Starting /dee2/code/volunteer_pipeline.sh SRR4237646 current disk space = 3050934513664 free memory = 1579812028 SRR4237646 SRAfilesize a49e4af676377b4126e3afdf2e75dd33 SRR4237646.sra SRR4237646.sra file validated SRR4237646 is paired end SRR4237646 is conventional basespace SRR4237646 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237646_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.01025 34.0 33.0 34.0 2.0 34.0 2 32.7225 34.0 33.0 34.0 28.0 34.0 3 32.9245 34.0 33.0 34.0 31.0 34.0 4 33.11775 34.0 33.0 34.0 32.0 34.0 5 33.2055 34.0 33.0 34.0 33.0 34.0 6 37.0285 38.0 37.0 38.0 36.0 38.0 7 37.39275 38.0 38.0 38.0 37.0 38.0 8 37.50375 38.0 38.0 38.0 37.0 38.0 9 37.453 38.0 38.0 38.0 37.0 38.0 10-14 37.48825 38.0 38.0 38.0 37.6 38.0 15-19 37.495400000000004 38.0 38.0 38.0 37.6 38.0 20-24 37.20765 38.0 38.0 38.0 36.6 38.0 25-29 37.438449999999996 38.0 38.0 38.0 37.6 38.0 30-34 37.2463 38.0 38.0 38.0 36.8 38.0 35-39 37.29105 38.0 38.0 38.0 37.0 38.0 40-44 37.30535 38.0 38.0 38.0 37.0 38.0 45-49 37.108200000000004 38.0 38.0 38.0 36.2 38.0 50-54 37.175149999999995 38.0 38.0 38.0 36.6 38.0 55-59 37.153499999999994 38.0 38.0 38.0 36.4 38.0 60-64 37.13185 38.0 38.0 38.0 36.2 38.0 65-69 37.12415 38.0 38.0 38.0 36.2 38.0 70-74 37.1114 38.0 38.0 38.0 36.4 38.0 75-79 37.08005 38.0 38.0 38.0 36.2 38.0 80-84 37.0427 38.0 38.0 38.0 36.0 38.0 85-89 36.962199999999996 38.0 38.0 38.0 36.0 38.0 90-94 36.83985 38.0 38.0 38.0 35.2 38.0 95-99 36.87564999999999 38.0 38.0 38.0 36.0 38.0 100-104 36.79350000000001 38.0 38.0 38.0 35.2 38.0 105-109 36.6626 38.0 38.0 38.0 34.6 38.0 110-114 36.588049999999996 38.0 38.0 38.0 34.6 38.0 115-119 36.38565 38.0 38.0 38.0 34.0 38.0 120-124 36.3776 38.0 38.0 38.0 34.0 38.0 125-129 36.14705 38.0 38.0 38.0 33.4 38.0 130-134 35.9625 38.0 37.8 38.0 33.2 38.0 135-139 35.820949999999996 38.0 37.2 38.0 32.6 38.0 140-144 35.4369 38.0 36.2 38.0 31.4 38.0 145-149 35.02475 38.0 36.0 38.0 31.0 38.0 150 29.083 33.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 2.0 17 0.0 18 2.0 19 3.0 20 1.0 21 4.0 22 5.0 23 6.0 24 5.0 25 17.0 26 20.0 27 20.0 28 27.0 29 28.0 30 28.0 31 35.0 32 66.0 33 85.0 34 121.0 35 196.0 36 482.0 37 2844.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.41306168015629 12.140664247837007 8.037957019257606 39.40831705274909 2 22.0 15.25 36.075 26.674999999999997 3 19.875 20.349999999999998 25.7 34.075 4 23.125 30.3 21.675 24.9 5 21.7 33.375 24.775 20.150000000000002 6 17.75 34.849999999999994 24.825 22.575 7 14.2 26.5 41.975 17.325 8 16.75 23.925 32.875 26.450000000000003 9 17.7 24.125 33.4 24.775 10-14 19.27 29.87 27.105 23.755000000000003 15-19 19.575 28.895 27.79 23.74 20-24 19.81 28.89 27.82 23.48 25-29 19.455 29.4 27.605 23.54 30-34 19.575 29.294999999999998 27.38 23.75 35-39 20.544999999999998 28.985 27.060000000000002 23.41 40-44 19.755 29.080000000000002 27.055 24.11 45-49 20.69 28.29 27.465 23.555 50-54 20.235 28.694999999999997 27.07 24.0 55-59 19.950000000000003 29.349999999999998 27.3 23.400000000000002 60-64 19.805 28.810000000000002 27.79 23.595 65-69 20.005 28.715000000000003 27.355 23.925 70-74 19.830000000000002 28.610000000000003 27.894999999999996 23.665 75-79 19.935 28.465 27.775 23.825 80-84 19.860993049652485 28.10140507025351 27.9813990699535 24.056202810140505 85-89 20.79 28.499999999999996 27.534999999999997 23.175 90-94 20.035 28.895 26.99 24.08 95-99 20.22 28.7 27.57 23.51 100-104 20.055 28.535 27.51 23.9 105-109 20.445 28.54 27.639999999999997 23.375 110-114 20.53 29.115000000000002 27.125 23.23 115-119 21.16 28.345 27.139999999999997 23.355 120-124 20.175 28.110000000000003 27.865000000000002 23.849999999999998 125-129 20.47 27.99 27.655 23.885 130-134 20.31 28.685 26.97 24.035 135-139 20.715 28.125 27.200000000000003 23.96 140-144 21.13 28.26 27.235 23.375 145-149 20.54 28.549999999999997 26.685 24.224999999999998 150 20.075000000000003 28.999999999999996 28.025 22.