Starting /dee2/code/volunteer_pipeline.sh SRR4237648 current disk space = 3050929680384 free memory = 1040982648 SRR4237648 SRAfilesize 11e074ddcc2db2362df54eb5c610b4ba SRR4237648.sra SRR4237648.sra file validated SRR4237648 is paired end SRR4237648 is conventional basespace SRR4237648 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237648_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.1825 34.0 33.0 34.0 2.0 34.0 2 32.875 34.0 33.0 34.0 28.0 34.0 3 33.12025 34.0 33.0 34.0 32.0 34.0 4 33.39175 34.0 33.0 34.0 33.0 34.0 5 33.49525 34.0 33.0 34.0 33.0 34.0 6 37.29 38.0 38.0 38.0 36.0 38.0 7 37.5745 38.0 38.0 38.0 37.0 38.0 8 37.66075 38.0 38.0 38.0 38.0 38.0 9 37.6885 38.0 38.0 38.0 38.0 38.0 10-14 37.4322 38.0 38.0 38.0 37.4 38.0 15-19 36.81535 38.0 37.2 38.0 34.6 38.0 20-24 37.529050000000005 38.0 38.0 38.0 37.6 38.0 25-29 37.6306 38.0 38.0 38.0 38.0 38.0 30-34 36.09740000000001 37.8 35.6 38.0 31.8 38.0 35-39 37.4532 38.0 37.8 38.0 37.2 38.0 40-44 37.389700000000005 38.0 38.0 38.0 37.2 38.0 45-49 37.4225 38.0 38.0 38.0 37.0 38.0 50-54 37.3926 38.0 38.0 38.0 37.2 38.0 55-59 37.281150000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.18485 38.0 38.0 38.0 36.6 38.0 65-69 37.2269 38.0 38.0 38.0 36.6 38.0 70-74 37.23365 38.0 38.0 38.0 36.8 38.0 75-79 37.19575 38.0 38.0 38.0 37.0 38.0 80-84 37.18325 38.0 38.0 38.0 36.4 38.0 85-89 37.2192 38.0 38.0 38.0 36.4 38.0 90-94 37.1997 38.0 38.0 38.0 36.6 38.0 95-99 37.06315 38.0 38.0 38.0 36.0 38.0 100-104 37.0197 38.0 38.0 38.0 36.0 38.0 105-109 36.852500000000006 38.0 38.0 38.0 35.6 38.0 110-114 36.73945 38.0 38.0 38.0 34.8 38.0 115-119 36.814800000000005 38.0 38.0 38.0 35.2 38.0 120-124 36.7293 38.0 38.0 38.0 35.0 38.0 125-129 36.55585 38.0 38.0 38.0 34.4 38.0 130-134 36.383300000000006 38.0 38.0 38.0 34.0 38.0 135-139 36.3805 38.0 38.0 38.0 34.0 38.0 140-144 36.10665 38.0 38.0 38.0 33.8 38.0 145-149 35.57525 38.0 36.4 38.0 32.8 38.0 150 31.67175 36.0 33.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 3.0 17 1.0 18 1.0 19 1.0 20 3.0 21 2.0 22 1.0 23 9.0 24 5.0 25 4.0 26 6.0 27 9.0 28 27.0 29 19.0 30 26.0 31 28.0 32 44.0 33 65.0 34 108.0 35 159.0 36 482.0 37 2994.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.30769230769231 12.223776223776223 8.41958041958042 47.04895104895105 2 19.875 14.424999999999999 39.65 26.05 3 18.7 17.5 26.200000000000003 37.6 4 23.200000000000003 25.624999999999996 21.75 29.425 5 23.375 30.55 24.575 21.5 6 19.825 35.125 24.525 20.525 7 14.174999999999999 29.425 39.95 16.45 8 16.6 26.8 33.175 23.425 9 15.475 24.65 35.85 24.025 10-14 19.02 30.915 27.62 22.445 15-19 18.88 29.675 27.935 23.51 20-24 19.425 29.275000000000002 27.77 23.53 25-29 19.12 29.685 27.6 23.595 30-34 19.6019601960196 29.307930793079308 28.212821282128214 22.877287728772878 35-39 19.619904976244058 29.462365591397848 27.35183795948987 23.565891472868216 40-44 19.561956195619562 29.492949294929495 27.322732273227324 23.622362236223623 45-49 19.57 29.104999999999997 27.465 23.86 50-54 19.31 28.7 27.744999999999997 24.245 55-59 19.61 29.65 27.18 23.56 60-64 19.79 29.575000000000003 26.729999999999997 23.905 65-69 19.955000000000002 29.220000000000002 27.525 23.3 70-74 19.541954195419542 29.4029402940294 27.677767776777678 