Starting /dee2/code/volunteer_pipeline.sh SRR4237642 current disk space = 3050965966848 free memory = 1578088704 SRR4237642 SRAfilesize 747a1b7d8484a43dabaa22eae9777e20 SRR4237642.sra SRR4237642.sra file validated SRR4237642 is paired end SRR4237642 is conventional basespace SRR4237642 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237642_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.85275 33.0 33.0 34.0 27.0 34.0 2 31.67825 33.0 32.0 34.0 27.0 34.0 3 32.47175 33.0 33.0 34.0 28.0 34.0 4 32.828 34.0 33.0 34.0 32.0 34.0 5 32.8965 34.0 33.0 34.0 32.0 34.0 6 36.08525 38.0 37.0 38.0 33.0 38.0 7 36.8555 38.0 38.0 38.0 35.0 38.0 8 37.0715 38.0 38.0 38.0 36.0 38.0 9 37.126 38.0 38.0 38.0 36.0 38.0 10-14 37.171749999999996 38.0 38.0 38.0 36.2 38.0 15-19 37.16705 38.0 38.0 38.0 36.2 38.0 20-24 36.889700000000005 38.0 38.0 38.0 35.6 38.0 25-29 36.9093 38.0 38.0 38.0 35.6 38.0 30-34 37.011399999999995 38.0 38.0 38.0 36.0 38.0 35-39 36.788 38.0 38.0 38.0 35.0 38.0 40-44 36.9165 38.0 38.0 38.0 35.6 38.0 45-49 36.896950000000004 38.0 38.0 38.0 35.6 38.0 50-54 36.76255 38.0 38.0 38.0 34.8 38.0 55-59 36.765100000000004 38.0 38.0 38.0 35.0 38.0 60-64 36.89805 38.0 38.0 38.0 35.8 38.0 65-69 36.76 38.0 38.0 38.0 35.0 38.0 70-74 36.79774999999999 38.0 38.0 38.0 35.0 38.0 75-79 36.2063 38.0 37.4 38.0 32.4 38.0 80-84 33.731049999999996 37.2 32.0 38.0 24.2 38.0 85-89 36.35790000000001 38.0 37.6 38.0 33.4 38.0 90-94 36.163399999999996 38.0 37.6 38.0 32.8 38.0 95-99 36.39035 38.0 37.8 38.0 33.8 38.0 100-104 36.273700000000005 38.0 37.8 38.0 33.8 38.0 105-109 36.0375 38.0 37.4 38.0 33.0 38.0 110-114 36.02865 38.0 37.4 38.0 33.0 38.0 115-119 35.8442 38.0 37.0 38.0 31.8 38.0 120-124 35.54985 38.0 36.6 38.0 30.6 38.0 125-129 35.2333 38.0 36.0 38.0 29.4 38.0 130-134 35.1006 38.0 35.8 38.0 27.6 38.0 135-139 35.0237 38.0 35.6 38.0 27.2 38.0 140-144 33.427200000000006 38.0 33.6 38.0 20.4 38.0 145-149 34.47099999999999 38.0 35.4 38.0 28.0 38.0 150 29.627 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 0.0 14 0.0 15 1.0 16 4.0 17 2.0 18 2.0 19 8.0 20 4.0 21 5.0 22 7.0 23 10.0 24 13.0 25 18.0 26 18.0 27 29.0 28 40.0 29 41.0 30 52.0 31 82.0 32 96.0 33 128.0 34 210.0 35 315.0 36 709.0 37 2201.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.686734150239744 13.771976558337773 8.497602557272243 34.04368673415024 2 23.75 15.45 33.35 27.450000000000003 3 19.15 20.875 26.974999999999998 33.0 4 22.650000000000002 30.475 23.125 23.75 5 22.35 33.5 23.75 20.4 6 17.825 38.224999999999994 24.05 19.900000000000002 7 13.975000000000001 26.974999999999998 42.25 16.8 8 15.950000000000001 27.150000000000002 31.0 25.900000000000002 9 17.65 25.374999999999996 33.6 23.375 10-14 19.37 32.025 26.19 22.415 15-19 19.095000000000002 30.259999999999998 27.435 23.21 20-24 18.98 29.965000000000003 27.51 23.544999999999998 25-29 19.335 30.59 27.275 22.8 30-34 19.580000000000002 30.685000000000002 27.025 22.71 35-39 19.295 30.12 27.224999999999998 23.36 40-44 19.445 29.830000000000002 27.58 23.145 45-49 19.695 