921240, 5842478], [5842479, 8763717], [8763718, 11684956], [11684957, 14606195], [14606196, 17527434], [17527435, 20448673], [20448674, 23369912], [23369913, 26291151], [26291152, 29212390], [29212391, 32133629], [32133630, 35054868], [35054869, 37976107], [37976108, 40897346], [40897347, 43818585], [43818586, 46739824], [46739825, 49661063], [49661064, 52582302], [52582303, 55503541], [55503542, 58424787]] SRR4237641 file size 19662431 SRR4237641 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237641 SRR4237641_1.fastq SRR4237641_2.fastq Input file: SRR4237641_1.fastq Paired file: SRR4237641_2.fastq trimmed: SRR4237641-trimmed-pair1.fastq, SRR4237641-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:00:01 2025 >> started Wed Feb 12 20:01:11 2025 >> done (69.264s) 58424787 read pairs processed; of these: 72287 ( 0.12%) short read pairs filtered out after trimming by size control 44103 ( 0.08%) empty read pairs filtered out after trimming by size control 58308397 (99.80%) read pairs available; of these: 21141813 (36.26%) trimmed read pairs available after processing 37166584 (63.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 11 0.00% 20 12 0.00% 21 14 0.00% 22 9 0.00% 23 9 0.00% 24 19 0.00% 25 14 0.00% 26 15 0.00% 27 15 0.00% 28 22 0.00% 29 18 0.00% 30 36 0.00% 31 31 0.00% 32 38 0.00% 33 34 0.00% 34 34 0.00% 35 43 0.00% 36 48 0.00% 37 49 0.00% 38 43 0.00% 39 38 0.00% 40 68 0.00% 41 83 0.00% 42 84 0.00% 43 76 0.00% 44 84 0.00% 45 94 0.00% 46 118 0.00% 47 138 0.00% 48 183 0.00% 49 163 0.00% 50 198 0.00% 51 248 0.00% 52 200 0.00% 53 257 0.00% 54 242 0.00% 55 342 0.00% 56 371 0.00% 57 413 0.00% 58 469 0.00% 59 563 0.00% 60 612 0.00% 61 705 0.00% 62 803 0.00% 63 838 0.00% 64 972 0.00% 65 1093 0.00% 66 1198 0.00% 67 1440 0.00% 68 1821 0.00% 69 3414 0.01% 70 3598 0.01% 71 2798 0.00% 72 2792 0.00% 73 3185 0.01% 74 3515 0.01% 75 4051 0.01% 76 4619 0.01% 77 4918 0.01% 78 5597 0.01% 79 6248 0.01% 80 7024 0.01% 81 8112 0.01% 82 9473 0.02% 83 10934 0.02% 84 16887 0.03% 85 18191 0.03% 86 19426 0.03% 87 21131 0.04% 88 22557 0.04% 89 24165 0.04% 90 26187 0.04% 91 28393 0.05% 92 30570 0.05% 93 33617 0.06% 94 36579 0.06% 95 39555 0.07% 96 42340 0.07% 97 44979 0.08% 98 47369 0.08% 99 50676 0.09% 100 54099 0.09% 101 57187 0.10% 102 62056 0.11% 103 66578 0.11% 104 70798 0.12% 105 75890 0.13% 106 80139 0.14% 107 83963 0.14% 108 87195 0.15% 109 91421 0.16% 110 94568 0.16% 111 99953 0.17% 112 105157 0.18% 113 110843 0.19% 114 117724 0.20% 115 122311 0.21% 116 127890 0.22% 117 134044 0.23% 118 137011 0.23% 119 140100 0.24% 120 145182 0.25% 121 150122 0.26% 122 155585 0.27% 123 161107 0.28% 124 167638 0.29% 125 173929 0.30% 126 182220 0.31% 127 187856 0.32% 128 194586 0.33% 129 200927 0.34% 130 206410 0.35% 131 211742 0.36% 132 219714 0.38% 133 228289 0.39% 134 235244 0.40% 135 245727 0.42% 136 257296 0.44% 137 266485 0.46% 138 283439 0.49% 139 296311 0.51% 140 312037 0.54% 141 332515 0.57% 142 356291 0.61% 143 388158 0.67% 144 436164 0.75% 145 506095 0.87% 146 626235 1.07% 147 856990 1.47% 148 1547606 2.65% 149 9093654 15.60% 150 37166584 63.74% 58308397 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=38 prefix-density=0.17 prefix-fanout=2.3 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=377.27 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=21.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=40 prefix-density=0.17 prefix-fanout=2.3 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=29 fanout-score=46.80 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=10.9 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCGCACAATCCAGTT SRR4237641 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:01:54 Started mapping on | Feb 12 20:01:54 Finished on | Feb 12 20:07:49 Mapping speed, Million of reads per hour | 591.30 Number of input reads | 58308397 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 55434213 Uniquely mapped reads % | 95.07% Average mapped length | 291.62 Number of splices: Total | 46639979 Number of splices: Annotated (sjdb) | 45793982 Number of splices: GT/AG | 45944279 Number of splices: GC/AG | 534116 Number of splices: AT/AC | 42398 Number of splices: Non-canonical | 119186 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1056937 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 78954 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.95% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1897359 1897359 1897359 N_multimapping 1056937 1056937 1056937 N_noFeature 1636730 54562051 2124580 N_ambiguous 620446 3945 233409 UnstrandedReadsAssigned:53177037 PositiveStrandReadsAssigned:868217 NegativeStrandReadsAssigned:53076224 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237641 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237641-trimmed-pair1.fastq SRR4237641-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 58,308,397 reads, 52,910,973 reads pseudoaligned [quant] estimated average fragment length: 223.633 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR4237641.ke.tsv 34699 SRR4237641.se.tsv 87100 total ==> SRR4237641.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.37 941.854 10.0677 Potri.005G024800.1.v4.1 1035 812.367 128 3.02383 Potri.004G059700.1.v4.1 961 738.394 9 0.233912 Potri.007G009000.2.v4.1 1416 1193.37 0 0 Potri.003G141000.2.v4.1 2943 2720.37 996.263 7.02822 Potri.016G087400.1.v4.1 270 86.6248 6653.89 1474.12 Potri.015G069301.1.v4.1 564 344.403 0 0 Potri.010G195200.1.v4.1 1773 1550.37 189.85 2.35004 Potri.012G127500.1.v4.1 977 754.381 10881 276.807 ==> SRR4237641.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9192 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 935 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 57 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237641 completed mapping pipeline successfully