23.377337733773377 75-79 19.28192819281928 28.512851285128516 27.57275727572757 24.632463246324633 80-84 19.89 29.015 27.634999999999998 23.46 85-89 19.615 28.965000000000003 27.544999999999998 23.875 90-94 19.61 28.785 27.51 24.095 95-99 19.855 28.625 27.765 23.755000000000003 100-104 19.55 29.26 27.855 23.335 105-109 19.919999999999998 28.655 27.389999999999997 24.035 110-114 19.96 28.575 28.03 23.435 115-119 19.634999999999998 29.015 27.87 23.48 120-124 19.955000000000002 29.235 27.12 23.69 125-129 20.135 28.715000000000003 27.625 23.525 130-134 20.635 29.060000000000002 26.900000000000002 23.405 135-139 20.005 28.515 27.24 24.240000000000002 140-144 20.175 28.505000000000003 27.900000000000002 23.419999999999998 145-149 20.915 28.705000000000002 26.93 23.45 150 21.78714859437751 27.886546184738958 27.384538152610443 22.94176706827309 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 2.0 21 1.5 22 2.0 23 3.5 24 4.0 25 3.0 26 3.0 27 5.5 28 8.0 29 11.0 30 19.0 31 25.5 32 40.0 33 60.0 34 76.5 35 95.0 36 108.0 37 121.5 38 151.5 39 181.0 40 202.5 41 234.5 42 254.0 43 267.0 44 265.5 45 248.5 46 240.5 47 247.5 48 228.5 49 178.0 50 144.0 51 132.5 52 118.0 53 86.0 54 57.5 55 39.5 56 32.0 57 25.5 58 18.0 59 10.5 60 7.0 61 6.0 62 5.5 63 5.0 64 3.5 65 3.0 66 3.0 67 3.0 68 2.5 69 2.0 70 2.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.025 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 0.01 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.4 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.36250000000000004 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7124999999999999 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.2625 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.7000000000000002 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.6375 0.0 0.0 0.0 0.0 122-123 3.0999999999999996 0.0 0.0 0.0 0.0 124-125 3.3499999999999996 0.0 0.0 0.0 0.0 126-127 3.675 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.4125 0.0 0.0 0.0 0.0 132-133 4.7875 0.0 0.0 0.0 0.0 134-135 5.2 0.0 0.0 0.0 0.0 136-137 5.699999999999999 0.0 0.0 0.0 0.0 138 6.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237648 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237648_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93125 33.0 33.0 34.0 32.0 34.0 2 33.06975 34.0 33.0 34.0 33.0 34.0 3 33.215 34.0 33.0 34.0 33.0 34.0 4 33.15975 34.0 33.0 34.0 33.0 34.0 5 32.8005 34.0 33.0 34.0 32.0 34.0 6 37.32275 38.0 38.0 38.0 37.0 38.0 7 37.415 38.0 38.0 38.0 37.0 38.0 8 37.30175 38.0 38.0 38.0 37.0 38.0 9 37.4425 38.0 38.0 38.0 37.0 38.0 10-14 37.40665 38.0 38.0 38.0 38.0 38.0 15-19 37.370900000000006 38.0 38.0 38.0 37.6 38.0 20-24 37.34545000000001 38.0 38.0 38.0 37.6 38.0 25-29 37.346999999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.39265 38.0 38.0 38.0 38.0 38.0 35-39 37.40025000000001 38.0 38.0 38.0 37.6 38.0 40-44 37.3172 38.0 38.0 38.0 37.4 38.0 45-49 37.380849999999995 38.0 38.0 38.0 37.8 38.0 50-54 37.348 38.0 38.0 38.0 37.4 38.0 55-59 37.3394 38.0 38.0 38.0 37.4 38.0 60-64 37.28685 38.0 38.0 38.0 37.0 38.0 65-69 37.2538 38.0 38.0 38.0 37.0 38.0 70-74 37.2918 38.0 38.0 38.0 37.0 38.0 75-79 37.2185 38.0 38.0 38.0 37.0 38.0 80-84 37.2624 38.0 38.0 38.0 