Starting /dee2/code/volunteer_pipeline.sh SRR4237643 current disk space = 3050948395008 free memory = 1580220024 SRR4237643 SRAfilesize 0ae95fd1da25d8ede5656239311d00b4 SRR4237643.sra SRR4237643.sra file validated SRR4237643 is paired end SRR4237643 is conventional basespace SRR4237643 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237643_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.974 33.0 32.0 34.0 2.0 34.0 2 32.14525 33.0 32.0 34.0 27.0 34.0 3 32.347 34.0 32.0 34.0 28.0 34.0 4 32.623 34.0 33.0 34.0 32.0 34.0 5 32.76025 34.0 33.0 34.0 32.0 34.0 6 36.45225 38.0 37.0 38.0 34.0 38.0 7 36.95525 38.0 38.0 38.0 35.0 38.0 8 36.8565 38.0 38.0 38.0 35.0 38.0 9 36.933 38.0 38.0 38.0 36.0 38.0 10-14 37.07165 38.0 38.0 38.0 36.0 38.0 15-19 37.068900000000006 38.0 38.0 38.0 36.0 38.0 20-24 37.12585 38.0 38.0 38.0 36.0 38.0 25-29 36.56545 38.0 37.8 38.0 33.8 38.0 30-34 36.58 38.0 37.8 38.0 33.8 38.0 35-39 36.763549999999995 38.0 38.0 38.0 34.8 38.0 40-44 36.88075 38.0 38.0 38.0 35.4 38.0 45-49 36.869 38.0 38.0 38.0 35.4 38.0 50-54 36.54545 38.0 37.8 38.0 33.6 38.0 55-59 36.24445000000001 38.0 37.2 38.0 32.6 38.0 60-64 36.56625 38.0 38.0 38.0 34.0 38.0 65-69 36.659 38.0 38.0 38.0 34.0 38.0 70-74 34.49865 37.2 31.6 38.0 28.4 38.0 75-79 36.1543 38.0 37.0 38.0 32.8 38.0 80-84 34.3868 37.2 31.6 38.0 27.2 38.0 85-89 35.942899999999995 38.0 37.0 38.0 31.6 38.0 90-94 36.0345 38.0 37.2 38.0 32.0 38.0 95-99 36.168 38.0 37.4 38.0 33.2 38.0 100-104 36.10080000000001 38.0 37.2 38.0 33.0 38.0 105-109 35.93705 38.0 37.0 38.0 32.6 38.0 110-114 35.3925 38.0 36.2 38.0 28.8 38.0 115-119 35.461200000000005 38.0 36.6 38.0 29.4 38.0 120-124 34.985 38.0 35.8 38.0 27.2 38.0 125-129 34.25475 38.0 34.2 38.0 23.8 38.0 130-134 34.40125 38.0 34.4 38.0 25.0 38.0 135-139 34.3211 38.0 34.6 38.0 24.2 38.0 140-144 33.85745 37.8 34.2 38.0 23.0 38.0 145-149 33.1512 38.0 34.2 38.0 18.8 38.0 150 25.83225 34.0 15.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 0.0 15 3.0 16 1.0 17 2.0 18 4.0 19 0.0 20 5.0 21 4.0 22 9.0 23 13.0 24 13.0 25 15.0 26 26.0 27 48.0 28 44.0 29 63.0 30 68.0 31 94.0 32 131.0 33 169.0 34 236.0 35 358.0 36 882.0 37 1805.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.42061914228912 11.47401306447032 8.633910820789549 40.47145697245101 2 22.75 14.224999999999998 36.275 26.75 3 19.05 20.349999999999998 26.700000000000003 33.900000000000006 4 23.525 29.475 22.375 24.625 5 23.849999999999998 33.25 23.45 19.45 6 18.45 36.075 24.9 20.575 7 13.900000000000002 26.075 42.775 17.25 8 17.675 24.675 32.25 25.4 9 16.5 24.075 35.05 24.375 10-14 19.695 30.485 26.685 23.135 15-19 20.080000000000002 28.78 27.58 23.56 20-24 19.900000000000002 28.48 28.025 23.595 25-29 19.35 29.759999999999998 27.615000000000002 23.275000000000002 30-34 19.400000000000002 29.07 27.615000000000002 23.915 35-39 19.675 29.23 27.55 23.544999999999998 40-44 19.725 29.285 27.584999999999997 23.405 45-49 19.805 29.01 27.384999999999998 23.799999999999997 50-54 20.044999999999998 28.675 27.42 23.86 55-59 19.605 29.015 27.955000000000002 23.425 60-64 19.509999999999998 28.895 27.800000000000004 