30.080000000000002 26.669999999999998 23.555 50-54 19.705000000000002 30.349999999999998 26.21 23.735 55-59 19.384999999999998 29.82 26.845000000000002 23.95 60-64 19.23 30.04 27.58 23.150000000000002 65-69 19.384999999999998 30.175 27.189999999999998 23.25 70-74 19.67 29.845 27.525 22.96 75-79 19.384999999999998 29.835 26.805 23.974999999999998 80-84 19.925 29.385 27.205000000000002 23.485 85-89 19.79 29.985 27.275 22.95 90-94 20.064999999999998 29.42 27.200000000000003 23.315 95-99 20.035 28.835 27.68 23.45 100-104 20.09 28.775000000000002 27.655 23.48 105-109 19.99 29.165000000000003 27.305 23.54 110-114 19.67 29.215000000000003 27.245 23.87 115-119 19.830000000000002 29.53 26.845000000000002 23.794999999999998 120-124 20.375 29.110000000000003 27.12 23.395 125-129 20.32 28.749999999999996 26.740000000000002 24.19 130-134 20.76 28.470000000000002 27.255000000000003 23.515 135-139 20.7 28.925 26.525 23.849999999999998 140-144 20.849999999999998 28.82 26.505000000000003 23.825 145-149 20.65 28.62 26.284999999999997 24.445 150 21.025 27.025 27.575 24.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 1.5 23 4.0 24 5.5 25 6.0 26 6.5 27 12.0 28 16.5 29 16.0 30 27.0 31 39.0 32 46.5 33 57.0 34 73.0 35 101.5 36 122.5 37 147.0 38 154.0 39 163.5 40 208.0 41 236.0 42 239.5 43 243.0 44 244.0 45 254.0 46 257.0 47 227.0 48 208.5 49 192.5 50 152.5 51 122.5 52 104.0 53 78.0 54 64.5 55 48.0 56 31.0 57 23.0 58 15.5 59 11.0 60 6.0 61 6.0 62 5.0 63 4.5 64 6.0 65 4.5 66 1.5 67 0.5 68 0.5 69 1.0 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.27603513174404015 0.5499999999999999 3 0.05018820577164366 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 1.075 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.3875000000000002 0.0 0.0 0.0 0.0 110-111 1.4874999999999998 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 2.0 0.0 0.0 0.0 0.0 116-117 2.25 0.0 0.0 0.0 0.0 118-119 2.5999999999999996 0.0 0.0 0.0 0.0 120-121 3.025 0.0 0.0 0.0 0.0 122-123 3.4749999999999996 0.0 0.0 0.0 0.0 124-125 3.875 0.0 0.0 0.0 0.0 126-127 4.2375 0.0 0.0 0.0 0.0 128-129 4.6625 0.0 0.0 0.0 0.0 130-131 5.0875 0.0 0.0 0.0 0.0 132-133 5.625 0.0 0.0 0.0 0.0 134-135 5.9375 0.0 0.0 0.0 0.0 136-137 6.449999999999999 0.0 0.0 0.0 0.0 138 6.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCCTC 10 0.0069772652 143.975 5 TTGGCCC 10 0.0069772652 143.975 8 >>END_MODULE SRR4237642 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237642_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0695 33.0 33.0 34.0 30.0 34.0 2 31.099 33.0 32.0 34.0 18.0 34.0 3 31.9165 33.0 32.0 34.0 28.0 34.0 4 32.15475 33.0 33.0 34.0 31.0 34.0 5 32.22625 33.0 33.0 34.0 31.0 34.0 6 36.1815 38.0 38.0 38.0 33.0 38.0 7 36.31175 38.0 38.0 38.0 34.0 38.0 8 36.46725 38.0 38.0 38.0 34.0 38.0 9 36.30425 38.0 38.0 38.0 34.0 38.0 10-14 36.30555 38.0 38.0 38.0 33.6 38.0 15-19 36.355650000000004 38.0 38.0 38.0 34.0 38.0 20-24 35.79174999999999 38.0 37.4 38.0 29.4 38.0 25-29 35.2433 38.0 35.8 38.0 29.0 38.0 30-34 35.74550000000001 38.0 37.0 