Starting /dee2/code/volunteer_pipeline.sh SRR4237645 current disk space = 3050946289664 free memory = 1579730324 SRR4237645 SRAfilesize 422326f3ebf93709d49f4582dd3ac01f SRR4237645.sra SRR4237645.sra file validated SRR4237645 is paired end SRR4237645 is conventional basespace SRR4237645 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237645_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.81725 33.0 31.0 34.0 2.0 34.0 2 31.6525 33.0 30.0 34.0 27.0 34.0 3 32.1045 33.0 32.0 34.0 27.0 34.0 4 32.5095 33.0 33.0 34.0 31.0 34.0 5 32.75575 33.0 33.0 34.0 32.0 34.0 6 36.47675 38.0 37.0 38.0 34.0 38.0 7 36.948 38.0 38.0 38.0 35.0 38.0 8 36.98475 38.0 38.0 38.0 36.0 38.0 9 36.8855 38.0 38.0 38.0 35.0 38.0 10-14 37.081500000000005 38.0 38.0 38.0 35.8 38.0 15-19 36.90755 38.0 38.0 38.0 35.2 38.0 20-24 36.9884 38.0 38.0 38.0 36.0 38.0 25-29 37.0053 38.0 38.0 38.0 35.8 38.0 30-34 36.82985 38.0 38.0 38.0 35.0 38.0 35-39 36.629149999999996 38.0 38.0 38.0 34.6 38.0 40-44 36.66375000000001 38.0 38.0 38.0 34.4 38.0 45-49 36.7799 38.0 38.0 38.0 34.8 38.0 50-54 36.49665 38.0 37.8 38.0 33.8 38.0 55-59 34.724199999999996 37.6 34.0 38.0 27.2 38.0 60-64 35.077450000000006 37.8 34.8 38.0 28.8 38.0 65-69 36.436600000000006 38.0 37.8 38.0 33.4 38.0 70-74 35.908300000000004 38.0 36.6 38.0 30.8 38.0 75-79 36.3214 38.0 37.8 38.0 33.8 38.0 80-84 33.39854999999999 37.4 30.0 38.0 21.2 38.0 85-89 35.3033 37.8 36.0 38.0 28.8 38.0 90-94 35.743849999999995 38.0 36.6 38.0 30.8 38.0 95-99 36.094950000000004 38.0 37.0 38.0 33.0 38.0 100-104 36.0328 38.0 37.0 38.0 33.0 38.0 105-109 35.92895 38.0 37.0 38.0 32.4 38.0 110-114 35.6454 38.0 36.8 38.0 30.6 38.0 115-119 35.6498 38.0 37.0 38.0 31.0 38.0 120-124 35.5777 38.0 36.8 38.0 31.0 38.0 125-129 35.3858 38.0 36.0 38.0 30.2 38.0 130-134 34.0129 37.8 33.8 38.0 24.4 38.0 135-139 33.684599999999996 38.0 34.0 38.0 21.2 38.0 140-144 34.3396 38.0 34.8 38.0 25.2 38.0 145-149 32.43560000000001 37.6 31.6 38.0 18.2 38.0 150 27.0615 33.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 2.0 14 2.0 15 1.0 16 1.0 17 6.0 18 2.0 19 3.0 20 0.0 21 6.0 22 11.0 23 9.0 24 18.0 25 21.0 26 31.0 27 42.0 28 51.0 29 63.0 30 95.0 31 99.0 32 127.0 33 168.0 34 274.0 35 402.0 36 826.0 37 1738.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.93023255813954 13.426356589147288 8.434108527131782 37.2093023255814 2 22.55 14.549999999999999 36.05 26.85 3 18.475 20.825 26.1 34.599999999999994 4 21.875 30.099999999999998 23.549999999999997 24.474999999999998 5 22.875 34.300000000000004 22.35 20.474999999999998 6 17.675 36.8 24.8 20.724999999999998 7 13.850000000000001 26.6 41.425 18.125 8 17.125 25.15 32.1 25.624999999999996 9 16.05 23.325000000000003 34.949999999999996 25.674999999999997 10-14 19.835 31.019999999999996 26.19 22.955000000000002 15-19 19.64 29.595 27.355 23.41 20-24 20.275000000000002 29.470000000000002 27.26 22.994999999999997 25-29 19.74 29.354999999999997 27.425 23.48 30-34 19.945 29.075 27.73 23.25 35-39 19.945 29.42 27.224999999999998 