Starting /dee2/code/volunteer_pipeline.sh SRR4237649 current disk space = 3050867048448 free memory = 1580485180 SRR4237649 SRAfilesize fe5e9ec5201611088bee5265a28d0515 SRR4237649.sra SRR4237649.sra file validated SRR4237649 is paired end SRR4237649 is conventional basespace SRR4237649 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237649_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.66175 34.0 33.0 34.0 2.0 34.0 2 32.765 34.0 33.0 34.0 28.0 34.0 3 33.0515 34.0 33.0 34.0 32.0 34.0 4 33.385 34.0 33.0 34.0 32.0 34.0 5 33.479 34.0 33.0 34.0 33.0 34.0 6 37.291 38.0 38.0 38.0 36.0 38.0 7 37.49825 38.0 38.0 38.0 37.0 38.0 8 37.6095 38.0 38.0 38.0 38.0 38.0 9 37.6195 38.0 38.0 38.0 38.0 38.0 10-14 37.39125 38.0 38.0 38.0 37.4 38.0 15-19 36.782849999999996 38.0 37.4 38.0 32.6 38.0 20-24 37.48350000000001 38.0 38.0 38.0 37.4 38.0 25-29 37.5838 38.0 38.0 38.0 38.0 38.0 30-34 35.9934 37.8 35.6 38.0 31.8 38.0 35-39 37.3264 38.0 37.8 38.0 36.8 38.0 40-44 37.27095 38.0 38.0 38.0 36.8 38.0 45-49 37.3701 38.0 38.0 38.0 37.0 38.0 50-54 37.33284999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.20005 38.0 38.0 38.0 36.6 38.0 60-64 37.1101 38.0 38.0 38.0 36.4 38.0 65-69 37.1433 38.0 38.0 38.0 36.0 38.0 70-74 37.15075 38.0 38.0 38.0 36.0 38.0 75-79 37.13915 38.0 38.0 38.0 36.0 38.0 80-84 37.063900000000004 38.0 38.0 38.0 36.0 38.0 85-89 37.08855 38.0 38.0 38.0 36.0 38.0 90-94 37.07445 38.0 38.0 38.0 36.0 38.0 95-99 36.9273 38.0 38.0 38.0 35.8 38.0 100-104 36.8765 38.0 38.0 38.0 35.4 38.0 105-109 36.7285 38.0 38.0 38.0 35.0 38.0 110-114 36.56235 38.0 38.0 38.0 34.4 38.0 115-119 36.5844 38.0 38.0 38.0 34.4 38.0 120-124 36.478249999999996 38.0 38.0 38.0 34.0 38.0 125-129 36.356300000000005 38.0 38.0 38.0 34.0 38.0 130-134 36.23955 38.0 38.0 38.0 34.0 38.0 135-139 36.0955 38.0 38.0 38.0 33.0 38.0 140-144 35.93769999999999 38.0 37.2 38.0 33.0 38.0 145-149 35.30305 38.0 36.0 38.0 32.0 38.0 150 30.702 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 2.0 13 0.0 14 1.0 15 1.0 16 1.0 17 0.0 18 2.0 19 1.0 20 0.0 21 4.0 22 3.0 23 6.0 24 3.0 25 9.0 26 10.0 27 17.0 28 22.0 29 23.0 30 36.0 31 41.0 32 56.0 33 72.0 34 98.0 35 187.0 36 564.0 37 2840.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.29445234708393 11.66429587482219 9.72972972972973 47.311522048364154 2 19.675 14.424999999999999 38.725 27.175 3 18.975 16.150000000000002 25.825 39.050000000000004 4 21.275 24.425 23.25 31.05 5 23.925 31.2 24.7 20.175 6 17.825 33.95 26.900000000000002 21.325 7 14.649999999999999 26.700000000000003 40.75 17.9 8 15.125 27.200000000000003 34.35 23.325000000000003 9 16.5 23.474999999999998 36.8 23.225 10-14 18.91 30.48 27.400000000000002 23.21 15-19 18.8 29.25 28.165000000000003 23.785 20-24 18.615000000000002 30.049999999999997 27.32 24.015 25-29 18.965 29.975 27.51 23.549999999999997 30-34 19.10073021906572 29.613884165249576 27.488246473942183 23.797139141742523 35-39 19.532696252564165 29.244008605593635 27.73302646720368 23.490268674638514 40-44 19.148616877594918 29.3882247011155 28.217697964083836 23.245460457205745 45-49 19.63 28.725 27.925 23.72 50-54 19.17 29.115000000000002 28.225 23.49 55-59 19.52 29.56 27.279999999999998 23.64 60-64 19.465 28.865000000000002 27.47 24.2 65-69 19.405 29.225 27.37 24.0 70-74 19.775932779833948 29.623887166149842 27.22816845053516 23.372011603481045 