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 1.0 23 1.5 24 2.0 25 2.0 26 4.0 27 8.5 28 9.5 29 10.0 30 13.0 31 21.0 32 28.5 33 49.0 34 64.0 35 76.5 36 93.5 37 105.5 38 133.0 39 174.0 40 194.5 41 215.5 42 248.0 43 254.5 44 262.5 45 265.5 46 257.5 47 257.0 48 244.0 49 215.5 50 179.0 51 145.0 52 116.5 53 92.5 54 77.0 55 56.0 56 34.0 57 24.0 58 18.5 59 14.0 60 12.5 61 5.5 62 2.0 63 1.5 64 1.0 65 1.5 66 1.5 67 0.5 68 0.5 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.424999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.9875 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.625 0.0 0.0 0.0 0.0 118-119 1.8125 0.0 0.0 0.0 0.0 120-121 2.0999999999999996 0.0 0.0 0.0 0.0 122-123 2.2750000000000004 0.0 0.0 0.0 0.0 124-125 2.5625 0.0 0.0 0.0 0.0 126-127 2.95 0.0 0.0 0.0 0.0 128-129 3.2750000000000004 0.0 0.0 0.0 0.0 130-131 3.5875 0.0 0.0 0.0 0.0 132-133 3.9000000000000004 0.0 0.0 0.0 0.0 134-135 4.3625 0.0 0.0 0.0 0.0 136-137 4.7 0.0 0.0 0.0 0.0 138 4.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCCCA 10 0.0069899606 143.8875 8 TTGCCTC 10 0.0069899606 143.8875 8 TTTTTTT 95 0.0077067935 10.602237 40-44 >>END_MODULE SRR4237646 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237646_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71575 33.0 33.0 34.0 32.0 34.0 2 32.78675 33.0 33.0 34.0 32.0 34.0 3 32.80075 34.0 33.0 34.0 32.0 34.0 4 32.7025 34.0 33.0 34.0 32.0 34.0 5 32.834 34.0 33.0 34.0 32.0 34.0 6 36.8895 38.0 38.0 38.0 36.0 38.0 7 37.0585 38.0 38.0 38.0 36.0 38.0 8 36.94875 38.0 38.0 38.0 36.0 38.0 9 36.955 38.0 38.0 38.0 36.0 38.0 10-14 36.874300000000005 38.0 38.0 38.0 36.0 38.0 15-19 36.83955 38.0 38.0 38.0 36.0 38.0 20-24 36.92625 38.0 38.0 38.0 36.0 38.0 25-29 36.89265 38.0 38.0 38.0 36.0 38.0 30-34 36.886649999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.840199999999996 38.0 38.0 38.0 36.0 38.0 40-44 36.512649999999994 38.0 38.0 38.0 34.0 38.0 45-49 36.832800000000006 38.0 38.0 38.0 36.0 38.0 50-54 36.84185 38.0 38.0 38.0 36.0 38.0 55-59 36.775800000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.7603 38.0 38.0 38.0 35.8 38.0 65-69 36.7213 38.0 38.0 38.0 36.0 38.0 70-74 36.607150000000004 38.0 38.0 38.0 35.4 38.0 75-79 36.5857 38.0 38.0 38.0 35.2 38.0 80-84 36.529250000000005 38.0 38.0 38.0 34.8 38.0 85-89 36.46855000000001 38.0 38.0 38.0 34.6 38.0 90-94 36.415200000000006 38.0 38.0 38.0 35.0 38.0 95-99 36.295 38.0 38.0 38.0 34.2 38.0 100-104 36.237 38.0 38.0 38.0 34.0 38.0 105-109 36.166700000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.0871 38.0 38.0 38.0 33.8 38.0 115-119 35.9423 38.0 38.0 38.0 33.6 38.0 120-124 35.7064 38.0 38.0 38.0 32.4 38.0 125-129 35.6618 38.0 37.8 38.0 32.6 38.0 130-134 35.357 38.0 37.0 38.0 31.0 38.0 135-139 35.22435 38.0 36.8 38.0 31.0 38.0 140-144 34.85955 38.0 36.2 38.0 29.8 38.0 145-149 34.145450000000004 38.0 35.8 38.0 26.4 38.0 150 27.686 33.