37.0 38.0 85-89 37.13585 38.0 38.0 38.0 36.8 38.0 90-94 37.058350000000004 38.0 38.0 38.0 36.8 38.0 95-99 37.04809999999999 38.0 38.0 38.0 36.2 38.0 100-104 36.90965 38.0 38.0 38.0 35.8 38.0 105-109 36.881099999999996 38.0 38.0 38.0 36.0 38.0 110-114 36.82955 38.0 38.0 38.0 35.8 38.0 115-119 36.813599999999994 38.0 38.0 38.0 36.0 38.0 120-124 36.66275 38.0 38.0 38.0 35.0 38.0 125-129 36.549099999999996 38.0 38.0 38.0 35.0 38.0 130-134 36.5028 38.0 38.0 38.0 35.0 38.0 135-139 36.4178 38.0 38.0 38.0 34.8 38.0 140-144 36.06945 38.0 38.0 38.0 33.6 38.0 145-149 35.8434 38.0 38.0 38.0 33.8 38.0 150 31.46075 36.0 33.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 3.0 17 2.0 18 2.0 19 5.0 20 3.0 21 6.0 22 8.0 23 6.0 24 8.0 25 9.0 26 15.0 27 17.0 28 16.0 29 16.0 30 34.0 31 35.0 32 35.0 33 53.0 34 96.0 35 123.0 36 295.0 37 3209.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.8870765370138 19.47302383939774 13.324968632371393 37.31493099121707 2 25.338345864661655 23.082706766917294 36.2406015037594 15.338345864661655 3 20.090180360721444 27.880761523046093 32.16432865731463 19.864729458917836 4 22.54509018036072 32.38977955911824 24.423847695390783 20.64128256513026 5 25.250501002004004 34.844689378757515 23.947895791583164 15.956913827655312 6 20.875 38.125 23.5 17.5 7 19.7 23.075000000000003 38.550000000000004 18.675 8 20.51025512756378 24.58729364682341 31.240620310155077 23.66183091545773 9 22.28614307153577 23.986993496748372 32.09104552276138 21.635817908954476 10-14 22.896330780397456 28.958302047354458 26.986033939029884 21.1593332332182 15-19 23.845730578760442 27.7574908708919 28.097643939772897 20.29913461057476 20-24 23.06345951892784 28.52427864179627 27.879181877281596 20.5330799619943 25-29 22.95418167266907 28.07122849139656 28.256302521008404 20.71828731492597 30-34 22.716135806790337 28.111405570278514 28.741437071853593 20.431021551077556 35-39 23.07 28.105000000000004 28.185 20.64 40-44 22.9672254190643 28.10607955966975 28.416312234175635 20.510382787090318 45-49 23.275818954738682 27.93198299574894 28.30207551887972 20.49012253063266 50-54 23.43937575030012 28.271308523409367 28.45138055222089 19.837935174069628 55-59 23.779235738969298 27.65563179245755 28.446937446787203 20.118195021785947 60-64 23.20088079271344 28.520668601741566 28.375537984185765 19.902912621359224 65-69 23.788083445895243 27.910350692881085 27.85532042623443 20.446245434989244 70-74 23.416391474031823 27.43920744521165 28.64004803362354 20.50435304713299 75-79 23.04650347900085 28.05226009911398 28.582870300845975 20.318366121039194 80-84 23.84192096048024 27.088544272136065 28.789394697348676 20.280140070035017 85-89 23.16 28.294999999999998 28.444999999999997 20.1 90-94 23.382213102447324 28.216805965667387 28.321905810519993 20.079075121365296 95-99 23.07846176926539 27.774166124918736 28.7993198979847 20.348052207831174 100-104 24.05 27.355 28.595 20.0 105-109 23.512351235123514 27.83778377837784 28.347834783478348 20.3020302030203 110-114 23.807380738073807 27.647764776477647 28.18781878187819 20.357035703570357 115-119 24.232423242324234 28.112811281128113 27.9027902790279 19.75197519751975 120-124 24.07620381019051 28.39141957097855 27.936396819840994 19.595979798989948 125-129 