23.41 40-44 20.235 29.205 27.395000000000003 23.165 45-49 19.62 29.32 27.339999999999996 23.72 50-54 19.335 29.32 27.450000000000003 23.895 55-59 19.915 29.904999999999998 26.834999999999997 23.345 60-64 19.919999999999998 28.835 27.345000000000002 23.9 65-69 19.86 29.7 27.310000000000002 23.13 70-74 19.77 29.005 28.075 23.150000000000002 75-79 19.28 29.035 27.76 23.925 80-84 19.91 28.475 27.800000000000004 23.815 85-89 19.845 28.96 27.57 23.625 90-94 20.265 28.999999999999996 26.884999999999998 23.849999999999998 95-99 20.1 28.455000000000002 27.279999999999998 24.165 100-104 19.975 29.110000000000003 27.49 23.425 105-109 20.080000000000002 28.689999999999998 27.339999999999996 23.89 110-114 19.79 28.175 28.175 23.86 115-119 20.424999999999997 28.060000000000002 27.750000000000004 23.765 120-124 21.455 28.799999999999997 26.75 22.994999999999997 125-129 20.785 29.015 27.134999999999998 23.064999999999998 130-134 20.365 29.15 27.134999999999998 23.35 135-139 20.765 29.285 26.625 23.325000000000003 140-144 21.240000000000002 28.76 26.605 23.395 145-149 20.84 28.62 27.195000000000004 23.345 150 20.349999999999998 28.925 26.525 24.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 2.5 22 4.5 23 3.5 24 2.0 25 5.5 26 7.0 27 7.0 28 7.5 29 13.5 30 25.5 31 37.0 32 45.5 33 47.0 34 60.5 35 86.5 36 104.5 37 114.0 38 144.0 39 170.5 40 180.5 41 207.5 42 241.5 43 257.5 44 276.0 45 271.5 46 263.0 47 254.5 48 217.0 49 190.5 50 173.5 51 144.5 52 117.5 53 95.5 54 64.5 55 46.0 56 34.0 57 19.5 58 10.5 59 10.0 60 8.0 61 5.5 62 4.0 63 3.5 64 2.5 65 1.5 66 2.0 67 2.5 68 1.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 19.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.11249999999999999 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.425 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.9249999999999998 0.0 0.0 0.0 0.0 122-123 2.2125000000000004 0.0 0.0 0.0 0.0 124-125 2.55 0.0 0.0 0.0 0.0 126-127 2.8875 0.0 0.0 0.0 0.0 128-129 3.1875 0.0 0.0 0.0 0.0 130-131 3.4625 0.0 0.0 0.0 0.0 132-133 3.6625 0.0 0.0 0.0 0.0 134-135 4.025 0.0 0.0 0.0 0.0 136-137 4.362500000000001 0.0 0.0 0.0 0.0 138 4.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTTTGT 10 0.0070081474 143.7625 6 >>END_MODULE SRR4237645 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237645_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2015 33.0 33.0 34.0 31.0 34.0 2 32.428 33.0 33.0 34.0 31.0 34.0 3 32.37675 33.0 33.0 34.0 31.0 34.0 4 32.0715 33.0 33.0 34.0 31.0 34.0 5 32.33575 33.0 33.0 34.0 31.0 34.0 6 36.26 38.0 38.0 38.0 33.0 38.0 7 36.3775 38.0 38.0 38.0 34.0 38.0 8 36.38925 38.0 38.0 38.0 34.0 38.0 9 36.32125 38.0 38.0 38.0 33.0 38.0 10-14 36.32555 38.0 38.0 38.0 33.8 38.0 15-19 36.22535 38.0 38.0 38.0 33.0 38.0 20-24 36.244600000000005 38.0 38.0 38.0 33.6 38.0 25-29 35.62185 38.0 37.0 38.0 29.4 38.0 30-34 36.16715 38.0 38.0 38.0 33.2 38.0 35-39 35.47825 38.0 36.4 38.0 29.8 38.0 40-44 35.83030000000001 38.0 37.2 38.0 30.8 38.0 45-49 36.0551 38.0 38.0 38.0 32.8 