38.0 31.2 38.0 35-39 36.20784999999999 38.0 38.0 38.0 33.8 38.0 40-44 36.275 38.0 38.0 38.0 34.0 38.0 45-49 36.10235 38.0 38.0 38.0 33.2 38.0 50-54 36.262100000000004 38.0 38.0 38.0 33.8 38.0 55-59 36.2159 38.0 38.0 38.0 33.6 38.0 60-64 36.2812 38.0 38.0 38.0 34.0 38.0 65-69 35.2256 38.0 36.4 38.0 27.8 38.0 70-74 35.946749999999994 38.0 37.6 38.0 32.6 38.0 75-79 34.1777 38.0 34.4 38.0 22.4 38.0 80-84 34.93635 38.0 35.8 38.0 27.2 38.0 85-89 35.59009999999999 38.0 37.0 38.0 29.8 38.0 90-94 35.6717 38.0 37.2 38.0 31.0 38.0 95-99 35.577 38.0 37.0 38.0 30.2 38.0 100-104 35.39235000000001 38.0 37.0 38.0 29.4 38.0 105-109 35.137049999999995 38.0 36.8 38.0 28.2 38.0 110-114 35.286500000000004 38.0 37.0 38.0 29.4 38.0 115-119 35.27825 38.0 37.0 38.0 29.4 38.0 120-124 34.990300000000005 38.0 36.4 38.0 28.2 38.0 125-129 34.810449999999996 38.0 36.0 38.0 26.8 38.0 130-134 34.525549999999996 38.0 35.8 38.0 25.0 38.0 135-139 34.278650000000006 38.0 35.6 38.0 23.8 38.0 140-144 33.59905 38.0 34.2 38.0 20.2 38.0 145-149 32.8556 38.0 33.8 38.0 11.2 38.0 150 25.87975 33.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 11.0 4 6.0 5 1.0 6 4.0 7 1.0 8 4.0 9 0.0 10 2.0 11 0.0 12 3.0 13 2.0 14 2.0 15 7.0 16 6.0 17 8.0 18 8.0 19 8.0 20 16.0 21 8.0 22 17.0 23 20.0 24 12.0 25 39.0 26 35.0 27 39.0 28 49.0 29 54.0 30 79.0 31 80.0 32 105.0 33 141.0 34 189.0 35 291.0 36 647.0 37 2095.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.65 22.175 11.675 23.5 2 29.099999999999998 24.8 30.099999999999998 16.0 3 21.5 28.95 31.924999999999997 17.625 4 24.3 35.75 22.85 17.1 5 25.924999999999997 36.225 22.15 15.7 6 21.45 39.050000000000004 21.55 17.95 7 20.724999999999998 21.975 40.35 16.950000000000003 8 21.25 25.3 28.825 24.625 9 22.85 25.85 29.025000000000002 22.275 10-14 23.87 29.235 26.479999999999997 20.415 15-19 24.07 27.560000000000002 28.199999999999996 20.169999999999998 20-24 23.61 27.889999999999997 28.08 20.419999999999998 25-29 24.025 27.889999999999997 27.994999999999997 20.09 30-34 23.32 28.194999999999997 27.750000000000004 20.735 35-39 23.66 27.595 27.985 20.76 40-44 23.455000000000002 27.6 28.549999999999997 20.395 45-49 22.96 27.725 29.18 20.135 50-54 23.665 27.689999999999998 28.17 20.474999999999998 55-59 23.380000000000003 27.815 28.215 20.59 60-64 23.369999999999997 28.38 28.294999999999998 19.955000000000002 65-69 23.275000000000002 27.685 28.93 20.11 70-74 23.66 27.425 28.249999999999996 20.665 75-79 22.985 27.505000000000003 29.32 20.19 80-84 23.52 27.465 28.470000000000002 20.544999999999998 85-89 23.755000000000003 27.265 28.62 20.36 90-94 22.919999999999998 27.529999999999998 29.075 20.474999999999998 95-99 23.015 27.51 29.065 20.41 100-104 23.645 27.57 28.57 20.215 105-109 23.32 28.27 28.405 20.005 110-114 23.715 27.48 28.4 20.405 115-119 23.56 27.584999999999997 29.044999999999998 19.81 120-124 23.919999999999998 27.98 28.384999999999998 19.715 125-129 24.29 27.925 28.360000000000003 19.425 130-134 24.36 27.92 28.189999999999998 19.53 135-139 24.69 27.465 28.415000000000003 19.43 140-144 24.65 28.205000000000002 27.584999999999997 19.56 145-149 25.835 28.144999999999996 27.32 18.7 150 26.375 26.125 28.125 19.