24.03220966289887 28.82864859457837 27.508252475742722 19.630889266780034 130-134 24.16 28.494999999999997 27.815 19.53 135-139 24.48989797959592 27.935587117423484 27.525505101020205 20.04900980196039 140-144 24.85612770855227 28.439173297302705 27.513386378421657 19.191312615723366 145-149 24.989997999599918 27.795559111822364 27.580516103220642 19.633926785357072 150 25.727911646586342 28.639558232931726 26.68172690763052 18.950803212851405 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.5 24 2.5 25 3.0 26 6.0 27 8.5 28 6.5 29 8.0 30 14.0 31 19.0 32 29.0 33 41.0 34 60.5 35 79.5 36 90.0 37 107.5 38 141.5 39 184.5 40 210.0 41 244.5 42 287.0 43 302.5 44 271.0 45 262.5 46 276.0 47 259.5 48 236.5 49 190.0 50 149.0 51 119.5 52 93.5 53 75.5 54 50.5 55 36.0 56 33.5 57 24.5 58 19.5 59 14.0 60 5.5 61 2.5 62 4.5 63 8.0 64 7.0 65 3.0 66 1.5 67 1.5 68 1.0 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.25 3 0.2 4 0.2 5 0.2 6 0.0 7 0.0 8 0.05 9 0.05 10-14 0.11499999999999999 15-19 0.045 20-24 0.015 25-29 0.04 30-34 0.005 35-39 0.0 40-44 0.075 45-49 0.025 50-54 0.04 55-59 0.165 60-64 0.09 65-69 0.055 70-74 0.06999999999999999 75-79 0.11499999999999999 80-84 0.05 85-89 0.0 90-94 0.095 95-99 0.015 100-104 0.0 105-109 0.01 110-114 0.01 115-119 0.01 120-124 0.005 125-129 0.03 130-134 0.0 135-139 0.02 140-144 0.08499999999999999 145-149 0.02 150 0.4 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2508151492350138 0.5 3 0.0 0.0 4 0.025081514923501375 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.36250000000000004 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7124999999999999 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.2625 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.7000000000000002 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.2 0.0 0.0 0.0 0.0 120-121 2.5875 0.0 0.0 0.0 0.0 122-123 3.05 0.0 0.0 0.0 0.0 124-125 3.3 0.0 0.0 0.0 0.0 126-127 3.625 0.0 0.0 0.0 0.0 128-129 3.9875 0.0 0.0 0.0 0.0 130-131 4.362500000000001 0.0 0.0 0.0 0.0 132-133 4.7375 0.0 0.0 0.0 0.0 134-135 5.15 0.0 0.0 0.0 0.0 136-137 5.65 0.0 0.0 0.0 0.0 138 5.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3961802 spots for SRR4237648.sra Read 3961802 spots for SRR4237648.sra Written 3961802 spots for SRR4237648.sra Written 3961802 spots for SRR4237648.sra Read 3961802 spots for SRR4237648.sra Written 3961802 spots for SRR4237648.sra Read 3961802 spots for SRR4237648.sra Written 3961802 spots for SRR4237648.sra Read 3961802 spots for SRR4237648.sra Read 3961802 spots for SRR4237648.sra Written 3961802 spots for SRR4237648.sra Written 3961802 spots for SRR4237648.sra Read 3961802 spots for SRR4237648.sra Written 3961802 spots for SRR4237648.sra Read 3961802 spots for SRR4237648.sra Written 3961802 spots for SRR4237648.sra Read 3961802 spots for SRR4237648.sra Written 3961802 spots for SRR4237648.sra Read 3961802 spots for SRR4237648.sra Written 3961802 spots for SRR4237648.sra Read 3961802 spots for SRR4237648.sra Written 3961802 spots for SRR4237648.sra Read 3961802 spots for SRR4237648.sra Written 3961802 spots for SRR4237648.sra Read 3961802 spots for SRR4237648.sra Written 3961802 spots for SRR4237648.sra Read 3961802 spots for SRR4237648.sra Written 3961802 