38.0 50-54 36.07845 38.0 38.0 38.0 33.0 38.0 55-59 35.9973 38.0 37.8 38.0 32.2 38.0 60-64 35.896699999999996 38.0 37.4 38.0 31.8 38.0 65-69 35.8641 38.0 37.2 38.0 31.4 38.0 70-74 35.7542 38.0 37.0 38.0 30.8 38.0 75-79 35.23995 38.0 36.8 38.0 28.2 38.0 80-84 35.40635 38.0 37.0 38.0 29.0 38.0 85-89 35.28015 38.0 36.8 38.0 28.4 38.0 90-94 35.3484 38.0 36.8 38.0 28.8 38.0 95-99 35.2403 38.0 37.0 38.0 28.6 38.0 100-104 34.903 38.0 36.6 38.0 26.8 38.0 105-109 32.201350000000005 36.8 28.2 38.0 19.4 38.0 110-114 34.63415 38.0 35.6 38.0 26.0 38.0 115-119 34.53679999999999 38.0 35.6 38.0 24.4 38.0 120-124 34.1332 38.0 35.0 38.0 22.8 38.0 125-129 33.963100000000004 38.0 34.6 38.0 21.8 38.0 130-134 33.46704999999999 38.0 33.0 38.0 18.6 38.0 135-139 32.97305 38.0 33.0 38.0 14.2 38.0 140-144 31.917250000000003 38.0 32.6 38.0 12.2 38.0 145-149 30.9834 38.0 32.2 38.0 2.0 38.0 150 23.054 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 4.0 4 1.0 5 4.0 6 1.0 7 1.0 8 2.0 9 3.0 10 3.0 11 2.0 12 1.0 13 9.0 14 4.0 15 10.0 16 7.0 17 8.0 18 9.0 19 11.0 20 21.0 21 17.0 22 17.0 23 29.0 24 32.0 25 37.0 26 42.0 27 42.0 28 69.0 29 71.0 30 87.0 31 115.0 32 115.0 33 152.0 34 213.0 35 334.0 36 661.0 37 1855.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.65 22.525000000000002 12.425 26.400000000000002 2 29.5 23.849999999999998 31.275 15.375 3 21.099999999999998 28.625 30.825000000000003 19.45 4 24.65 35.25 22.775000000000002 17.325 5 24.349999999999998 36.875 22.025 16.75 6 19.875 38.4 24.825 16.900000000000002 7 18.95 20.525 41.325 19.2 8 21.025 24.325 29.375 25.275 9 22.075 24.2 29.475 24.25 10-14 23.71 28.360000000000003 27.310000000000002 20.62 15-19 23.875 27.785 27.994999999999997 20.345 20-24 22.925 28.199999999999996 28.235 20.64 25-29 23.26 27.900000000000002 28.325 20.515 30-34 23.200000000000003 27.650000000000002 28.46 20.69 35-39 22.830000000000002 28.155 28.15 20.865000000000002 40-44 22.98 28.335 28.565 20.119999999999997 45-49 23.25 28.04 28.249999999999996 20.46 50-54 23.474999999999998 27.915 28.57 20.04 55-59 23.82 27.279999999999998 28.525 20.375 60-64 23.485 27.91 28.54 20.064999999999998 65-69 22.915 27.375 29.310000000000002 20.4 70-74 23.615 27.605 28.599999999999998 20.18 75-79 23.549999999999997 27.605 28.865000000000002 19.98 80-84 23.455000000000002 27.235 28.999999999999996 20.31 85-89 23.52 27.76 28.01 20.71 90-94 23.335 27.815 28.76 20.09 95-99 23.45 28.365000000000002 28.04 20.145 100-104 23.64 27.48 28.575 20.305 105-109 23.78 27.315 28.26 20.645 110-114 23.7 27.715 28.689999999999998 19.895 115-119 24.075 27.284999999999997 28.365000000000002 20.275000000000002 120-124 23.845 27.735 28.1 20.32 125-129 23.84 27.755000000000003 28.325 20.080000000000002 130-134 24.32 28.249999999999996 27.715 19.715 135-139 24.044999999999998 27.47 28.27 20.215 140-144 24.85 27.605 27.83 19.715 145-149 24.665 27.97 27.525 19.84 150 24.7 26.55 28.475 20.