Starting /dee2/code/volunteer_pipeline.sh SRR4237644 current disk space = 3050937200640 free memory = 1575358152 SRR4237644 SRAfilesize 0cc3a3b16cb7aa013f2d54e9f33622a8 SRR4237644.sra SRR4237644.sra file validated SRR4237644 is paired end SRR4237644 is conventional basespace SRR4237644 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237644_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.52175 33.0 33.0 34.0 25.0 34.0 2 32.709 34.0 33.0 34.0 28.0 34.0 3 32.878 34.0 33.0 34.0 31.0 34.0 4 33.0815 34.0 33.0 34.0 32.0 34.0 5 32.33875 34.0 33.0 34.0 31.0 34.0 6 36.5775 38.0 37.0 38.0 34.0 38.0 7 37.14475 38.0 38.0 38.0 36.0 38.0 8 37.2765 38.0 38.0 38.0 36.0 38.0 9 37.348 38.0 38.0 38.0 37.0 38.0 10-14 37.3719 38.0 38.0 38.0 37.0 38.0 15-19 37.30355 38.0 38.0 38.0 37.0 38.0 20-24 37.1959 38.0 38.0 38.0 36.6 38.0 25-29 36.61635 38.0 37.4 38.0 34.2 38.0 30-34 37.24235 38.0 38.0 38.0 36.8 38.0 35-39 36.9892 38.0 38.0 38.0 35.8 38.0 40-44 37.1087 38.0 38.0 38.0 36.2 38.0 45-49 37.059799999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.316700000000004 38.0 37.4 38.0 32.6 38.0 55-59 34.3487 37.6 33.6 38.0 24.2 38.0 60-64 34.564049999999995 36.8 31.4 38.0 28.8 38.0 65-69 36.93835 38.0 38.0 38.0 35.8 38.0 70-74 35.24625 37.6 34.6 38.0 29.8 38.0 75-79 36.22665 38.0 37.4 38.0 32.2 38.0 80-84 35.7353 38.0 36.2 38.0 29.8 38.0 85-89 36.2167 38.0 37.4 38.0 33.0 38.0 90-94 35.8626 38.0 36.8 38.0 30.6 38.0 95-99 36.609 38.0 38.0 38.0 34.4 38.0 100-104 36.501850000000005 38.0 38.0 38.0 34.0 38.0 105-109 36.4106 38.0 38.0 38.0 34.0 38.0 110-114 36.3591 38.0 38.0 38.0 34.0 38.0 115-119 36.135450000000006 38.0 37.6 38.0 33.8 38.0 120-124 35.95485000000001 38.0 37.6 38.0 32.4 38.0 125-129 34.8773 38.0 35.4 38.0 26.4 38.0 130-134 35.6357 38.0 36.6 38.0 31.4 38.0 135-139 32.3121 36.2 29.6 38.0 21.0 38.0 140-144 31.27925 36.0 27.0 38.0 17.2 38.0 145-149 33.80195 37.6 34.2 38.0 25.2 38.0 150 30.02625 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 0.0 16 4.0 17 1.0 18 2.0 19 6.0 20 2.0 21 6.0 22 8.0 23 9.0 24 5.0 25 22.0 26 31.0 27 25.0 28 33.0 29 41.0 30 58.0 31 73.0 32 119.0 33 145.0 34 244.0 35 470.0 36 1049.0 37 1642.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.04613297150611 11.913161465400272 8.656716417910449 41.38398914518318 2 23.05 14.924999999999999 35.325 26.700000000000003 3 19.75 21.349999999999998 25.45 33.45 4 22.525000000000002 28.975 23.125 25.374999999999996 5 22.825 34.300000000000004 24.05 18.825 6 16.650000000000002 38.550000000000004 23.425 21.375 7 12.975 27.3 42.125 17.599999999999998 8 16.1 27.35 32.1 24.45 9 16.025 24.474999999999998 35.25 24.25 10-14 19.165 31.235000000000003 27.089999999999996 22.509999999999998 15-19 19.025 29.995 27.694999999999997 23.285 20-24 19.295 30.31 27.33 23.064999999999998 25-29 18.995 29.73 27.6 23.674999999999997 30-34 19.425 30.115 26.75 23.71 35-39 19.66 30.435000000000002 26.66 23.244999999999997 40-44 19.695 30.25 27.0 23.055 45-49 19.32 29.675 27.075 23.93 50-54 19.715 29.825000000000003 26.645000000000003 23.815 55-59 19.695 29.705 27.065 23.535 60-64 19.485 30.06 26.974999999999998 23.48 65-69 19.56 28.804999999999996 27.685 23.95 70-74 19.53 29.26 27.51 23.7 75-79 19.325 29.48 27.485 23.71 80-84 19.814999999999998 29.535 27.045 23.605 85-89 19.509999999999998 29.845 26.974999999999998 23.669999999999998 90-94 19.650000000000002 29.29 27.32 23.74 95-99 19.915 28.915000000000003 27.925 23.244999999999997 100-104 20.145 29.189999999999998 27.584999999999997 