Starting /dee2/code/volunteer_pipeline.sh SRR4237647 current disk space = 3050860933120 free memory = 1506052896 SRR4237647 SRAfilesize e3218a04ac6ed5c6d58a888b0851c9a1 SRR4237647.sra SRR4237647.sra file validated SRR4237647 is paired end SRR4237647 is conventional basespace SRR4237647 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237647_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.32825 33.0 32.0 34.0 2.0 34.0 2 32.2595 34.0 32.0 34.0 28.0 34.0 3 32.3835 34.0 32.0 34.0 28.0 34.0 4 32.63475 34.0 33.0 34.0 31.0 34.0 5 32.9005 34.0 33.0 34.0 32.0 34.0 6 36.76725 38.0 37.0 38.0 34.0 38.0 7 37.04025 38.0 38.0 38.0 36.0 38.0 8 37.21225 38.0 38.0 38.0 36.0 38.0 9 37.18075 38.0 38.0 38.0 36.0 38.0 10-14 36.8846 38.0 38.0 38.0 35.4 38.0 15-19 37.03615 38.0 38.0 38.0 35.6 38.0 20-24 37.1148 38.0 38.0 38.0 35.6 38.0 25-29 37.1203 38.0 38.0 38.0 36.0 38.0 30-34 37.0815 38.0 38.0 38.0 36.0 38.0 35-39 37.037699999999994 38.0 38.0 38.0 36.0 38.0 40-44 36.9868 38.0 38.0 38.0 36.0 38.0 45-49 36.60110000000001 38.0 37.8 38.0 33.8 38.0 50-54 36.799099999999996 38.0 38.0 38.0 34.8 38.0 55-59 36.85325 38.0 38.0 38.0 34.8 38.0 60-64 36.7859 38.0 38.0 38.0 34.8 38.0 65-69 36.7235 38.0 38.0 38.0 34.8 38.0 70-74 36.11275 38.0 37.2 38.0 32.2 38.0 75-79 36.36065 38.0 38.0 38.0 33.6 38.0 80-84 36.49745 38.0 38.0 38.0 34.0 38.0 85-89 36.51335 38.0 38.0 38.0 34.0 38.0 90-94 36.428549999999994 38.0 38.0 38.0 34.0 38.0 95-99 36.36084999999999 38.0 38.0 38.0 34.0 38.0 100-104 36.2609 38.0 37.6 38.0 33.6 38.0 105-109 36.12485 38.0 37.4 38.0 33.2 38.0 110-114 36.01645 38.0 37.0 38.0 32.8 38.0 115-119 35.82365 38.0 37.0 38.0 31.8 38.0 120-124 35.70175 38.0 36.8 38.0 31.0 38.0 125-129 35.66225 38.0 36.6 38.0 31.0 38.0 130-134 34.818650000000005 38.0 35.4 38.0 25.4 38.0 135-139 34.58045 38.0 35.2 38.0 25.4 38.0 140-144 34.7787 38.0 35.4 38.0 27.6 38.0 145-149 33.93155 38.0 35.0 38.0 23.0 38.0 150 27.60125 34.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 3.0 15 0.0 16 2.0 17 2.0 18 3.0 19 3.0 20 3.0 21 5.0 22 4.0 23 7.0 24 11.0 25 16.0 26 23.0 27 24.0 28 30.0 29 45.0 30 46.0 31 106.0 32 111.0 33 164.0 34 179.0 35 275.0 36 589.0 37 2347.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.49436936936937 11.96509009009009 8.783783783783784 31.756756756756754 2 22.925 14.85 33.825 28.4 3 19.625 22.175 26.400000000000002 31.8 4 23.125 28.799999999999997 22.55 25.525 5 22.15 33.85 23.75 20.25 6 18.05 36.35 23.825 21.775 7 14.424999999999999 25.3 42.125 18.15 8 16.875 26.424999999999997 30.3 26.400000000000002 9 17.525 24.25 33.074999999999996 25.15 10-14 19.869999999999997 30.080000000000002 26.474999999999998 23.575 15-19 19.77 29.005 27.860000000000003 23.365 20-24 19.835 28.505000000000003 27.72 23.94 25-29 19.794999999999998 28.54 27.525 24.14 30-34 20.31 28.74 27.575 23.375 35-39 19.830000000000002 29.220000000000002 26.740000000000002 24.21 40-44 20.275000000000002 28.804999999999996 27.384999999999998 23.535 45-49 19.91 28.71 28.060000000000002 23.32 50-54 20.305 29.09 27.26 23.345 55-59 19.295 29.26 27.725 23.72 60-64 20.195 28.74 27.575 23.49 65-69 19.985 29.42 27.13 23.465 70-74 20.26 28.965000000000003 27.63 23.145 75-79 20.265 28.34 27.32 24.075 80-84 19.900000000000002 28.84 27.36 23.9 85-89 20.32 28.505000000000003 27.22 23.955000000000002 90-94 19.759999999999998 29.4 27.400000000000002 23.44 95-99 20.21 28.42 27.825 23.544999999999998 100-104 20.14 29.095 27.1 23.665 105-109 20.4 28.689999999999998 26.96 23.95 110-114 20.24 28.83 27.48 23.45 115-119 20.23 28.615000000000002 27.22 23.935000000000002 120-124 20.435 28.335 27.965 23.265 125-129 20.4 28.415000000000003 27.400000000000002 23.785 130-134 21.145 27.474999999999998 27.67 23.71 135-139 20.330000000000002 28.854999999999997 27.62 23.195 140-144 20.695 27.865000000000002 27.025 24.415 145-149 20.64 28.185 27.08 24.095 150 20.825 28.000000000000004 26.875 24.