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 6.0 4 2.0 5 2.0 6 3.0 7 0.0 8 1.0 9 2.0 10 0.0 11 2.0 12 2.0 13 6.0 14 4.0 15 3.0 16 6.0 17 4.0 18 5.0 19 4.0 20 4.0 21 7.0 22 11.0 23 15.0 24 9.0 25 16.0 26 25.0 27 24.0 28 28.0 29 30.0 30 50.0 31 52.0 32 57.0 33 90.0 34 110.0 35 229.0 36 388.0 37 2796.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.349999999999994 19.85 12.675 26.125 2 29.475 24.85 31.0 14.674999999999999 3 21.65 28.799999999999997 29.9 19.650000000000002 4 24.349999999999998 35.6 22.1 17.95 5 24.349999999999998 38.725 21.825 15.1 6 20.200000000000003 39.675 22.475 17.65 7 21.55 20.4 39.4 18.65 8 21.05 25.85 29.075 24.025 9 22.525000000000002 24.4 30.025000000000002 23.05 10-14 23.515 28.415000000000003 27.265 20.805 15-19 23.599999999999998 27.51 27.875 21.015 20-24 23.044999999999998 28.485 27.750000000000004 20.72 25-29 23.294999999999998 28.249999999999996 28.02 20.435 30-34 22.93 27.96 28.03 21.08 35-39 23.599999999999998 27.845 28.084999999999997 20.47 40-44 23.375 27.96 28.155 20.51 45-49 23.330000000000002 27.900000000000002 28.625 20.145 50-54 23.27 27.915 28.115000000000002 20.7 55-59 23.485 27.725 28.325 20.465 60-64 23.445 27.375 29.244999999999997 19.935 65-69 23.73 27.639999999999997 28.325 20.305 70-74 23.405 27.435 28.965000000000003 20.195 75-79 23.36 28.155 28.134999999999998 20.349999999999998 80-84 23.515 27.855 28.560000000000002 20.07 85-89 23.735 28.084999999999997 28.1 20.080000000000002 90-94 23.244999999999997 27.800000000000004 28.485 20.47 95-99 23.369999999999997 27.37 28.74 20.52 100-104 23.96 27.800000000000004 27.900000000000002 20.34 105-109 23.375 27.250000000000004 28.945 20.43 110-114 23.66 27.71 28.535 20.095 115-119 24.125 27.79 28.194999999999997 19.89 120-124 23.95 27.994999999999997 27.98 20.075000000000003 125-129 23.630000000000003 28.1 27.82 20.45 130-134 24.41 27.655 27.834999999999997 20.1 135-139 24.13 27.37 28.485 20.015 140-144 25.135 27.560000000000002 27.765 19.54 145-149 24.585 27.66 28.16 19.595000000000002 150 25.35 27.175 27.625 19.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 1.0 17 1.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 2.0 24 2.0 25 1.0 26 1.5 27 3.5 28 6.0 29 12.0 30 19.5 31 21.0 32 31.5 33 41.5 34 47.0 35 62.5 36 84.0 37 107.0 38 136.5 39 166.0 40 203.0 41 240.5 42 250.0 43 267.5 44 279.5 45 274.5 46 285.0 47 259.5 48 227.5 49 207.0 50 169.0 51 135.5 52 126.0 53 101.5 54 61.0 55 44.5 56 31.5 57 27.5 58 19.5 59 11.0 60 6.5 61 3.5 62 4.0 63 3.0 64 3.0 65 3.5 66 2.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.0750000000000002 0.0 0.0 0.0 0.0 112-113 1.2 0.0 0.0 0.0 0.0 114-115 1.4 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.7125 0.0 0.0 0.0 0.0 120-121 2.0 0.0 0.0 0.0 0.0 122-123 2.175 0.0 0.0 0.0 0.0 124-125 2.4625 0.0 0.0 0.0 0.0 126-127 2.85 0.0 0.0 0.0 0.0 128-129 3.175 0.0 0.0 0.0 0.0 130-131 3.4875 0.0 0.0 0.0 0.0 132-133 3.8 0.0 0.0 0.0 0.0 134-135 4.2375 0.0 0.0 0.0 0.0 136-137 4.6125 0.0 0.0 0.0 0.0 138 4.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1885188 spots for SRR4237646.sra Written 1885188 spots for SRR4237646.sra Read 1885188 spots for SRR4237646.sra Written 1885188 spots for SRR4237646.sra Read 1885188 spots for SRR4237646.sra Written 1885188 spots for SRR4237646.sra Read 1885188 spots for SRR4237646.sra Written 1885188 spots for SRR4237646.sra Read 1885188 spots for SRR4237646.sra Written 1885188 spots for SRR4237646.sra Read 1885188 spots for SRR4237646.sra Written 1885188 spots for SRR4237646.sra Read 1885188 spots for SRR4237646.sra Written 1885188 spots for