spots for SRR4237648.sra Read 3961802 spots for SRR4237648.sra Written 3961802 spots for SRR4237648.sra Read 3961802 spots for SRR4237648.sra Written 3961802 spots for SRR4237648.sra Read 3961812 spots for SRR4237648.sra Written 3961812 spots for SRR4237648.sra Read 3961802 spots for SRR4237648.sra Written 3961802 spots for SRR4237648.sra Read 3961802 spots for SRR4237648.sra Written 3961802 spots for SRR4237648.sra Read 3961802 spots for SRR4237648.sra Written 3961802 spots for SRR4237648.sra SRR ids: ['SRR4237648.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hst4gbhy SRR4237648.sra spots: 79236050 blocks: [[1, 3961802], [3961803, 7923604], [7923605, 11885406], [11885407, 15847208], [15847209, 19809010], [19809011, 23770812], [23770813, 27732614], [27732615, 31694416], [31694417, 35656218], [35656219, 39618020], [39618021, 43579822], [43579823, 47541624], [47541625, 51503426], [51503427, 55465228], [55465229, 59427030], [59427031, 63388832], [63388833, 67350634], [67350635, 71312436], [71312437, 75274238], [75274239, 79236050]] SRR4237648 file size 26674039 SRR4237648 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237648 SRR4237648_1.fastq SRR4237648_2.fastq Input file: SRR4237648_1.fastq Paired file: SRR4237648_2.fastq trimmed: SRR4237648-trimmed-pair1.fastq, SRR4237648-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:34:13 2025 >> started Wed Feb 12 20:36:26 2025 >> done (132.738s) 79236050 read pairs processed; of these: 20161 ( 0.03%) short read pairs filtered out after trimming by size control 20344 ( 0.03%) empty read pairs filtered out after trimming by size control 79195545 (99.95%) read pairs available; of these: 23138042 (29.22%) trimmed read pairs available after processing 56057503 (70.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 89 0.00% 19 126 0.00% 20 81 0.00% 21 120 0.00% 22 87 0.00% 23 95 0.00% 24 54 0.00% 25 70 0.00% 26 65 0.00% 27 71 0.00% 28 73 0.00% 29 58 0.00% 30 59 0.00% 31 52 0.00% 32 60 0.00% 33 54 0.00% 34 66 0.00% 35 74 0.00% 36 61 0.00% 37 72 0.00% 38 86 0.00% 39 99 0.00% 40 105 0.00% 41 137 0.00% 42 150 0.00% 43 168 0.00% 44 162 0.00% 45 211 0.00% 46 213 0.00% 47 228 0.00% 48 289 0.00% 49 323 0.00% 50 343 0.00% 51 444 0.00% 52 433 0.00% 53 467 0.00% 54 515 0.00% 55 540 0.00% 56 563 0.00% 57 635 0.00% 58 749 0.00% 59 796 0.00% 60 936 0.00% 61 1133 0.00% 62 1193 0.00% 63 1288 0.00% 64 1449 0.00% 65 1537 0.00% 66 1704 0.00% 67 1849 0.00% 68 2120 0.00% 69 2367 0.00% 70 3131 0.00% 71 3508 0.00% 72 3254 0.00% 73 3745 0.00% 74 4107 0.01% 75 4470 0.01% 76 4899 0.01% 77 5366 0.01% 78 5739 0.01% 79 6311 0.01% 80 7029 0.01% 81 7611 0.01% 82 8752 0.01% 83 10129 0.01% 84 12472 0.02% 85 14175 0.02% 86 15693 0.02% 87 17037 0.02% 88 18337 0.02% 89 19253 0.02% 90 21056 0.03% 91 23277 0.03% 92 25125 0.03% 93 28468 0.04% 94 33559 0.04% 95 34360 0.04% 96 38703 0.05% 97 38680 0.05% 98 41493 0.05% 99 43788 0.06% 100 46894 0.06% 101 49767 0.06% 102 53663 0.07% 103 58015 0.07% 104 63028 0.08% 105 68126 0.09% 106 74424 0.09% 107 79256 0.10% 108 83341 0.11% 109 87587 0.11% 110 89677 0.11% 111 94971 0.12% 112 101431 0.13% 113 106220 0.13% 114 113379 0.14% 115 122520 0.15% 116 128300 0.16% 117 136208 0.17% 118 143098 0.18% 119 147615 0.19% 120 152636 