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 3.5 24 6.5 25 4.0 26 4.0 27 7.5 28 12.5 29 12.5 30 11.5 31 17.0 32 27.5 33 33.0 34 42.0 35 68.5 36 90.5 37 106.5 38 137.5 39 159.5 40 210.5 41 248.0 42 260.5 43 280.0 44 269.5 45 284.5 46 297.0 47 254.0 48 219.5 49 200.5 50 166.5 51 139.5 52 111.5 53 90.0 54 71.0 55 46.0 56 27.5 57 20.0 58 18.5 59 12.0 60 4.0 61 4.0 62 4.0 63 4.5 64 4.0 65 1.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.025 0.0 0.0 0.025 0.0 90-91 0.05 0.0 0.0 0.025 0.0 92-93 0.075 0.0 0.0 0.025 0.0 94-95 0.075 0.0 0.0 0.025 0.0 96-97 0.1375 0.0 0.0 0.025 0.0 98-99 0.2625 0.0 0.0 0.025 0.0 100-101 0.375 0.0 0.0 0.025 0.0 102-103 0.44999999999999996 0.0 0.0 0.025 0.0 104-105 0.5125 0.0 0.0 0.025 0.0 106-107 0.6000000000000001 0.0 0.0 0.025 0.0 108-109 0.6625000000000001 0.0 0.0 0.025 0.0 110-111 0.7875000000000001 0.0 0.0 0.025 0.0 112-113 0.9375 0.0 0.0 0.025 0.0 114-115 1.1125 0.0 0.0 0.025 0.0 116-117 1.35 0.0 0.0 0.025 0.0 118-119 1.575 0.0 0.0 0.025 0.0 120-121 1.85 0.0 0.0 0.025 0.0 122-123 2.1624999999999996 0.0 0.0 0.025 0.0 124-125 2.55 0.0 0.0 0.025 0.0 126-127 2.9000000000000004 0.0 0.0 0.025 0.0 128-129 3.2125 0.0 0.0 0.025 0.0 130-131 3.4875 0.0 0.0 0.025 0.0 132-133 3.7 0.0 0.0 0.025 0.0 134-135 4.0875 0.0 0.0 0.025 0.0 136-137 4.4375 0.0 0.0 0.025 0.0 138 4.625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTGGA 10 0.006973645 144.0 5 AAGAGTG 10 0.006973645 144.0 3 CAATCCA 10 0.006973645 144.0 4 GAAGAGT 10 0.006973645 144.0 2 ATTCTTA 10 0.006973645 144.0 5 AGAGTGG 30 0.0018473949 72.0 4 >>END_MODULE Read 2899634 spots for SRR4237645.sra Written 2899634 spots for SRR4237645.sra Read 2899634 spots for SRR4237645.sra Written 2899634 spots for SRR4237645.sra Read 2899634 spots for SRR4237645.sra Written 2899634 spots for SRR4237645.sra Read 2899634 spots for SRR4237645.sra Written 2899634 spots for SRR4237645.sra Read 2899634 spots for SRR4237645.sra Written 2899634 spots for SRR4237645.sra Read 2899634 spots for SRR4237645.sra Written 2899634 spots for SRR4237645.sra Read 2899634 spots for SRR4237645.sra Written 2899634 spots for SRR4237645.sra Read 2899634 spots for SRR4237645.sra Written 2899634 spots for SRR4237645.sra Read 2899634 spots for SRR4237645.sra Written 2899634 spots for SRR4237645.sra Read 2899634 spots for SRR4237645.sra Written 2899634 spots for SRR4237645.sra Read 2899634 spots for SRR4237645.sra Written 2899634 spots for SRR4237645.sra Read 2899634 spots for SRR4237645.sra Written 2899634 spots for SRR4237645.sra Read 2899634 spots for SRR4237645.sra Written 2899634 spots for SRR4237645.sra Read 2899634 spots for SRR4237645.sra Written 2899634 spots for SRR4237645.sra Read 2899634 spots for SRR4237645.sra Written 2899634 spots for SRR4237645.sra Read 2899634 spots for SRR4237645.sra Written 2899634 spots for SRR4237645.sra Read 2899634 spots for SRR4237645.sra Written 2899634 spots for SRR4237645.sra Read 2899634 spots for SRR4237645.sra Written 2899634 spots for SRR4237645.sra Read 2899644 spots for SRR4237645.sra Written 2899644 spots for SRR4237645.sra Read 2899634 spots for SRR4237645.sra Written 2899634 spots for SRR4237645.sra SRR ids: ['SRR4237645.