75-79 19.46389277855571 29.370874174834967 27.475495099019803 23.689737947589517 80-84 19.900000000000002 29.065 27.49 23.544999999999998 85-89 19.555 28.63 27.52 24.295 90-94 19.905 28.205000000000002 27.944999999999997 23.945 95-99 19.645000000000003 29.125 27.125 24.104999999999997 100-104 19.54 29.165000000000003 27.405 23.89 105-109 19.875 28.255000000000003 27.779999999999998 24.09 110-114 19.88 28.694999999999997 27.529999999999998 23.895 115-119 19.74 28.87 27.49 23.9 120-124 20.465 28.4 27.700000000000003 23.435 125-129 20.015 28.470000000000002 27.389999999999997 24.125 130-134 19.825 28.405 27.98 23.79 135-139 19.885 28.48 27.42 24.215 140-144 20.525 28.27 27.884999999999998 23.32 145-149 20.495 28.525 26.855 24.125 150 18.718592964824122 28.34170854271357 28.84422110552764 24.095477386934675 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 2.0 24 2.0 25 3.5 26 7.5 27 12.0 28 16.0 29 18.5 30 24.5 31 29.5 32 44.5 33 57.0 34 62.0 35 80.5 36 96.5 37 121.0 38 158.0 39 183.5 40 207.5 41 217.0 42 231.5 43 257.5 44 271.0 45 271.5 46 268.0 47 250.5 48 217.0 49 193.5 50 160.0 51 127.0 52 97.5 53 76.0 54 60.0 55 40.5 56 33.5 57 28.0 58 18.5 59 11.0 60 8.5 61 8.5 62 5.0 63 3.0 64 5.0 65 4.0 66 1.0 67 0.0 68 0.5 69 0.5 70 0.5 71 1.0 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 12.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.03 35-39 0.065 40-44 0.045 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.03 75-79 0.02 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.5 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1625 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.8999999999999999 0.0 0.0 0.0 0.0 114-115 1.0750000000000002 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.3875000000000002 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.6625 0.0 0.0 0.0 0.0 124-125 1.775 0.0 0.0 0.0 0.0 126-127 1.975 0.0 0.0 0.0 0.0 128-129 2.15 0.0 0.0 0.0 0.0 130-131 2.3375000000000004 0.0 0.0 0.0 0.0 132-133 2.5875 0.0 0.0 0.0 0.0 134-135 2.8375 0.0 0.0 0.0 0.0 136-137 3.125 0.0 0.0 0.0 0.0 138 3.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237649 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237649_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82175 33.0 33.0 34.0 32.0 34.0 2 33.017 34.0 33.0 34.0 32.0 34.0 3 33.09075 34.0 33.0 34.0 33.0 34.0 4 33.04325 34.0 33.0 34.0 33.0 34.0 5 32.5845 34.0 33.0 34.0 32.0 34.0 6 37.251 38.0 38.0 38.0 37.0 38.0 7 37.2435 38.0 38.0 38.0 37.0 38.0 8 37.09875 38.0 38.0 38.0 37.0 38.0 9 37.30775 38.0 38.0 38.0 37.0 38.0 10-14 37.23995 38.0 38.0 38.0 37.0 38.0 15-19 37.26475000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.23975 38.0 38.0 38.0 37.0 38.0 25-29 37.20795 38.0 38.0 38.0 37.0 38.0 30-34 37.2384 38.0 38.0 38.0 37.0 38.0 35-39 37.2459 38.0 38.0 38.0 37.0 38.0 40-44 37.105199999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.2231 38.0 38.0 38.0 37.0 38.0 50-54 37.169549999999994 38.0 38.0 38.0 36.8 38.0 55-59 37.106399999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.040949999999995 38.0 38.0 38.0 36.8 38.0 65-69 37.0572 38.0 38.0 38.0 36.6 38.0 70-74 37.03365000000001 38.0 38.0 38.0 36.6 38.0 75-79 36.9616 38.0 38.0 38.0 36.4 38.0 80-84 36.98309999999999 38.0 38.0 38.0 36.2 38.0 85-89 36.9366 38.0 38.0 38.0 36.2 38.0 90-94 36.78724999999999 38.0 