23.080000000000002 105-109 19.875 28.804999999999996 27.525 23.794999999999998 110-114 20.32 28.535 27.725 23.419999999999998 115-119 20.125 29.475 27.245 23.155 120-124 20.355 28.655 27.400000000000002 23.59 125-129 20.080000000000002 29.154999999999998 26.595000000000002 24.169999999999998 130-134 20.16 28.59 27.544999999999998 23.705000000000002 135-139 20.544999999999998 28.645 27.105 23.705000000000002 140-144 20.825 28.375 27.045 23.755000000000003 145-149 20.505000000000003 29.049999999999997 26.255 24.19 150 20.575 28.299999999999997 26.900000000000002 24.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 3.5 24 5.0 25 2.0 26 1.0 27 11.0 28 20.5 29 22.0 30 24.5 31 35.5 32 58.0 33 66.0 34 68.0 35 83.0 36 104.0 37 131.5 38 153.5 39 171.0 40 193.0 41 216.0 42 233.0 43 266.0 44 283.0 45 275.0 46 269.0 47 245.0 48 200.5 49 167.0 50 155.0 51 126.0 52 92.5 53 76.0 54 65.0 55 47.0 56 35.0 57 26.5 58 15.5 59 11.5 60 9.0 61 6.0 62 4.5 63 5.0 64 4.5 65 2.5 66 2.0 67 3.0 68 2.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.2375 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.7 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.175 0.0 0.0 0.0 0.0 118-119 2.45 0.0 0.0 0.0 0.0 120-121 2.5875 0.0 0.0 0.0 0.0 122-123 2.95 0.0 0.0 0.0 0.0 124-125 3.4124999999999996 0.0 0.0 0.0 0.0 126-127 3.9125 0.0 0.0 0.0 0.0 128-129 4.275 0.0 0.0 0.0 0.0 130-131 4.6875 0.0 0.0 0.0 0.0 132-133 5.1 0.0 0.0 0.0 0.0 134-135 5.3875 0.0 0.0 0.0 0.0 136-137 5.95 0.0 0.0 0.0 0.0 138 6.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237644 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237644_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.54775 33.0 33.0 34.0 32.0 34.0 2 32.61125 33.0 33.0 34.0 32.0 34.0 3 32.59875 33.0 33.0 34.0 32.0 34.0 4 32.6125 33.0 33.0 34.0 32.0 34.0 5 32.6595 33.0 33.0 34.0 32.0 34.0 6 36.62775 38.0 38.0 38.0 35.0 38.0 7 36.814 38.0 38.0 38.0 36.0 38.0 8 36.81625 38.0 38.0 38.0 36.0 38.0 9 36.7525 38.0 38.0 38.0 36.0 38.0 10-14 36.38165 38.0 37.8 38.0 33.4 38.0 15-19 36.36750000000001 38.0 38.0 38.0 33.6 38.0 20-24 34.441700000000004 38.0 34.2 38.0 23.4 38.0 25-29 36.151250000000005 38.0 37.6 38.0 32.6 38.0 30-34 36.6305 38.0 38.0 38.0 34.8 38.0 35-39 36.54365 38.0 38.0 38.0 34.8 38.0 40-44 36.38095 38.0 38.0 38.0 34.0 38.0 45-49 35.9721 38.0 37.2 38.0 29.8 38.0 50-54 35.215050000000005 38.0 35.2 38.0 28.2 38.0 55-59 36.34015000000001 38.0 38.0 38.0 33.8 38.0 60-64 36.35125 38.0 38.0 38.0 34.0 38.0 65-69 36.39905 38.0 38.0 38.0 34.2 38.0 70-74 35.38005 38.0 36.2 38.0 29.0 38.0 75-79 34.619800000000005 38.0 35.2 38.0 23.4 38.0 80-84 36.1345 38.0 37.8 38.0 33.0 38.0 85-89 36.15235 38.0 38.0 38.0 33.8 38.0 90-94 35.954100000000004 38.0 37.6 38.0 32.8 38.0 95-99 35.97865 38.0 38.0 38.0 33.2 38.0 100-104 35.5917 38.0 37.2 38.0 30.4 38.0 105-109 35.495900000000006 38.0 36.8 38.0 30.0 38.0 110-114 34.12045 37.8 34.2 38.0 25.4 38.0 115-119 33.4321 37.4 31.8 38.0 22.8 38.0 120-124 34.907 38.0 36.0 38.0 27.4 38.0 125-129 34.84805 38.0 35.8 38.0 27.2 38.0 130-134 34.53215 38.0 35.4 38.0 25.0 38.0 135-139 34.455 38.0 35.8 38.0 25.2 38.0 140-144 33.5489 38.0 34.4 38.0 20.4 38.0 145-149 32.39755 38.0 33.0 38.0 10.4 38.0 150 26.35125 33.0 21.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 4.0 4 4.0 5 1.0 6 2.0 7 1.0 8 0.0 9 2.0 10 1.0 11 0.0 12 5.0 13 1.0 14 5.0 15 1.0 16 9.0 17 5.0 18 4.0 19 7.0 20 10.0 21 11.0 22 16.0 23 13.0 24 24.0 25 23.0 26 40.0 27 37.0 28 50.0 29 56.0 30 61.0 31 71.0 32 127.0 33 153.0 34 227.0 35 358.0 36 735.0 37 1922.