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 4.5 25 5.0 26 4.5 27 9.5 28 11.0 29 13.5 30 18.5 31 27.0 32 39.5 33 48.5 34 58.0 35 67.0 36 84.0 37 112.5 38 129.5 39 154.5 40 197.5 41 226.0 42 245.0 43 265.5 44 283.5 45 273.5 46 246.0 47 238.5 48 226.0 49 205.5 50 179.0 51 141.0 52 113.0 53 92.5 54 72.5 55 57.5 56 41.0 57 25.5 58 21.0 59 17.5 60 10.5 61 6.0 62 6.5 63 6.5 64 4.0 65 2.5 66 1.0 67 1.0 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.200000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.05 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.6375000000000002 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.0625 0.0 0.0 0.0 0.0 120-121 2.2750000000000004 0.0 0.0 0.0 0.0 122-123 2.6 0.0 0.0 0.0 0.0 124-125 2.9125 0.0 0.0 0.0 0.0 126-127 3.2874999999999996 0.0 0.0 0.0 0.0 128-129 3.6875 0.0 0.0 0.0 0.0 130-131 3.9875 0.0 0.0 0.0 0.0 132-133 4.45 0.0 0.0 0.0 0.0 134-135 4.762499999999999 0.0 0.0 0.0 0.0 136-137 5.1625 0.0 0.0 0.0 0.0 138 5.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237647 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237647_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1575 33.0 33.0 34.0 31.0 34.0 2 32.40525 33.0 33.0 34.0 31.0 34.0 3 32.32775 33.0 33.0 34.0 31.0 34.0 4 32.33625 33.0 33.0 34.0 31.0 34.0 5 32.34125 33.0 33.0 34.0 31.0 34.0 6 36.32975 38.0 38.0 38.0 34.0 38.0 7 36.37175 38.0 38.0 38.0 34.0 38.0 8 36.43525 38.0 38.0 38.0 34.0 38.0 9 36.345 38.0 38.0 38.0 34.0 38.0 10-14 36.32745 38.0 38.0 38.0 34.0 38.0 15-19 35.97525 38.0 37.8 38.0 32.4 38.0 20-24 35.91575 38.0 37.6 38.0 32.0 38.0 25-29 36.204299999999996 38.0 38.0 38.0 33.8 38.0 30-34 36.17529999999999 38.0 38.0 38.0 33.6 38.0 35-39 36.120999999999995 38.0 38.0 38.0 33.8 38.0 40-44 36.157349999999994 38.0 38.0 38.0 33.8 38.0 45-49 36.054500000000004 38.0 38.0 38.0 33.4 38.0 50-54 36.1101 38.0 38.0 38.0 33.8 38.0 55-59 36.0596 38.0 38.0 38.0 33.2 38.0 60-64 35.90275 38.0 38.0 38.0 33.0 38.0 65-69 35.94845 38.0 38.0 38.0 33.2 38.0 70-74 35.603899999999996 38.0 37.6 38.0 31.2 38.0 75-79 35.5375 38.0 37.0 38.0 30.4 38.0 80-84 35.5646 38.0 37.0 38.0 30.8 38.0 85-89 35.59385000000001 38.0 37.0 38.0 31.4 38.0 90-94 35.52945 38.0 37.2 38.0 30.6 38.0 95-99 35.38770000000001 38.0 37.0 38.0 29.8 38.0 100-104 35.2173 38.0 37.0 38.0 29.0 38.0 105-109 34.29625 38.0 35.0 38.0 24.6 38.0 110-114 34.91325 38.0 36.6 38.0 27.6 38.0 115-119 34.70569999999999 38.0 36.0 38.0 26.4 38.0 120-124 34.55165 38.0 36.0 38.0 25.2 38.0 125-129 34.17815 38.0 35.6 38.0 21.6 38.0 130-134 33.657050000000005 38.0 34.8 38.0 19.0 38.0 135-139 33.4164 38.0 33.4 38.0 18.6 38.0 140-144 32.91585 38.0 33.0 38.0 13.8 38.0 145-149 31.6527 38.0 33.0 38.0 6.2 38.0 150 23.75725 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 17.0 4 4.0 5 4.0 6 4.0 7 2.0 8 3.0 9 3.0 10 5.0 11 7.0 12 1.0 13 7.0 14 4.0 15 3.0 16 7.0 17 12.0 18 7.0 19 14.0 20 7.0 21 10.0 22 12.0 23 21.0 24 29.0 25 28.0 26 31.0 27 34.0 28 43.0 29 61.0 30 55.0 31 88.0 32 110.0 33 143.0 34 201.0 35 271.0 36 558.0 37 2178.