38.0 38.0 35.6 38.0 95-99 36.818799999999996 38.0 38.0 38.0 36.0 38.0 100-104 36.642399999999995 38.0 38.0 38.0 35.0 38.0 105-109 36.68645 38.0 38.0 38.0 35.2 38.0 110-114 36.5924 38.0 38.0 38.0 35.0 38.0 115-119 36.619299999999996 38.0 38.0 38.0 35.0 38.0 120-124 36.4778 38.0 38.0 38.0 34.8 38.0 125-129 36.318999999999996 38.0 38.0 38.0 34.0 38.0 130-134 36.25305 38.0 38.0 38.0 34.0 38.0 135-139 36.05745 38.0 38.0 38.0 33.8 38.0 140-144 35.819100000000006 38.0 38.0 38.0 33.2 38.0 145-149 35.519099999999995 38.0 38.0 38.0 33.0 38.0 150 30.977 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 2.0 7 2.0 8 1.0 9 2.0 10 1.0 11 1.0 12 1.0 13 1.0 14 2.0 15 0.0 16 1.0 17 3.0 18 6.0 19 4.0 20 5.0 21 10.0 22 6.0 23 10.0 24 8.0 25 12.0 26 11.0 27 19.0 28 25.0 29 28.0 30 19.0 31 25.0 32 53.0 33 70.0 34 106.0 35 154.0 36 323.0 37 3087.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.527638190954775 19.246231155778894 14.37185929648241 35.85427135678392 2 24.253824931025832 24.57988462503135 35.11412089290193 16.052169551040883 3 19.834503510531594 27.73319959879639 31.59478435305918 20.837512537612838 4 22.04112337011033 31.87061183550652 25.401203610832496 20.68706118355065 5 25.90270812437312 34.3530591775326 23.219658976930795 16.52457372116349 6 20.25 38.725 24.725 16.3 7 19.25 22.55 39.375 18.825 8 21.017034068136272 25.100200400801604 30.91182364729459 22.970941883767534 9 23.240671174555473 23.64137240170298 30.65364387678437 22.464312546957174 10-14 22.775105231509322 29.514932852275006 26.7989577069553 20.911004209260373 15-19 22.620834584208946 28.900230161112777 27.759431602121488 20.71950365255679 20-24 22.810264619078584 29.128107648441798 27.73247961582712 20.329148116652494 25-29 23.21893135881529 27.656593956373825 28.16189713828297 20.962577546527918 30-34 22.947294729472947 28.347834783478348 27.73777377737774 20.96709670967097 35-39 22.895 28.494999999999997 28.105000000000004 20.505000000000003 40-44 23.29027736056874 28.241714228497045 28.021427856213077 20.446580554721137 45-49 22.838270616493194 28.938150520416333 27.53702962369896 20.686549239391514 50-54 23.15699914919173 27.966568239827836 27.966568239827836 20.909864371152594 55-59 23.614941087991976 28.02707445475057 27.896715968914513 20.46126848834294 60-64 22.69585253456221 28.68162692847125 27.800040072129832 20.82248046483671 65-69 22.948685857321653 28.901126408010015 27.99499374217772 20.155193992490613 70-74 23.022231123573004 28.059282996194675 28.444822751852595 20.473663128379734 75-79 23.552104208416832 28.161322645290582 27.650300601202403 20.636272545090183 80-84 23.457840977368317 28.03424794712598 27.788904466252756 20.719006609252954 85-89 23.835 27.965 28.09 20.11 90-94 23.918052494490084 28.035463834902824 27.9052294129433 20.141254257663796 95-99 23.424054432659595 28.497098258955372 27.661596958174904 20.417250350210125 100-104 23.59 28.075 28.685 19.650000000000002 105-109 23.609721944388877 27.945589117823566 28.170634126825366 20.27405481096219 110-114 23.53588397099275 27.651912978244564 28.772193048262068 20.040010002500626 115-119 24.007202160648195 27.998399519855955 27.87836350905272 20.116034810443136 120-124 24.102410241024103 27.53775377537754 28.08780878087809 20.27202720272027 125-129 23.99439663798279 28.732239343606164 27.231338803281968 20.04202521512908 130-134 24.29 28.34 27.54 19.830000000000002 135-139 24.33338336084847 28.175496523087702 27.39506728700786 20.09605282905598 140-144 24.43309806277219 28.382640036041444 27.671822595985386 19.51243930520098 145-149 24.352176088044022 28.109054527263634 27.70385192596298 19.834917458729365 150 24.490822227809907 27.784762383706312 27.784762383706312 19.939653004777472 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 2.0 18 1.