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.525 20.325 13.825000000000001 27.325 2 28.199999999999996 24.025 32.800000000000004 14.975 3 20.925 26.55 33.650000000000006 18.875 4 24.6 33.575 24.6 17.224999999999998 5 24.575 36.075 23.325000000000003 16.025 6 20.9 39.324999999999996 22.825 16.950000000000003 7 20.8 20.724999999999998 39.7 18.775 8 21.55 24.825 30.375000000000004 23.25 9 21.85 23.875 31.674999999999997 22.6 10-14 24.11 28.48 26.924999999999997 20.485 15-19 24.19 28.189999999999998 27.944999999999997 19.675 20-24 23.745 27.375 28.689999999999998 20.19 25-29 23.535 28.27 27.950000000000003 20.244999999999997 30-34 23.355 28.060000000000002 27.96 20.625 35-39 23.185 28.12 28.055000000000003 20.64 40-44 23.27 28.04 28.71 19.98 45-49 23.515 27.565 28.87 20.05 50-54 23.165 28.37 28.395 20.07 55-59 23.055 27.744999999999997 28.749999999999996 20.45 60-64 23.085 27.47 29.285 20.16 65-69 23.5 27.565 28.7 20.235 70-74 23.72 27.725 28.43 20.125 75-79 24.085 27.46 28.42 20.035 80-84 23.59 27.450000000000003 29.270000000000003 19.689999999999998 85-89 23.705000000000002 27.900000000000002 28.38 20.015 90-94 23.615 27.955000000000002 29.205 19.225 95-99 23.400000000000002 28.27 28.465 19.865 100-104 23.810000000000002 28.134999999999998 28.54 19.515 105-109 23.990000000000002 28.065 28.549999999999997 19.395 110-114 24.055 27.134999999999998 29.03 19.78 115-119 24.19 27.79 28.685 19.335 120-124 24.415 27.955000000000002 28.050000000000004 19.580000000000002 125-129 24.125 27.755000000000003 28.754999999999995 19.365 130-134 24.740000000000002 27.245 28.52 19.495 135-139 24.675 27.395000000000003 27.72 20.21 140-144 24.43 27.725 28.505000000000003 19.34 145-149 25.71 27.779999999999998 27.534999999999997 18.975 150 24.2 27.650000000000002 28.575 19.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.5 21 2.5 22 1.0 23 1.0 24 2.0 25 2.0 26 4.0 27 5.0 28 6.0 29 11.0 30 15.5 31 18.0 32 24.5 33 44.5 34 63.5 35 74.0 36 96.5 37 127.0 38 149.5 39 170.0 40 197.0 41 241.5 42 263.5 43 264.5 44 272.0 45 278.0 46 287.0 47 263.5 48 235.5 49 200.0 50 145.0 51 127.0 52 103.0 53 70.5 54 64.0 55 50.0 56 31.5 57 21.5 58 18.0 59 13.0 60 6.5 61 4.5 62 6.5 63 4.5 64 1.5 65 2.0 66 2.0 67 1.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 0.9875 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.2625000000000002 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.7375 0.0 0.0 0.0 0.0 116-117 1.9749999999999999 0.0 0.0 0.0 0.0 118-119 2.2750000000000004 0.0 0.0 0.0 0.0 120-121 2.4625 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.3 0.0 0.0 0.0 0.0 126-127 3.7874999999999996 0.0 0.0 0.0 0.0 128-129 4.225 0.0 0.0 0.0 0.0 130-131 4.75 0.0 0.0 0.0 0.0 132-133 5.25 0.0 0.0 0.0 0.0 134-135 5.7125 0.0 0.0 0.0 0.0 136-137 6.4375 0.0 0.0 0.0 0.0 138 6.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2683007 spots for SRR4237644.sra Written 2683007 spots for SRR4237644.sra Read 2683007 spots for SRR4237644.sra Written 2683007 spots for SRR4237644.sra Read 2683007 spots for SRR4237644.sra Written 2683007 spots for SRR4237644.sra Read 2683007 spots for SRR4237644.sra Written 2683007 spots for SRR4237644.sra Read 2683007 spots for SRR4237644.sra Written 2683007 spots for SRR4237644.sra Read 2683007 spots for SRR4237644.sra Written 2683007 spots for SRR4237644.sra Read 2683007 spots for SRR4237644.sra Written 2683007 spots for SRR4237644.sra Read 2683026 spots for SRR4237644.sra