23.794999999999998 65-69 19.68 29.335 27.435 23.549999999999997 70-74 20.24 28.665000000000003 27.655 23.44 75-79 19.869999999999997 29.110000000000003 27.250000000000004 23.77 80-84 20.57 28.79 27.200000000000003 23.44 85-89 19.75 29.215000000000003 27.575 23.46 90-94 20.28 29.085 27.084999999999997 23.549999999999997 95-99 20.145 28.73 27.235 23.89 100-104 20.064999999999998 28.925 26.950000000000003 24.060000000000002 105-109 20.73 29.2 26.99 23.080000000000002 110-114 20.945 28.58 26.740000000000002 23.735 115-119 21.025 29.12 26.245 23.61 120-124 21.37 29.345 25.45 23.835 125-129 20.625 28.845 25.805 24.725 130-134 20.7 28.310000000000002 26.97 24.02 135-139 20.61 28.449999999999996 26.150000000000002 24.79 140-144 20.89 28.375 25.55 25.185000000000002 145-149 20.705000000000002 28.24 25.71 25.345000000000002 150 20.4 27.85 26.674999999999997 25.074999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.5 23 2.0 24 1.5 25 4.0 26 6.5 27 10.0 28 11.0 29 12.0 30 20.5 31 31.0 32 36.0 33 49.0 34 69.0 35 86.0 36 107.5 37 121.0 38 133.0 39 157.5 40 194.5 41 219.0 42 242.5 43 268.0 44 271.0 45 261.5 46 256.5 47 246.5 48 210.5 49 192.5 50 179.5 51 146.5 52 121.0 53 92.5 54 56.5 55 39.0 56 37.0 57 24.0 58 14.5 59 14.0 60 11.5 61 9.0 62 7.0 63 4.5 64 1.5 65 2.5 66 4.5 67 4.0 68 3.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92492492492492 99.825 2 0.050050050050050046 0.1 3 0.025025025025025023 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 1.025 0.0 0.0 0.0 0.0 96-97 1.2625000000000002 0.0 0.0 0.0 0.0 98-99 1.6125 0.0 0.0 0.0 0.0 100-101 2.025 0.0 0.0 0.0 0.0 102-103 2.4375 0.0 0.0 0.0 0.0 104-105 2.9625000000000004 0.0 0.0 0.0 0.0 106-107 3.45 0.0 0.0 0.0 0.0 108-109 4.025 0.0 0.0 0.0 0.0 110-111 4.7875 0.0 0.0 0.0 0.0 112-113 5.525 0.0 0.0 0.0 0.0 114-115 6.3375 0.0 0.0 0.0 0.0 116-117 7.15 0.0 0.0 0.0 0.0 118-119 7.9375 0.0 0.0 0.0 0.0 120-121 8.9375 0.0 0.0 0.0 0.0 122-123 9.8625 0.0 0.0 0.0 0.0 124-125 10.5125 0.0 0.0 0.0 0.0 126-127 11.3625 0.0 0.0 0.0 0.0 128-129 12.1875 0.0 0.0 0.0 0.0 130-131 13.025 0.0 0.0 0.0 0.0 132-133 13.975 0.0 0.0 0.0 0.0 134-135 14.975000000000001 0.0 0.0 0.0 0.0 136-137 15.775 0.0 0.0 0.0 0.0 138 16.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTATGC 20 0.0061575063 28.7825 135-139 >>END_MODULE SRR4237643 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237643_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.167 33.0 33.0 34.0 30.0 34.0 2 32.02125 33.0 33.0 34.0 30.0 34.0 3 32.09025 33.0 33.0 34.0 30.0 34.0 4 32.165 33.0 33.0 34.0 31.0 34.0 5 32.31425 33.0 33.0 34.0 31.0 34.0 6 36.177 38.0 38.0 38.0 33.0 38.0 7 36.19175 38.0 38.0 38.0 33.0 38.0 8 35.83025 38.0 37.0 38.0 31.0 38.0 9 36.2215 38.0 38.0 38.0 33.0 38.0 10-14 36.209250000000004 38.0 38.0 38.0 33.0 38.0 15-19 36.280899999999995 38.0 38.0 38.0 33.4 38.0 20-24 36.34385 38.0 38.0 38.0 33.8 38.0 25-29 36.1463 38.0 37.6 38.0 33.0 38.0 30-34 36.2067 38.0 38.0 38.0 33.4 38.0 35-39 36.19029999999999 38.0 38.0 38.0 33.2 38.0 40-44 35.950900000000004 38.0 37.6 38.0 31.6 38.0 45-49 34.6099 37.8 34.8 38.0 24.6 38.0 50-54 