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 4.0 25 7.0 26 6.0 27 7.5 28 11.5 29 15.0 30 22.5 31 26.0 32 23.5 33 33.5 34 51.5 35 66.0 36 82.5 37 105.5 38 141.5 39 175.5 40 207.0 41 239.0 42 266.0 43 282.5 44 283.0 45 291.0 46 279.5 47 242.5 48 231.5 49 202.0 50 153.5 51 127.0 52 100.5 53 75.5 54 57.5 55 40.5 56 30.0 57 26.5 58 20.0 59 13.5 60 10.0 61 8.0 62 8.0 63 6.0 64 2.5 65 2.0 66 1.0 67 1.5 68 1.5 69 0.0 70 1.0 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.325 3 0.3 4 0.3 5 0.3 6 0.0 7 0.0 8 0.2 9 0.17500000000000002 10-14 0.22 15-19 0.06999999999999999 20-24 0.045 25-29 0.06 30-34 0.01 35-39 0.0 40-44 0.13 45-49 0.08 50-54 0.095 55-59 0.27499999999999997 60-64 0.18 65-69 0.125 70-74 0.13999999999999999 75-79 0.2 80-84 0.13999999999999999 85-89 0.0 90-94 0.18 95-99 0.06 100-104 0.0 105-109 0.02 110-114 0.025 115-119 0.03 120-124 0.01 125-129 0.06 130-134 0.0 135-139 0.055 140-144 0.11499999999999999 145-149 0.05 150 0.575 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.2005515166708448 0.4 3 0.0 0.0 4 0.0250689395838556 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1625 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 1.0499999999999998 0.0 0.0 0.0 0.0 116-117 1.2000000000000002 0.0 0.0 0.0 0.0 118-119 1.35 0.0 0.0 0.0 0.0 120-121 1.4625 0.0 0.0 0.0 0.0 122-123 1.5875 0.0 0.0 0.0 0.0 124-125 1.7000000000000002 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 2.075 0.0 0.0 0.0 0.0 130-131 2.2375 0.0 0.0 0.0 0.0 132-133 2.4875 0.0 0.0 0.0 0.0 134-135 2.7375 0.0 0.0 0.0 0.0 136-137 3.025 0.0 0.0 0.0 0.0 138 3.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGCAA 10 0.0069611473 144.06328 9 AAATGAA 10 0.0069611473 144.06328 4 >>END_MODULE Read 4376903 spots for SRR4237649.sra Written 4376903 spots for SRR4237649.sra Read 4376903 spots for SRR4237649.sra Written 4376903 spots for SRR4237649.sra Read 4376903 spots for SRR4237649.sra Written 4376903 spots for SRR4237649.sra Read 4376903 spots for SRR4237649.sra Written 4376903 spots for SRR4237649.sra Read 4376903 spots for SRR4237649.sra Written 4376903 spots for SRR4237649.sra Read 4376903 spots for SRR4237649.sra Written 4376903 spots for SRR4237649.sra Read 4376903 spots for SRR4237649.sra Written 4376903 spots for SRR4237649.sra Read 4376903 spots for SRR4237649.sra Written 4376903 spots for SRR4237649.sra Read 4376903 spots for SRR4237649.sra Written 4376903 spots for SRR4237649.sra Read 4376903 spots for SRR4237649.sra Written 4376903 spots for SRR4237649.sra Read 4376920 spots for SRR4237649.sra Written 4376920 spots for SRR4237649.sra Read 4376903 spots for SRR4237649.sra Written 4376903 spots for SRR4237649.sra Read 4376903 spots for SRR4237649.sra Written 4376903 spots for SRR4237649.sra Read 4376903 spots for SRR4237649.sra Written 4376903 spots for SRR4237649.sra Read 4376903 spots for SRR4237649.sra Written 4376903 spots for SRR4237649.sra Read 4376903 spots for SRR4237649.sra Written 4376903 spots for SRR4237649.sra Read 4376903 spots for SRR4237649.sra Written 4376903 spots for SRR4237649.sra Read 4376903 spots for SRR4237649.sra Written 4376903 spots for SRR4237649.sra Read 4376903 spots for SRR4237649.sra Written 4376903 spots for SRR4237649.sra Read 4376903 spots for SRR4237649.sra Written 4376903 spots for SRR4237649.sra SRR ids: ['SRR4237649.