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.3 21.575 12.625 21.5 2 29.549999999999997 23.974999999999998 30.55 15.925 3 21.75 28.925 30.775000000000002 18.55 4 25.7 34.225 23.75 16.325 5 24.025 37.475 22.275 16.225 6 20.375 38.25 23.75 17.625 7 20.75 20.575 39.625 19.05 8 21.075 24.55 28.475 25.900000000000002 9 21.95 24.9 30.55 22.6 10-14 23.52 28.77 26.810000000000002 20.9 15-19 23.02 27.750000000000004 28.34 20.89 20-24 23.315 28.235 27.775 20.674999999999997 25-29 23.044999999999998 28.325 28.22 20.41 30-34 23.7 27.815 27.994999999999997 20.49 35-39 22.93 28.175 28.29 20.605 40-44 24.0 26.900000000000002 28.59 20.51 45-49 22.85 28.21 28.425 20.515 50-54 23.355 27.529999999999998 28.43 20.685000000000002 55-59 23.02 28.675 27.439999999999998 20.865000000000002 60-64 22.715 27.41 28.875 21.0 65-69 23.244999999999997 28.22 28.27 20.265 70-74 23.355 27.555000000000003 28.65 20.44 75-79 23.175 28.845 28.084999999999997 19.895 80-84 23.49 28.38 27.939999999999998 20.19 85-89 23.785 27.655 28.4 20.16 90-94 24.08 28.01 28.225 19.685 95-99 23.87 27.825 28.46 19.845 100-104 23.39 28.115000000000002 28.08 20.415 105-109 23.73 27.87 27.85 20.549999999999997 110-114 23.71 27.48 28.475 20.335 115-119 23.875 28.225 27.785 20.115 120-124 23.66 27.975 28.384999999999998 19.98 125-129 24.23 27.944999999999997 27.529999999999998 20.294999999999998 130-134 24.25 28.185 28.075 19.49 135-139 24.465 28.115000000000002 27.555000000000003 19.865 140-144 25.495 27.43 27.875 19.2 145-149 25.385 27.985 27.07 19.56 150 26.200000000000003 26.450000000000003 28.7 18.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.5 17 0.5 18 1.0 19 1.5 20 1.5 21 1.0 22 1.5 23 3.0 24 4.0 25 6.5 26 8.5 27 7.5 28 9.5 29 10.5 30 13.0 31 16.5 32 19.5 33 32.5 34 48.5 35 62.0 36 85.5 37 110.0 38 135.0 39 172.5 40 207.0 41 234.0 42 268.5 43 289.0 44 286.5 45 275.5 46 275.5 47 264.0 48 218.0 49 190.5 50 159.5 51 127.5 52 116.0 53 88.0 54 56.5 55 40.0 56 33.0 57 26.5 58 20.0 59 17.5 60 11.5 61 6.0 62 6.0 63 6.5 64 6.0 65 4.0 66 2.0 67 1.5 68 1.0 69 0.5 70 2.0 71 2.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.25 0.0 0.0 0.0 0.0 114-115 1.4874999999999998 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 1.8875 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.4 0.0 0.0 0.0 0.0 124-125 2.7125 0.0 0.0 0.0 0.0 126-127 3.1 0.0 0.0 0.0 0.0 128-129 3.5125 0.0 0.0 0.0 0.0 130-131 3.7874999999999996 0.0 0.0 0.0 0.0 132-133 4.237500000000001 0.0 0.0 0.0 0.0 134-135 4.5875 0.0 0.0 0.0 0.0 136-137 4.9625 0.0 0.0 0.0 0.0 138 5.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACACT 10 0.006973645 144.0 3 >>END_MODULE Read 3275881 spots for SRR4237647.sra Written 3275881 spots for SRR4237647.sra Read 3275881 spots for SRR4237647.sra Written 3275881 spots for SRR4237647.sra Read 3275881 spots for SRR4237647.sra Written 3275881 spots for SRR4237647.sra Read 3275881 spots for SRR4237647.sra Written 3275881 spots for SRR4237647.sra Read 3275881 spots for SRR4237647.sra Written 3275881 spots for SRR4237647.sra Read 3275881 spots for SRR4237647.sra Written 3275881 spots for SRR4237647.sra Read 3275881 spots for SRR4237647.sra Written 3275881 spots for SRR4237647.sra Read 3275881 spots for SRR4237647.sra Written 3275881 spots for SRR4237647.sra Read 3275881 