0.19% 121 156739 0.20% 122 161932 0.20% 123 168313 0.21% 124 175364 0.22% 125 183837 0.23% 126 192661 0.24% 127 203069 0.26% 128 209208 0.26% 129 215058 0.27% 130 222521 0.28% 131 227408 0.29% 132 235127 0.30% 133 242441 0.31% 134 249976 0.32% 135 260069 0.33% 136 274578 0.35% 137 287388 0.36% 138 302514 0.38% 139 319361 0.40% 140 333283 0.42% 141 350617 0.44% 142 374790 0.47% 143 404919 0.51% 144 454705 0.57% 145 531844 0.67% 146 646631 0.82% 147 902590 1.14% 148 1643692 2.08% 149 10679005 13.48% 150 56057503 70.78% 79195545 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=34 prefix-density=0.18 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=283.08 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=29.7 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=31 prefix-density=0.33 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=14 fanout-score=271.42 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=30.5 sequence=AAGAAGAAGAAA SRR4237648 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:37:33 Started mapping on | Feb 12 20:37:33 Finished on | Feb 12 20:44:28 Mapping speed, Million of reads per hour | 687.00 Number of input reads | 79195545 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 75694073 Uniquely mapped reads % | 95.58% Average mapped length | 293.71 Number of splices: Total | 69601454 Number of splices: Annotated (sjdb) | 68315662 Number of splices: GT/AG | 68520375 Number of splices: GC/AG | 830463 Number of splices: AT/AC | 72279 Number of splices: Non-canonical | 178337 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1411748 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 1242655 % of reads mapped to too many loci | 1.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.89% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2120133 2120133 2120133 N_multimapping 1411748 1411748 1411748 N_noFeature 2328854 74268247 3279092 N_ambiguous 825859 7788 344506 UnstrandedReadsAssigned:72539360 PositiveStrandReadsAssigned:1418038 NegativeStrandReadsAssigned:72070475 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237648 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237648-trimmed-pair1.fastq SRR4237648-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 79,195,545 reads, 72,317,268 reads pseudoaligned [quant] estimated average fragment length: 257.146 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,222 rounds 52401 SRR4237648.ke.tsv 34699 SRR4237648.se.tsv 87100 total ==> SRR4237648.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.85 1530 11.5128 Potri.005G024800.1.v4.1 1035 778.854 275 4.68098 Potri.004G059700.1.v4.1 961 704.917 68 1.27889 Potri.007G009000.2.v4.1 1416 1159.85 0 0 Potri.003G141000.2.v4.1 2943 2686.85 1129.09 5.57115 Potri.016G087400.1.v4.1 270 83.8136 9347.13 1478.51 Potri.015G069301.1.v4.1 564 317.234 0 0 Potri.010G195200.1.v4.1 1773 1516.85 149 1.30228 Potri.012G127500.1.v4.1 977 720.889 31098 571.906 ==> SRR4237648.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8358 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 1593 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 26 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR4237648 completed mapping pipeline successfully