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9qsls2y0 SRR4237649.sra spots: 87538077 blocks: [[1, 4376903], [4376904, 8753806], [8753807, 13130709], [13130710, 17507612], [17507613, 21884515], [21884516, 26261418], [26261419, 30638321], [30638322, 35015224], [35015225, 39392127], [39392128, 43769030], [43769031, 48145933], [48145934, 52522836], [52522837, 56899739], [56899740, 61276642], [61276643, 65653545], [65653546, 70030448], [70030449, 74407351], [74407352, 78784254], [78784255, 83161157], [83161158, 87538077]] SRR4237649 file size 29471108 SRR4237649 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237649 SRR4237649_1.fastq SRR4237649_2.fastq Input file: SRR4237649_1.fastq Paired file: SRR4237649_2.fastq trimmed: SRR4237649-trimmed-pair1.fastq, SRR4237649-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:54:42 2025 >> started Wed Feb 12 20:56:12 2025 >> done (90.739s) 87538077 read pairs processed; of these: 32737 ( 0.04%) short read pairs filtered out after trimming by size control 35124 ( 0.04%) empty read pairs filtered out after trimming by size control 87470216 (99.92%) read pairs available; of these: 24193434 (27.66%) trimmed read pairs available after processing 63276782 (72.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 74 0.00% 19 73 0.00% 20 60 0.00% 21 103 0.00% 22 53 0.00% 23 53 0.00% 24 44 0.00% 25 49 0.00% 26 44 0.00% 27 35 0.00% 28 35 0.00% 29 32 0.00% 30 51 0.00% 31 42 0.00% 32 48 0.00% 33 49 0.00% 34 41 0.00% 35 50 0.00% 36 56 0.00% 37 69 0.00% 38 70 0.00% 39 73 0.00% 40 84 0.00% 41 87 0.00% 42 79 0.00% 43 120 0.00% 44 140 0.00% 45 131 0.00% 46 181 0.00% 47 163 0.00% 48 192 0.00% 49 211 0.00% 50 277 0.00% 51 263 0.00% 52 318 0.00% 53 366 0.00% 54 386 0.00% 55 408 0.00% 56 445 0.00% 57 444 0.00% 58 590 0.00% 59 584 0.00% 60 639 0.00% 61 740 0.00% 62 793 0.00% 63 918 0.00% 64 1048 0.00% 65 1170 0.00% 66 1249 0.00% 67 1465 0.00% 68 1581 0.00% 69 2144 0.00% 70 4305 0.00% 71 4664 0.01% 72 3139 0.00% 73 2793 0.00% 74 3073 0.00% 75 3152 0.00% 76 3453 0.00% 77 3771 0.00% 78 4050 0.00% 79 4647 0.01% 80 4813 0.01% 81 5499 0.01% 82 6382 0.01% 83 7238 0.01% 84 10574 0.01% 85 11577 0.01% 86 12659 0.01% 87 13687 0.02% 88 14313 0.02% 89 15226 0.02% 90 16567 0.02% 91 17844 0.02% 92 19694 0.02% 93 21927 0.03% 94 26564 0.03% 95 26393 0.03% 96 30544 0.03% 97 29264 0.03% 98 31080 0.04% 99 32842 0.04% 100 35629 0.04% 101 37424 0.04% 102 40422 0.05% 103 43713 0.05% 104 47391 0.05% 105 51381 0.06% 106 55959 0.06% 107 59625 0.07% 108 62524 0.07% 109 65580 0.07% 110 68664 0.08% 111 72938 0.08% 112 77479 0.09% 113 80917 0.09% 114 86650 0.10% 115 93253 0.11% 116 98851 0.11% 117 104854 0.12% 118 110944 0.13% 119 114831 0.13% 120 118591 0.14% 121 123473 0.14% 122 127988 0.15% 123 132814 0.15% 124 140301 0.16% 125 147069 0.17% 126 154284 0.18% 127 163737 0.19% 128 170551 0.19% 129 176659 0.20% 130 183587 0.21% 131 189912 0.22% 132 197969 