SRR4237646.sra Read 1885189 spots for SRR4237646.sra Written 1885189 spots for SRR4237646.sra Read 1885188 spots for SRR4237646.sra Written 1885188 spots for SRR4237646.sra Read 1885188 spots for SRR4237646.sra Written 1885188 spots for SRR4237646.sra Read 1885188 spots for SRR4237646.sra Written 1885188 spots for SRR4237646.sra Read 1885188 spots for SRR4237646.sra Written 1885188 spots for SRR4237646.sra Read 1885188 spots for SRR4237646.sra Written 1885188 spots for SRR4237646.sra Read 1885188 spots for SRR4237646.sra Written 1885188 spots for SRR4237646.sra Read 1885188 spots for SRR4237646.sra Written 1885188 spots for SRR4237646.sra Read 1885188 spots for SRR4237646.sra Written 1885188 spots for SRR4237646.sra Read 1885188 spots for SRR4237646.sra Written 1885188 spots for SRR4237646.sra Read 1885188 spots for SRR4237646.sra Written 1885188 spots for SRR4237646.sra Read 1885188 spots for SRR4237646.sra Written 1885188 spots for SRR4237646.sra Read 1885188 spots for SRR4237646.sra Written 1885188 spots for SRR4237646.sra SRR ids: ['SRR4237646.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z5j_5gn5 SRR4237646.sra spots: 37703761 blocks: [[1, 1885188], [1885189, 3770376], [3770377, 5655564], [5655565, 7540752], [7540753, 9425940], [9425941, 11311128], [11311129, 13196316], [13196317, 15081504], [15081505, 16966692], [16966693, 18851880], [18851881, 20737068], [20737069, 22622256], [22622257, 24507444], [24507445, 26392632], [26392633, 28277820], [28277821, 30163008], [30163009, 32048196], [32048197, 33933384], [33933385, 35818572], [35818573, 37703761]] SRR4237646 file size 12681226 SRR4237646 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237646 SRR4237646_1.fastq SRR4237646_2.fastq Input file: SRR4237646_1.fastq Paired file: SRR4237646_2.fastq trimmed: SRR4237646-trimmed-pair1.fastq, SRR4237646-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:43:09 2025 >> started Wed Feb 12 20:43:53 2025 >> done (44.295s) 37703761 read pairs processed; of these: 36635 ( 0.10%) short read pairs filtered out after trimming by size control 29341 ( 0.08%) empty read pairs filtered out after trimming by size control 37637785 (99.83%) read pairs available; of these: 13818302 (36.71%) trimmed read pairs available after processing 23819483 (63.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 6 0.00% 21 7 0.00% 22 8 0.00% 23 5 0.00% 24 8 0.00% 25 6 0.00% 26 3 0.00% 27 17 0.00% 28 8 0.00% 29 8 0.00% 30 14 0.00% 31 14 0.00% 32 17 0.00% 33 18 0.00% 34 26 0.00% 35 18 0.00% 36 26 0.00% 37 24 0.00% 38 24 0.00% 39 33 0.00% 40 50 0.00% 41 28 0.00% 42 27 0.00% 43 45 0.00% 44 49 0.00% 45 53 0.00% 46 61 0.00% 47 59 0.00% 48 60 0.00% 49 87 0.00% 50 84 0.00% 51 103 0.00% 52 129 0.00% 53 138 0.00% 54 141 0.00% 55 153 0.00% 56 180 0.00% 57 195 0.00% 58 220 0.00% 59 236 0.00% 60 280 0.00% 61 311 0.00% 62 345 0.00% 63 403 0.00% 64 455 0.00% 65 462 0.00% 66 530 0.00% 67 688 0.00% 68 859 0.00% 69 1479 0.00% 70 1486 0.00% 71 1108 0.00% 72 1241 0.00% 73 1325 0.00% 74 1456 0.00% 75 1745 0.00% 76 1831 0.00% 77 2029 0.01% 78 2234 0.01% 79 2467 0.01% 80 2927 0.01% 81 3330 0.01% 82 3983 0.01% 83 4549 0.01% 84 7475 0.02% 85 8065 0.02% 86 8497 0.02% 87 9061 0.02% 88 9786 0.03% 89 10355 0.03% 90 11157 0.03% 91 11910 0.03% 92 13286 0.04% 93 14165 0.04% 94 15321 0.04% 95 16382 0.04% 96 17753 0.05% 97 18959 0.05% 98 20027 0.05% 99 21356 0.06% 100 22954 0.06% 101 24326 0.06% 102 26090 0.07% 103 27952 0.07% 104 29548 0.08% 105 31669 