35.869150000000005 38.0 37.0 38.0 31.2 38.0 55-59 36.11755 38.0 37.8 38.0 33.0 38.0 60-64 36.074349999999995 38.0 37.8 38.0 32.8 38.0 65-69 35.851350000000004 38.0 37.2 38.0 31.2 38.0 70-74 34.9924 38.0 35.6 38.0 25.4 38.0 75-79 33.33355 37.6 31.6 38.0 22.8 38.0 80-84 35.56225 38.0 36.8 38.0 30.0 38.0 85-89 35.1908 38.0 36.4 38.0 28.0 38.0 90-94 35.279399999999995 38.0 36.4 38.0 28.4 38.0 95-99 35.419 38.0 36.8 38.0 29.2 38.0 100-104 35.3466 38.0 36.8 38.0 29.0 38.0 105-109 35.09035 38.0 36.2 38.0 27.2 38.0 110-114 33.963849999999994 37.8 33.8 38.0 23.6 38.0 115-119 34.4446 38.0 35.0 38.0 24.4 38.0 120-124 34.4702 38.0 35.4 38.0 24.4 38.0 125-129 34.2806 38.0 35.0 38.0 23.4 38.0 130-134 33.5892 38.0 34.6 38.0 20.2 38.0 135-139 33.179700000000004 38.0 33.6 38.0 16.8 38.0 140-144 31.312149999999995 37.4 30.0 38.0 10.8 38.0 145-149 29.858050000000002 37.2 29.8 38.0 2.0 38.0 150 22.55825 31.0 2.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 6.0 4 2.0 5 0.0 6 4.0 7 1.0 8 0.0 9 2.0 10 4.0 11 0.0 12 2.0 13 3.0 14 2.0 15 2.0 16 4.0 17 5.0 18 8.0 19 9.0 20 10.0 21 14.0 22 17.0 23 35.0 24 37.0 25 55.0 26 41.0 27 58.0 28 56.0 29 80.0 30 95.0 31 98.0 32 163.0 33 174.0 34 263.0 35 353.0 36 731.0 37 1658.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.45 20.375 13.225000000000001 27.950000000000003 2 28.225 23.849999999999998 32.75 15.174999999999999 3 20.325 27.400000000000002 32.175 20.1 4 24.5 33.1 24.0 18.4 5 25.474999999999998 35.65 23.5 15.375 6 19.575 38.675 24.224999999999998 17.525 7 19.950000000000003 19.75 41.975 18.325 8 21.45 22.775000000000002 31.2 24.575 9 23.7 23.575 30.25 22.475 10-14 23.53 28.79 27.155 20.525 15-19 23.735 27.38 28.79 20.095 20-24 23.474999999999998 28.18 27.634999999999998 20.71 25-29 23.265 28.285 28.055000000000003 20.395 30-34 23.565 27.48 28.035 20.919999999999998 35-39 23.215 28.115000000000002 28.044999999999998 20.625 40-44 23.544999999999998 27.565 28.499999999999996 20.39 45-49 23.74 27.3 28.849999999999998 20.11 50-54 24.185000000000002 27.42 28.084999999999997 20.31 55-59 23.565 27.71 28.804999999999996 19.919999999999998 60-64 23.185 28.12 28.595 20.1 65-69 23.29 27.63 28.299999999999997 20.78 70-74 24.165 27.224999999999998 28.465 20.145 75-79 23.085 27.935 28.694999999999997 20.285 80-84 23.52 27.815 27.944999999999997 20.72 85-89 23.125 27.860000000000003 28.715000000000003 20.3 90-94 23.96 27.939999999999998 27.88 20.22 95-99 23.625 27.82 28.15 20.405 100-104 23.544999999999998 28.23 28.15 20.075000000000003 105-109 23.66 28.13 27.894999999999996 20.315 110-114 24.8 27.994999999999997 27.224999999999998 19.98 115-119 24.85 28.465 27.029999999999998 19.655 120-124 25.86 28.435 26.715 18.990000000000002 125-129 26.035000000000004 27.905 26.87 19.189999999999998 130-134 26.145000000000003 27.534999999999997 27.36 18.96 135-139 26.555 27.68 27.165 18.6 140-144 26.955000000000002 28.044999999999998 26.900000000000002 18.099999999999998 145-149 26.55 27.555000000000003 27.01 18.884999999999998 150 27.800000000000004 27.6 25.8 18.