Written 2683026 spots for SRR4237644.sra Read 2683007 spots for SRR4237644.sra Written 2683007 spots for SRR4237644.sra Read 2683007 spots for SRR4237644.sra Written 2683007 spots for SRR4237644.sra Read 2683007 spots for SRR4237644.sra Written 2683007 spots for SRR4237644.sra Read 2683007 spots for SRR4237644.sra Written 2683007 spots for SRR4237644.sra Read 2683007 spots for SRR4237644.sra Written 2683007 spots for SRR4237644.sra Read 2683007 spots for SRR4237644.sra Written 2683007 spots for SRR4237644.sra Read 2683007 spots for SRR4237644.sra Written 2683007 spots for SRR4237644.sra Read 2683007 spots for SRR4237644.sra Written 2683007 spots for SRR4237644.sra Read 2683007 spots for SRR4237644.sra Written 2683007 spots for SRR4237644.sra Read 2683007 spots for SRR4237644.sra Written 2683007 spots for SRR4237644.sra Read 2683007 spots for SRR4237644.sra Written 2683007 spots for SRR4237644.sra Read 2683007 spots for SRR4237644.sra Written 2683007 spots for SRR4237644.sra SRR ids: ['SRR4237644.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b8otjuid SRR4237644.sra spots: 53660159 blocks: [[1, 2683007], [2683008, 5366014], [5366015, 8049021], [8049022, 10732028], [10732029, 13415035], [13415036, 16098042], [16098043, 18781049], [18781050, 21464056], [21464057, 24147063], [24147064, 26830070], [26830071, 29513077], [29513078, 32196084], [32196085, 34879091], [34879092, 37562098], [37562099, 40245105], [40245106, 42928112], [42928113, 45611119], [45611120, 48294126], [48294127, 50977133], [50977134, 53660159]] SRR4237644 file size 18057161 SRR4237644 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237644 SRR4237644_1.fastq SRR4237644_2.fastq Input file: SRR4237644_1.fastq Paired file: SRR4237644_2.fastq trimmed: SRR4237644-trimmed-pair1.fastq, SRR4237644-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:33:48 2025 >> started Wed Feb 12 20:35:35 2025 >> done (106.539s) 53660159 read pairs processed; of these: 49349 ( 0.09%) short read pairs filtered out after trimming by size control 49169 ( 0.09%) empty read pairs filtered out after trimming by size control 53561641 (99.82%) read pairs available; of these: 20301681 (37.90%) trimmed read pairs available after processing 33259960 (62.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 5 0.00% 21 11 0.00% 22 8 0.00% 23 6 0.00% 24 11 0.00% 25 12 0.00% 26 11 0.00% 27 12 0.00% 28 16 0.00% 29 17 0.00% 30 18 0.00% 31 15 0.00% 32 19 0.00% 33 27 0.00% 34 31 0.00% 35 23 0.00% 36 35 0.00% 37 38 0.00% 38 38 0.00% 39 31 0.00% 40 49 0.00% 41 45 0.00% 42 72 0.00% 43 69 0.00% 44 76 0.00% 45 87 0.00% 46 96 0.00% 47 120 0.00% 48 106 0.00% 49 150 0.00% 50 151 0.00% 51 171 0.00% 52 205 0.00% 53 252 0.00% 54 297 0.00% 55 285 0.00% 56 300 0.00% 57 342 0.00% 58 390 0.00% 59 462 0.00% 60 528 0.00% 61 647 0.00% 62 662 0.00% 63 723 0.00% 64 917 0.00% 65 1005 0.00% 66 1123 0.00% 67 1260 0.00% 68 1560 0.00% 69 2410 0.00% 70 2285 0.00% 71 2155 0.00% 72 2452 0.00% 73 2844 0.01% 74 3066 0.01% 75 3439 0.01% 76 3907 0.01% 77 4283 0.01% 78 4907 0.01% 79 5471 0.01% 80 6241 0.01% 81 7128 0.01% 82 8351 0.02% 83 9445 0.02% 84 13974 0.03% 85 14903 0.03% 86 16043 0.03% 87 17432 0.03% 88 18672 0.03% 89 20262 0.04% 90 22026 0.04% 91 23846 0.04% 92 26063 0.05% 93 28387 0.05% 94 31229 0.06% 95 33865 0.06% 96 36440 0.07% 97 39599 0.07% 98 41747 0.08% 99 44176 0.08% 100 47897 0.09% 101 50346 0.09% 102 54545 0.10% 103 58129 0.11% 104 62462 0.12% 105 66922 0.12% 106 71282 0.13% 107 74731 0.14% 108 77942 