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dym_b1om SRR4237645.sra spots: 57992690 blocks: [[1, 2899634], [2899635, 5799268], [5799269, 8698902], [8698903, 11598536], [11598537, 14498170], [14498171, 17397804], [17397805, 20297438], [20297439, 23197072], [23197073, 26096706], [26096707, 28996340], [28996341, 31895974], [31895975, 34795608], [34795609, 37695242], [37695243, 40594876], [40594877, 43494510], [43494511, 46394144], [46394145, 49293778], [49293779, 52193412], [52193413, 55093046], [55093047, 57992690]] SRR4237645 file size 19516852 SRR4237645 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237645 SRR4237645_1.fastq SRR4237645_2.fastq Input file: SRR4237645_1.fastq Paired file: SRR4237645_2.fastq trimmed: SRR4237645-trimmed-pair1.fastq, SRR4237645-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:41:22 2025 >> started Wed Feb 12 20:42:23 2025 >> done (61.549s) 57992690 read pairs processed; of these: 80732 ( 0.14%) short read pairs filtered out after trimming by size control 111528 ( 0.19%) empty read pairs filtered out after trimming by size control 57800430 (99.67%) read pairs available; of these: 23171241 (40.09%) trimmed read pairs available after processing 34629189 (59.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 3 0.00% 20 6 0.00% 21 9 0.00% 22 9 0.00% 23 10 0.00% 24 7 0.00% 25 13 0.00% 26 19 0.00% 27 12 0.00% 28 16 0.00% 29 16 0.00% 30 19 0.00% 31 20 0.00% 32 19 0.00% 33 30 0.00% 34 31 0.00% 35 20 0.00% 36 39 0.00% 37 36 0.00% 38 35 0.00% 39 60 0.00% 40 52 0.00% 41 43 0.00% 42 63 0.00% 43 78 0.00% 44 84 0.00% 45 103 0.00% 46 88 0.00% 47 112 0.00% 48 98 0.00% 49 127 0.00% 50 122 0.00% 51 177 0.00% 52 180 0.00% 53 193 0.00% 54 240 0.00% 55 243 0.00% 56 271 0.00% 57 274 0.00% 58 330 0.00% 59 379 0.00% 60 418 0.00% 61 451 0.00% 62 538 0.00% 63 608 0.00% 64 625 0.00% 65 733 0.00% 66 811 0.00% 67 928 0.00% 68 1152 0.00% 69 1484 0.00% 70 1470 0.00% 71 1491 0.00% 72 1784 0.00% 73 1983 0.00% 74 2226 0.00% 75 2479 0.00% 76 2801 0.00% 77 3038 0.01% 78 3399 0.01% 79 3996 0.01% 80 4489 0.01% 81 5128 0.01% 82 5802 0.01% 83 7257 0.01% 84 12959 0.02% 85 13552 0.02% 86 14389 0.02% 87 14873 0.03% 88 15835 0.03% 89 16659 0.03% 90 17695 0.03% 91 19009 0.03% 92 20645 0.04% 93 21928 0.04% 94 23856 0.04% 95 25618 0.04% 96 27122 0.05% 97 28714 0.05% 98 30979 0.05% 99 32542 0.06% 100 35273 0.06% 101 37605 0.07% 102 40044 0.07% 103 42913 0.07% 104 45795 0.08% 105 49048 0.08% 106 52306 0.09% 107 54758 0.09% 108 57361 0.10% 109 60755 0.11% 110 63419 0.11% 111 67462 0.12% 112 71115 0.12% 113 74897 0.13% 114 78982 0.14% 115 83923 0.15% 116 86907 0.15% 117 91642 0.16% 118 95808 0.17% 119 97963 0.17% 120 102703 0.18% 121 107743 0.19% 122 111724 0.19% 123 116592 0.20% 124 123122 0.21% 125 129982 0.22% 126 134562 0.23% 127 141355 0.24% 128 147543 0.26% 129 155443 0.27% 130 162184 0.28% 131 169245 0.29% 132 177314 0.31% 133 187412 0.32% 134 