spots for SRR4237647.sra Written 3275881 spots for SRR4237647.sra Read 3275881 spots for SRR4237647.sra Written 3275881 spots for SRR4237647.sra Read 3275881 spots for SRR4237647.sra Written 3275881 spots for SRR4237647.sra Read 3275881 spots for SRR4237647.sra Written 3275881 spots for SRR4237647.sra Read 3275881 spots for SRR4237647.sra Written 3275881 spots for SRR4237647.sra Read 3275881 spots for SRR4237647.sra Written 3275881 spots for SRR4237647.sra Read 3275881 spots for SRR4237647.sra Written 3275881 spots for SRR4237647.sra Read 3275881 spots for SRR4237647.sra Written 3275881 spots for SRR4237647.sra Read 3275886 spots for SRR4237647.sra Written 3275886 spots for SRR4237647.sra Read 3275881 spots for SRR4237647.sra Written 3275881 spots for SRR4237647.sra Read 3275881 spots for SRR4237647.sra Written 3275881 spots for SRR4237647.sra Read 3275881 spots for SRR4237647.sra Written 3275881 spots for SRR4237647.sra SRR ids: ['SRR4237647.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2dd16mr3 SRR4237647.sra spots: 65517625 blocks: [[1, 3275881], [3275882, 6551762], [6551763, 9827643], [9827644, 13103524], [13103525, 16379405], [16379406, 19655286], [19655287, 22931167], [22931168, 26207048], [26207049, 29482929], [29482930, 32758810], [32758811, 36034691], [36034692, 39310572], [39310573, 42586453], [42586454, 45862334], [45862335, 49138215], [49138216, 52414096], [52414097, 55689977], [55689978, 58965858], [58965859, 62241739], [62241740, 65517625]] SRR4237647 file size 22052108 SRR4237647 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237647 SRR4237647_1.fastq SRR4237647_2.fastq Input file: SRR4237647_1.fastq Paired file: SRR4237647_2.fastq trimmed: SRR4237647-trimmed-pair1.fastq, SRR4237647-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:49:14 2025 >> started Wed Feb 12 20:50:48 2025 >> done (93.778s) 65517625 read pairs processed; of these: 159243 ( 0.24%) short read pairs filtered out after trimming by size control 104754 ( 0.16%) empty read pairs filtered out after trimming by size control 65253628 (99.60%) read pairs available; of these: 25379352 (38.89%) trimmed read pairs available after processing 39874276 (61.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 5 0.00% 20 8 0.00% 21 11 0.00% 22 12 0.00% 23 7 0.00% 24 10 0.00% 25 12 0.00% 26 11 0.00% 27 15 0.00% 28 19 0.00% 29 19 0.00% 30 21 0.00% 31 34 0.00% 32 30 0.00% 33 26 0.00% 34 23 0.00% 35 38 0.00% 36 47 0.00% 37 40 0.00% 38 51 0.00% 39 46 0.00% 40 61 0.00% 41 61 0.00% 42 73 0.00% 43 80 0.00% 44 62 0.00% 45 108 0.00% 46 113 0.00% 47 132 0.00% 48 154 0.00% 49 151 0.00% 50 191 0.00% 51 203 0.00% 52 212 0.00% 53 232 0.00% 54 259 0.00% 55 267 0.00% 56 324 0.00% 57 346 0.00% 58 393 0.00% 59 467 0.00% 60 495 0.00% 61 620 0.00% 62 602 0.00% 63 731 0.00% 64 818 0.00% 65 970 0.00% 66 1056 0.00% 67 1302 0.00% 68 1991 0.00% 69 5637 0.01% 70 3809 0.01% 71 2144 0.00% 72 2299 0.00% 73 2577 0.00% 74 2777 0.00% 75 3192 0.00% 76 3521 0.01% 77 3926 0.01% 78 4286 0.01% 79 4985 0.01% 80 5705 0.01% 81 6535 0.01% 82 7563 0.01% 83 9277 0.01% 84 21172 0.03% 85 21315 0.03% 86 22052 0.03% 87 22666 0.03% 88 23717 0.04% 89 24707 0.04% 90 25845 0.04% 91 27274 0.04% 92 28837 0.04% 93 30411 0.05% 94 32956 0.05% 95 35143 0.05% 96 36880 0.06% 97 39413 0.06% 98 41443 0.06% 99 44885 0.07% 100 47282 0.07% 101 50026 0.08% 102 53347 0.08% 103 56824 0.09% 104 60865 0.09% 105 65086 