0.15% 109 81968 0.15% 110 84525 0.16% 111 88956 0.17% 112 93893 0.18% 113 97865 0.18% 114 102712 0.19% 115 108318 0.20% 116 113069 0.21% 117 118060 0.22% 118 123536 0.23% 119 126680 0.24% 120 130367 0.24% 121 134890 0.25% 122 139335 0.26% 123 144136 0.27% 124 152066 0.28% 125 158314 0.30% 126 163405 0.31% 127 170096 0.32% 128 175421 0.33% 129 182217 0.34% 130 188043 0.35% 131 192665 0.36% 132 200826 0.37% 133 209943 0.39% 134 215679 0.40% 135 224818 0.42% 136 236788 0.44% 137 247719 0.46% 138 262137 0.49% 139 276694 0.52% 140 292972 0.55% 141 313535 0.59% 142 338920 0.63% 143 371700 0.69% 144 422421 0.79% 145 501399 0.94% 146 631280 1.18% 147 892249 1.67% 148 1568959 2.93% 149 8949254 16.71% 150 33259960 62.10% 53561641 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=40 prefix-density=0.16 prefix-fanout=2.5 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=375.08 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=21.4 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=27.11 fanout-score-rank=9 prefix-density=0.39 prefix-fanout=9.7 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCT criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=219.59 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=25.4 sequence=GAAGAAGAAGAAA SRR4237644 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:36:15 Started mapping on | Feb 12 20:36:15 Finished on | Feb 12 20:40:14 Mapping speed, Million of reads per hour | 806.79 Number of input reads | 53561641 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 51706318 Uniquely mapped reads % | 96.54% Average mapped length | 291.77 Number of splices: Total | 42212005 Number of splices: Annotated (sjdb) | 41383063 Number of splices: GT/AG | 41550252 Number of splices: GC/AG | 506812 Number of splices: AT/AC | 41451 Number of splices: Non-canonical | 113490 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1095741 % of reads mapped to multiple loci | 2.05% Number of reads mapped to too many loci | 84066 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.23% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 808064 808064 808064 N_multimapping 1095741 1095741 1095741 N_noFeature 1646362 50948794 2035780 N_ambiguous 599398 3320 229263 UnstrandedReadsAssigned:49460558 PositiveStrandReadsAssigned:754204 NegativeStrandReadsAssigned:49441275 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237644 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237644-trimmed-pair1.fastq SRR4237644-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 53,561,641 reads, 49,257,239 reads pseudoaligned [quant] estimated average fragment length: 224.235 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52401 SRR4237644.ke.tsv 34699 SRR4237644.se.tsv 87100 total ==> SRR4237644.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.76 1317 14.8127 Potri.005G024800.1.v4.1 1035 811.765 260 6.46545 Potri.004G059700.1.v4.1 961 737.789 76 2.0794 Potri.007G009000.2.v4.1 1416 1192.76 0 0 Potri.003G141000.2.v4.1 2943 2719.76 714.112 5.30018 Potri.016G087400.1.v4.1 270 84.7813 7378.63 1756.84 Potri.015G069301.1.v4.1 564 343.457 0 0 Potri.010G195200.1.v4.1 1773 1549.76 310 4.03787 Potri.012G127500.1.v4.1 977 753.77 14156 379.103 ==> SRR4237644.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7534 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 814 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 935 Potri.001G452600.v4.1 5 SRR4237644 completed mapping pipeline successfully