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.0 23 2.0 24 1.5 25 1.5 26 4.5 27 9.0 28 10.5 29 12.5 30 16.5 31 19.5 32 29.5 33 41.5 34 49.0 35 65.5 36 83.5 37 110.0 38 142.5 39 174.5 40 210.5 41 226.5 42 257.5 43 282.0 44 268.0 45 260.0 46 258.5 47 251.5 48 240.5 49 206.0 50 159.0 51 127.0 52 118.0 53 96.5 54 64.0 55 50.5 56 35.0 57 26.5 58 19.0 59 13.0 60 10.0 61 6.5 62 6.0 63 5.5 64 5.5 65 5.5 66 5.0 67 3.5 68 1.0 69 1.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.5249999999999999 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.9125 0.0 0.0 0.0 0.0 94-95 1.125 0.0 0.0 0.0 0.0 96-97 1.3375 0.0 0.0 0.0 0.0 98-99 1.6875 0.0 0.0 0.0 0.0 100-101 2.0625 0.0 0.0 0.0 0.0 102-103 2.425 0.0 0.0 0.0 0.0 104-105 2.975 0.0 0.0 0.0 0.0 106-107 3.5 0.0 0.0 0.0 0.0 108-109 4.075 0.0 0.0 0.0 0.0 110-111 4.7875 0.0 0.0 0.0 0.0 112-113 5.550000000000001 0.0 0.0 0.0 0.0 114-115 6.375 0.0 0.0 0.0 0.0 116-117 7.1875 0.0 0.0 0.0 0.0 118-119 8.0 0.0 0.0 0.0 0.0 120-121 9.0 0.0 0.0 0.0 0.0 122-123 9.9375 0.0 0.0 0.0 0.0 124-125 10.625 0.0 0.0 0.0 0.0 126-127 11.5375 0.0 0.0 0.0 0.0 128-129 12.3875 0.0 0.0 0.0 0.0 130-131 13.2125 0.0 0.0 0.0 0.0 132-133 14.15 0.0 0.0 0.0 0.0 134-135 15.1 0.0 0.0 0.0 0.0 136-137 15.850000000000001 0.0 0.0 0.0 0.0 138 16.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAACTT 10 0.006973645 144.0 8 TTGCTCG 10 0.006973645 144.0 7 GGGGGGG 35 0.0036813593 20.571428 50-54 >>END_MODULE Read 3103776 spots for SRR4237643.sra Written 3103776 spots for SRR4237643.sra Read 3103776 spots for SRR4237643.sra Written 3103776 spots for SRR4237643.sra Read 3103776 spots for SRR4237643.sra Written 3103776 spots for SRR4237643.sra Read 3103776 spots for SRR4237643.sra Written 3103776 spots for SRR4237643.sra Read 3103776 spots for SRR4237643.sra Written 3103776 spots for SRR4237643.sra Read 3103776 spots for SRR4237643.sra Written 3103776 spots for SRR4237643.sra Read 3103776 spots for SRR4237643.sra Written 3103776 spots for SRR4237643.sra Read 3103776 spots for SRR4237643.sra Written 3103776 spots for SRR4237643.sra Read 3103776 spots for SRR4237643.sra Read 3103776 spots for SRR4237643.sra Written 3103776 spots for SRR4237643.sra Written 3103776 spots for SRR4237643.sra Read 3103776 spots for SRR4237643.sra Written 3103776 spots for SRR4237643.sra Read 3103776 spots for SRR4237643.sra Written 3103776 spots for SRR4237643.sra Read 3103776 spots for SRR4237643.sra Written 3103776 spots for SRR4237643.sra Read 3103776 spots for SRR4237643.sra Written 3103776 spots for SRR4237643.sra Read 3103776 spots for SRR4237643.sra Written 3103776 spots for SRR4237643.sra Read 3103776 spots for SRR4237643.sra Written 3103776 spots for SRR4237643.sra Read 3103776 spots for SRR4237643.sra Written 3103776 spots for SRR4237643.sra Read 3103776 spots for SRR4237643.sra Written 3103776 spots for SRR4237643.sra Read 3103789 spots for SRR4237643.sra Written 3103789 spots for SRR4237643.sra Read 3103776 spots for SRR4237643.sra Written 3103776 spots for SRR4237643.sra SRR ids: ['SRR4237643.