0.10% 106 69184 0.11% 107 72627 0.11% 108 76228 0.12% 109 79845 0.12% 110 83144 0.13% 111 88731 0.14% 112 93583 0.14% 113 97766 0.15% 114 104049 0.16% 115 109581 0.17% 116 114341 0.18% 117 118704 0.18% 118 123677 0.19% 119 127383 0.20% 120 134266 0.21% 121 138622 0.21% 122 145434 0.22% 123 152077 0.23% 124 159381 0.24% 125 165781 0.25% 126 174116 0.27% 127 180411 0.28% 128 187578 0.29% 129 196879 0.30% 130 204608 0.31% 131 213696 0.33% 132 223659 0.34% 133 235643 0.36% 134 247203 0.38% 135 260509 0.40% 136 275509 0.42% 137 289964 0.44% 138 309838 0.47% 139 328786 0.50% 140 352756 0.54% 141 381654 0.58% 142 420506 0.64% 143 471541 0.72% 144 551613 0.85% 145 666562 1.02% 146 854774 1.31% 147 1210192 1.85% 148 2192944 3.36% 149 11800661 18.08% 150 39874276 61.11% 65253628 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=37 prefix-density=0.21 prefix-fanout=2.1 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=280.02 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=29.7 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=24 prefix-density=0.24 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=17 fanout-score=69.85 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=16.0 sequence=TGTTGGTGGTGG SRR4237647 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:51:32 Started mapping on | Feb 12 20:51:32 Finished on | Feb 12 20:58:54 Mapping speed, Million of reads per hour | 531.48 Number of input reads | 65253628 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 62468232 Uniquely mapped reads % | 95.73% Average mapped length | 292.63 Number of splices: Total | 57647725 Number of splices: Annotated (sjdb) | 56751322 Number of splices: GT/AG | 56790605 Number of splices: GC/AG | 682433 Number of splices: AT/AC | 52994 Number of splices: Non-canonical | 121693 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1108940 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 66973 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.44% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1839894 1839894 1839894 N_multimapping 1108940 1108940 1108940 N_noFeature 1532089 61712372 1986145 N_ambiguous 581230 4134 276138 UnstrandedReadsAssigned:60354913 PositiveStrandReadsAssigned:751726 NegativeStrandReadsAssigned:60205949 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237647 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237647-trimmed-pair1.fastq SRR4237647-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 65,253,628 reads, 59,938,491 reads pseudoaligned [quant] estimated average fragment length: 233.953 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,225 rounds 52401 SRR4237647.ke.tsv 34699 SRR4237647.se.tsv 87100 total ==> SRR4237647.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.05 1478 14.4566 Potri.005G024800.1.v4.1 1035 802.047 261 5.68175 Potri.004G059700.1.v4.1 961 728.081 44 1.05515 Potri.007G009000.2.v4.1 1416 1183.05 0 0 Potri.003G141000.2.v4.1 2943 2710.05 1181.23 7.61028 Potri.016G087400.1.v4.1 270 82.0843 5548 1180.1 Potri.015G069301.1.v4.1 564 334.997 0 0 Potri.010G195200.1.v4.1 1773 1540.05 118 1.33779 Potri.012G127500.1.v4.1 977 744.064 24518 575.328 ==> SRR4237647.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3778 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 799 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR4237647 completed mapping pipeline successfully