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 0.5 18 0.0 19 2.5 20 3.0 21 0.5 22 2.0 23 3.5 24 2.5 25 3.0 26 4.5 27 4.5 28 7.0 29 11.5 30 18.0 31 24.0 32 26.0 33 31.0 34 46.0 35 67.0 36 91.0 37 110.5 38 131.0 39 180.0 40 216.0 41 228.0 42 249.5 43 273.0 44 266.5 45 274.5 46 274.0 47 255.5 48 238.0 49 210.5 50 173.0 51 131.0 52 103.0 53 83.5 54 66.0 55 46.5 56 38.5 57 28.0 58 21.0 59 14.0 60 9.0 61 4.0 62 4.0 63 6.5 64 4.0 65 1.5 66 2.0 67 1.5 68 1.0 69 1.0 70 1.5 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.5249999999999999 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.5125000000000002 0.0 0.0 0.0 0.0 112-113 1.7374999999999998 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.2750000000000004 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 3.0375 0.0 0.0 0.0 0.0 122-123 3.45 0.0 0.0 0.0 0.0 124-125 3.8125 0.0 0.0 0.0 0.0 126-127 4.2125 0.0 0.0 0.0 0.0 128-129 4.699999999999999 0.0 0.0 0.0 0.0 130-131 5.199999999999999 0.0 0.0 0.0 0.0 132-133 5.7375 0.0 0.0 0.0 0.0 134-135 6.1625 0.0 0.0 0.0 0.0 136-137 6.699999999999999 0.0 0.0 0.0 0.0 138 7.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCTAT 10 0.006973645 144.0 6 >>END_MODULE Read 2267257 spots for SRR4237642.sra Written 2267257 spots for SRR4237642.sra Read 2267257 spots for SRR4237642.sra Written 2267257 spots for SRR4237642.sra Read 2267257 spots for SRR4237642.sra Written 2267257 spots for SRR4237642.sra Read 2267257 spots for SRR4237642.sra Written 2267257 spots for SRR4237642.sra Read 2267257 spots for SRR4237642.sra Written 2267257 spots for SRR4237642.sra Read 2267257 spots for SRR4237642.sra Written 2267257 spots for SRR4237642.sra Read 2267257 spots for SRR4237642.sra Written 2267257 spots for SRR4237642.sra Read 2267257 spots for SRR4237642.sra Written 2267257 spots for SRR4237642.sra Read 2267257 spots for SRR4237642.sra Written 2267257 spots for SRR4237642.sra Read 2267257 spots for SRR4237642.sra Written 2267257 spots for SRR4237642.sra Read 2267257 spots for SRR4237642.sra Written 2267257 spots for SRR4237642.sra Read 2267257 spots for SRR4237642.sra Written 2267257 spots for SRR4237642.sra Read 2267257 spots for SRR4237642.sra Written 2267257 spots for SRR4237642.sra Read 2267257 spots for SRR4237642.sra Written 2267257 spots for SRR4237642.sra Read 2267257 spots for SRR4237642.sra Written 2267257 spots for SRR4237642.sra Read 2267257 spots for SRR4237642.sra Written 2267257 spots for SRR4237642.sra Read 2267257 spots for SRR4237642.sra Written 2267257 spots for SRR4237642.sra Read 2267257 spots for SRR4237642.sra Written 2267257 spots for SRR4237642.sra Read 2267257 spots for SRR4237642.sra Written 2267257 spots for SRR4237642.sra Read 2267265 spots for SRR4237642.sra Written 2267265 spots for SRR4237642.sra SRR ids: ['SRR4237642.