0.23% 133 206713 0.24% 134 214895 0.25% 135 225532 0.26% 136 240166 0.27% 137 255189 0.29% 138 270033 0.31% 139 288381 0.33% 140 307134 0.35% 141 328928 0.38% 142 358101 0.41% 143 397589 0.45% 144 458342 0.52% 145 553253 0.63% 146 701881 0.80% 147 1020629 1.17% 148 1939596 2.22% 149 12580954 14.38% 150 63276782 72.34% 87470216 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=10.00 fanout-score-rank=15 prefix-density=0.27 prefix-fanout=5.6 sequence=AAGATCAAATGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=38 fanout-score=228.66 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=21.8 sequence=CCATCATCATGCATGCTCTCCCCCACAAAGAATTGCAAGTCCTTGATTTTTGAAAGCAAGAACTTGGTTGCTCCCTCAATGTTCTTTCTAAAATGTTCCTTCTGGTCCTCATCAAGTTTCTCCGACAGATTCTTGATAAATTTCTTAATCTGTGTAAGAAACTGCTTCTTGTCAAATGGAGGTTGCTCCTGGAGCCTAAATGTGTCAACGATGTCAACAACCTTGGCAGCTTGGTCATCAA criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=35 prefix-density=0.31 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=282.41 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=28.1 sequence=AAGAAGAAGAAG SRR4237649 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:56:55 Started mapping on | Feb 12 20:56:55 Finished on | Feb 12 21:03:29 Mapping speed, Million of reads per hour | 799.22 Number of input reads | 87470216 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 83953634 Uniquely mapped reads % | 95.98% Average mapped length | 295.06 Number of splices: Total | 80294408 Number of splices: Annotated (sjdb) | 78866502 Number of splices: GT/AG | 79006236 Number of splices: GC/AG | 989753 Number of splices: AT/AC | 79446 Number of splices: Non-canonical | 218973 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1652555 % of reads mapped to multiple loci | 1.89% Number of reads mapped to too many loci | 954660 % of reads mapped to too many loci | 1.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.89% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1908925 1908925 1908925 N_multimapping 1652555 1652555 1652555 N_noFeature 2151485 82551597 3007398 N_ambiguous 938251 6299 387684 UnstrandedReadsAssigned:80863898 PositiveStrandReadsAssigned:1395738 NegativeStrandReadsAssigned:80558552 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR4237649 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237649-trimmed-pair1.fastq SRR4237649-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 87,470,216 reads, 80,424,524 reads pseudoaligned [quant] estimated average fragment length: 289.529 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,196 rounds 52401 SRR4237649.ke.tsv 34699 SRR4237649.se.tsv 87100 total ==> SRR4237649.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1729.47 1480 9.83969 Potri.005G024800.1.v4.1 1035 746.471 216 3.32716 Potri.004G059700.1.v4.1 961 672.525 162 2.76974 Potri.007G009000.2.v4.1 1416 1127.47 0 0 Potri.003G141000.2.v4.1 2943 2654.47 1151.14 4.98634 Potri.016G087400.1.v4.1 270 79.1104 11652 1693.56 Potri.015G069301.1.v4.1 564 288.381 0 0 Potri.010G195200.1.v4.1 1773 1484.47 286.795 2.22143 Potri.012G127500.1.v4.1 977 688.487 44250 739.01 ==> SRR4237649.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8176 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 1735 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR4237649 completed mapping pipeline successfully