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zsj_8j8f SRR4237643.sra spots: 62075533 blocks: [[1, 3103776], [3103777, 6207552], [6207553, 9311328], [9311329, 12415104], [12415105, 15518880], [15518881, 18622656], [18622657, 21726432], [21726433, 24830208], [24830209, 27933984], [27933985, 31037760], [31037761, 34141536], [34141537, 37245312], [37245313, 40349088], [40349089, 43452864], [43452865, 46556640], [46556641, 49660416], [49660417, 52764192], [52764193, 55867968], [55867969, 58971744], [58971745, 62075533]] SRR4237643 file size 20892419 SRR4237643 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237643 SRR4237643_1.fastq SRR4237643_2.fastq Input file: SRR4237643_1.fastq Paired file: SRR4237643_2.fastq trimmed: SRR4237643-trimmed-pair1.fastq, SRR4237643-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:48:24 2025 >> started Wed Feb 12 20:49:35 2025 >> done (71.303s) 62075533 read pairs processed; of these: 70648 ( 0.11%) short read pairs filtered out after trimming by size control 65659 ( 0.11%) empty read pairs filtered out after trimming by size control 61939226 (99.78%) read pairs available; of these: 30655776 (49.49%) trimmed read pairs available after processing 31283450 (50.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 11 0.00% 21 7 0.00% 22 16 0.00% 23 14 0.00% 24 19 0.00% 25 16 0.00% 26 16 0.00% 27 24 0.00% 28 24 0.00% 29 23 0.00% 30 40 0.00% 31 26 0.00% 32 47 0.00% 33 47 0.00% 34 54 0.00% 35 75 0.00% 36 72 0.00% 37 100 0.00% 38 113 0.00% 39 111 0.00% 40 145 0.00% 41 173 0.00% 42 185 0.00% 43 198 0.00% 44 256 0.00% 45 264 0.00% 46 299 0.00% 47 323 0.00% 48 401 0.00% 49 477 0.00% 50 552 0.00% 51 625 0.00% 52 662 0.00% 53 706 0.00% 54 817 0.00% 55 906 0.00% 56 977 0.00% 57 1219 0.00% 58 1302 0.00% 59 1579 0.00% 60 1841 0.00% 61 2089 0.00% 62 2324 0.00% 63 2678 0.00% 64 2953 0.00% 65 3508 0.01% 66 3725 0.01% 67 4576 0.01% 68 5434 0.01% 69 6895 0.01% 70 6968 0.01% 71 7333 0.01% 72 8548 0.01% 73 9822 0.02% 74 11071 0.02% 75 12345 0.02% 76 13933 0.02% 77 15326 0.02% 78 17376 0.03% 79 19263 0.03% 80 21849 0.04% 81 24857 0.04% 82 28249 0.05% 83 32728 0.05% 84 40159 0.06% 85 45089 0.07% 86 48518 0.08% 87 52934 0.09% 88 57340 0.09% 89 61610 0.10% 90 67183 0.11% 91 73390 0.12% 92 79597 0.13% 93 87448 0.14% 94 96113 0.16% 95 104361 0.17% 96 112101 0.18% 97 119537 0.19% 98 126054 0.20% 99 133670 0.22% 100 141860 0.23% 101 149622 0.24% 102 158906 0.26% 103 168942 0.27% 104 179097 0.29% 105 189975 0.31% 106 200515 0.32% 107 209328 0.34% 108 215794 0.35% 109 223663 0.36% 110 227494 0.37% 111 236983 0.38% 112 245231 0.40% 113 251678 0.41% 114 263537 0.43% 115 276571 0.45% 116 282280 0.46% 117 291192 0.47% 118 301144 0.49% 119 302743 0.49% 120 307884 0.50% 121 314432 0.51% 122 317545 0.51% 123 324406 0.52% 124 334189 0.54% 125 341959 0.55% 126 350713 0.57% 127 357185 0.58% 128 364496 0.59% 129 370931 0.60% 130 377063 0.61% 131 380652 0.61% 132 385835 0.62% 133 393561 0.64% 134 399720 0.65% 135 407910 0.66% 136 421504 0.68% 137 433252 0.70% 138 450413 0.73% 139 465517 0.75% 140 481894 0.78% 141 500355 0.81% 142 529511 0.85% 143 564294 0.91% 144 620672 1.00% 145 708079 1.14% 146 852418 1.38% 147 1145921 1.85% 148 1952194 3.15% 149 9700985 15.66% 150 31283450 