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cark12r_ SRR4237642.sra spots: 45345148 blocks: [[1, 2267257], [2267258, 4534514], [4534515, 6801771], [6801772, 9069028], [9069029, 11336285], [11336286, 13603542], [13603543, 15870799], [15870800, 18138056], [18138057, 20405313], [20405314, 22672570], [22672571, 24939827], [24939828, 27207084], [27207085, 29474341], [29474342, 31741598], [31741599, 34008855], [34008856, 36276112], [36276113, 38543369], [38543370, 40810626], [40810627, 43077883], [43077884, 45345148]] SRR4237642 file size 15255717 SRR4237642 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237642 SRR4237642_1.fastq SRR4237642_2.fastq Input file: SRR4237642_1.fastq Paired file: SRR4237642_2.fastq trimmed: SRR4237642-trimmed-pair1.fastq, SRR4237642-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:08:36 2025 >> started Wed Feb 12 20:09:27 2025 >> done (51.097s) 45345148 read pairs processed; of these: 64682 ( 0.14%) short read pairs filtered out after trimming by size control 55432 ( 0.12%) empty read pairs filtered out after trimming by size control 45225034 (99.74%) read pairs available; of these: 17116180 (37.85%) trimmed read pairs available after processing 28108854 (62.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 10 0.00% 20 15 0.00% 21 8 0.00% 22 14 0.00% 23 17 0.00% 24 12 0.00% 25 11 0.00% 26 12 0.00% 27 23 0.00% 28 13 0.00% 29 21 0.00% 30 24 0.00% 31 20 0.00% 32 28 0.00% 33 42 0.00% 34 36 0.00% 35 274 0.00% 36 110 0.00% 37 56 0.00% 38 67 0.00% 39 53 0.00% 40 47 0.00% 41 85 0.00% 42 76 0.00% 43 87 0.00% 44 82 0.00% 45 80 0.00% 46 100 0.00% 47 123 0.00% 48 137 0.00% 49 152 0.00% 50 204 0.00% 51 180 0.00% 52 197 0.00% 53 216 0.00% 54 252 0.00% 55 281 0.00% 56 297 0.00% 57 361 0.00% 58 377 0.00% 59 471 0.00% 60 480 0.00% 61 565 0.00% 62 631 0.00% 63 735 0.00% 64 829 0.00% 65 944 0.00% 66 997 0.00% 67 1144 0.00% 68 1442 0.00% 69 2735 0.01% 70 2620 0.01% 71 2087 0.00% 72 2263 0.01% 73 2491 0.01% 74 2936 0.01% 75 3276 0.01% 76 3464 0.01% 77 4032 0.01% 78 4333 0.01% 79 5001 0.01% 80 5693 0.01% 81 6471 0.01% 82 7418 0.02% 83 8679 0.02% 84 13775 0.03% 85 14967 0.03% 86 15535 0.03% 87 16521 0.04% 88 17569 0.04% 89 18630 0.04% 90 20299 0.04% 91 21799 0.05% 92 23714 0.05% 93 25807 0.06% 94 27792 0.06% 95 30093 0.07% 96 32128 0.07% 97 34165 0.08% 98 36331 0.08% 99 38779 0.09% 100 40687 0.09% 101 43173 0.10% 102 46568 0.10% 103 50031 0.11% 104 53190 0.12% 105 56644 0.13% 106 59216 0.13% 107 61809 0.14% 108 64983 0.14% 109 67629 0.15% 110 70586 0.16% 111 74032 0.16% 112 77440 0.17% 113 81648 0.18% 114 86385 0.19% 115 90294 0.20% 116 93811 0.21% 117 98337 0.22% 118 101071 0.22% 119 102973 0.23% 120 106986 0.24% 121 111267 0.25% 122 114672 0.25% 123 120871 0.27% 124 125004 0.28% 125 130501 0.29% 126 134257 0.30% 127 137475 0.30% 128 142482 0.32% 129 147655 0.33% 130 152303 0.34% 131 156991 0.35% 132 164942 0.36% 133 171018 0.38% 134 177944 0.39% 135 186204 0.41% 136 196551 0.43% 137 205274 0.45% 138 217601 0.48% 139 229061 0.51% 140 242660 0.54% 141 261801 0.58% 142 283805 0.63% 143 314667 0.70% 144 361914 0.80% 145 429051 0.95% 146 