199197 0.34% 135 211318 0.37% 136 226672 0.39% 137 242506 0.42% 138 261469 0.45% 139 279739 0.48% 140 304526 0.53% 141 335283 0.58% 142 375214 0.65% 143 426475 0.74% 144 500221 0.87% 145 613845 1.06% 146 795101 1.38% 147 1159128 2.01% 148 2141795 3.71% 149 11448690 19.81% 150 34629189 59.91% 57800430 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=37 prefix-density=0.19 prefix-fanout=2.7 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=255.77 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=17.5 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=40 prefix-density=0.19 prefix-fanout=2.3 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=40 fanout-score=154.21 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=15.3 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAAGCT SRR4237645 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:43:08 Started mapping on | Feb 12 20:43:09 Finished on | Feb 12 20:48:49 Mapping speed, Million of reads per hour | 612.00 Number of input reads | 57800430 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 55517858 Uniquely mapped reads % | 96.05% Average mapped length | 293.32 Number of splices: Total | 49278097 Number of splices: Annotated (sjdb) | 48439229 Number of splices: GT/AG | 48578991 Number of splices: GC/AG | 552699 Number of splices: AT/AC | 44698 Number of splices: Non-canonical | 101709 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 920039 % of reads mapped to multiple loci | 1.59% Number of reads mapped to too many loci | 44310 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.26% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1444597 1444597 1444597 N_multimapping 920039 920039 920039 N_noFeature 1583299 54732500 1991925 N_ambiguous 622604 3374 243355 UnstrandedReadsAssigned:53311955 PositiveStrandReadsAssigned:781984 NegativeStrandReadsAssigned:53282578 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237645 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237645-trimmed-pair1.fastq SRR4237645-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 57,800,430 reads, 52,986,237 reads pseudoaligned [quant] estimated average fragment length: 244.481 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52401 SRR4237645.ke.tsv 34699 SRR4237645.se.tsv 87100 total ==> SRR4237645.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.52 1216 13.8232 Potri.005G024800.1.v4.1 1035 791.519 133 3.38959 Potri.004G059700.1.v4.1 961 717.556 16 0.449801 Potri.007G009000.2.v4.1 1416 1172.52 0 0 Potri.003G141000.2.v4.1 2943 2699.52 855.148 6.39016 Potri.016G087400.1.v4.1 270 77.1672 4628.35 1209.9 Potri.015G069301.1.v4.1 564 324.737 0 0 Potri.010G195200.1.v4.1 1773 1529.52 149 1.96512 Potri.012G127500.1.v4.1 977 733.544 9148 251.569 ==> SRR4237645.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7180 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 731 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR4237645 completed mapping pipeline successfully