50.51% 61939226 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=35 prefix-density=0.12 prefix-fanout=2.7 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=344.95 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=31.8 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=5.43 fanout-score-rank=31 prefix-density=0.18 prefix-fanout=3.7 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=2526.50 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=30.2 sequence=AAGAAGAAGTAAAGGAAGAACAGAAGCCTGTTGAAACAGAGGAGAAGGTTGAAACAGAAACCCCAGTAGAAAAGACTGAGTAATGAGGTCATCACGGGAGAATGCTGCATGGTTCCAGTGGAAGTCTATCTAGTGGGTTCTTGTGTGTAGGTTGAATCTTGCACGTCTAGCTAGTGGTTTAATAAAGGATTGTTATGCTAATGGGGGTGTAGGTATGGAAATGTTCCACTTGGATCAAACCAATGCG SRR4237643 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:50:21 Started mapping on | Feb 12 20:50:21 Finished on | Feb 12 20:57:09 Mapping speed, Million of reads per hour | 546.52 Number of input reads | 61939226 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 58696285 Uniquely mapped reads % | 94.76% Average mapped length | 284.37 Number of splices: Total | 49136100 Number of splices: Annotated (sjdb) | 48188388 Number of splices: GT/AG | 48330858 Number of splices: GC/AG | 626375 Number of splices: AT/AC | 46687 Number of splices: Non-canonical | 132180 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.38 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1251208 % of reads mapped to multiple loci | 2.02% Number of reads mapped to too many loci | 191534 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.84% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2051479 2051479 2051479 N_multimapping 1251208 1251208 1251208 N_noFeature 2024907 57829454 2545602 N_ambiguous 591540 3806 242943 UnstrandedReadsAssigned:56079838 PositiveStrandReadsAssigned:863025 NegativeStrandReadsAssigned:55907740 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=138 echo kmer=133 SRR4237643 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237643-trimmed-pair1.fastq SRR4237643-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 61,939,226 reads, 55,838,334 reads pseudoaligned [quant] estimated average fragment length: 196.661 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,289 rounds 52401 SRR4237643.ke.tsv 34699 SRR4237643.se.tsv 87100 total ==> SRR4237643.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1822.34 1638 18.2252 Potri.005G024800.1.v4.1 1035 839.339 349 8.43092 Potri.004G059700.1.v4.1 961 765.362 198 5.24548 Potri.007G009000.2.v4.1 1416 1220.34 0 0 Potri.003G141000.2.v4.1 2943 2747.34 1004.51 7.41361 Potri.016G087400.1.v4.1 270 102.832 6401 1262.14 Potri.015G069301.1.v4.1 564 370.435 0 0 Potri.010G195200.1.v4.1 1773 1577.34 440 5.65607 Potri.012G127500.1.v4.1 977 781.345 30300 786.298 ==> SRR4237643.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5953 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 862 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 26 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1906 Potri.001G452600.v4.1 0 SRR4237643 completed mapping pipeline successfully