538847 1.19% 147 760818 1.68% 148 1365715 3.02% 149 7543485 16.68% 150 28108854 62.15% 45225034 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=33 prefix-density=0.12 prefix-fanout=2.9 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=160.49 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=23.6 sequence=TCATCTTCACAAAC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=31.49 fanout-score-rank=13 prefix-density=0.39 prefix-fanout=10.1 sequence=TGCTGAGATCATTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=4038.79 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=29.8 sequence=AAGAAGAAGTAAAGGAAGAACAGAAGCCTGTTGAAACAGAGGAGAAGGTTGAAACAGAAACCCCAGTAGAAAAGACTGAGTAATGAGGTCATCACGGGAGAATGCTGCATGGTTCCAGTGGAAGTCTATCTAGTGGGTTCTTGTGTGTAGGTTGAATCTTGCACGTCTAGCTAGTGGTTTAATAAAGGATTGTTATGCTAATGGGGGTGTAGGTATGGAAATGTTCCACTTGGATCAAACCAATGCG SRR4237642 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:10:18 Started mapping on | Feb 12 20:10:18 Finished on | Feb 12 20:13:40 Mapping speed, Million of reads per hour | 805.99 Number of input reads | 45225034 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 43464535 Uniquely mapped reads % | 96.11% Average mapped length | 291.69 Number of splices: Total | 35529968 Number of splices: Annotated (sjdb) | 34818909 Number of splices: GT/AG | 34939437 Number of splices: GC/AG | 452043 Number of splices: AT/AC | 40749 Number of splices: Non-canonical | 97739 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 999410 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 84238 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.45% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 827292 827292 827292 N_multimapping 999410 999410 999410 N_noFeature 1307322 42831584 1615590 N_ambiguous 533575 2582 207450 UnstrandedReadsAssigned:41623638 PositiveStrandReadsAssigned:630369 NegativeStrandReadsAssigned:41641495 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237642 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237642-trimmed-pair1.fastq SRR4237642-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 45,225,034 reads, 41,562,665 reads pseudoaligned [quant] estimated average fragment length: 226.754 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR4237642.ke.tsv 34699 SRR4237642.se.tsv 87100 total ==> SRR4237642.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.25 1236 15.4497 Potri.005G024800.1.v4.1 1035 809.246 268 7.41914 Potri.004G059700.1.v4.1 961 735.246 210 6.39862 Potri.007G009000.2.v4.1 1416 1190.25 0 0 Potri.003G141000.2.v4.1 2943 2717.25 508 4.18826 Potri.016G087400.1.v4.1 270 83.907 5932 1583.81 Potri.015G069301.1.v4.1 564 341.145 0 0 Potri.010G195200.1.v4.1 1773 1547.25 274 3.96726 Potri.012G127500.1.v4.1 977 751.246 27927 832.801 ==> SRR4237642.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5105 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 962 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 870 Potri.001G452600.v4.1 3 SRR4237642 completed mapping pipeline successfully