0.08% 106 33768 0.09% 107 35439 0.09% 108 36993 0.10% 109 39157 0.10% 110 40822 0.11% 111 43156 0.11% 112 45359 0.12% 113 46911 0.12% 114 49909 0.13% 115 52066 0.14% 116 53785 0.14% 117 57125 0.15% 118 60129 0.16% 119 60852 0.16% 120 63543 0.17% 121 66758 0.18% 122 68076 0.18% 123 71714 0.19% 124 74798 0.20% 125 77815 0.21% 126 80591 0.21% 127 84171 0.22% 128 87305 0.23% 129 91515 0.24% 130 94703 0.25% 131 98208 0.26% 132 102667 0.27% 133 107199 0.28% 134 112708 0.30% 135 118094 0.31% 136 124997 0.33% 137 131104 0.35% 138 139931 0.37% 139 148960 0.40% 140 161029 0.43% 141 173052 0.46% 142 188512 0.50% 143 212092 0.56% 144 249612 0.66% 145 303863 0.81% 146 385083 1.02% 147 560467 1.49% 148 1110828 2.95% 149 7457420 19.81% 150 23819483 63.29% 37637785 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=36 prefix-density=0.18 prefix-fanout=2.4 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.13 sequence-density-rank=5 fanout-score=94.48 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=18.9 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=28 prefix-density=0.22 prefix-fanout=2.7 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.05 sequence-density-rank=40 fanout-score=138.07 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=14.9 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR4237646 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:44:36 Started mapping on | Feb 12 20:44:36 Finished on | Feb 12 20:47:30 Mapping speed, Million of reads per hour | 778.71 Number of input reads | 37637785 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 36455989 Uniquely mapped reads % | 96.86% Average mapped length | 293.87 Number of splices: Total | 34137925 Number of splices: Annotated (sjdb) | 33601832 Number of splices: GT/AG | 33640826 Number of splices: GC/AG | 394587 Number of splices: AT/AC | 32118 Number of splices: Non-canonical | 70394 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 626584 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 29488 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.38% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 597078 597078 597078 N_multimapping 626584 626584 626584 N_noFeature 916599 35998188 1168874 N_ambiguous 366003 2184 158745 UnstrandedReadsAssigned:35173387 PositiveStrandReadsAssigned:455617 NegativeStrandReadsAssigned:35128370 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237646 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237646-trimmed-pair1.fastq SRR4237646-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,637,785 reads, 34,904,792 reads pseudoaligned [quant] estimated average fragment length: 244.545 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR4237646.ke.tsv 34699 SRR4237646.se.tsv 87100 total ==> SRR4237646.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.46 862 14.4707 Potri.005G024800.1.v4.1 1035 791.455 131 4.93051 Potri.004G059700.1.v4.1 961 717.516 21 0.871836 Potri.007G009000.2.v4.1 1416 1172.46 0 0 Potri.003G141000.2.v4.1 2943 2699.46 604.146 6.66673 Potri.016G087400.1.v4.1 270 79.0117 2963 1117.09 Potri.015G069301.1.v4.1 564 326.355 0 0 Potri.010G195200.1.v4.1 1773 1529.46 36 0.701153 Potri.012G127500.1.v4.1 977 733.462 13362 542.676 ==> SRR4237646.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2624 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 424 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR4237646 completed mapping pipeline successfully