Starting /dee2/code/volunteer_pipeline.sh SRR4237650 current disk space = 3050949795840 free memory = 1472256772 SRR4237650 SRAfilesize 138c90eb6db364cc960c3bf991889516 SRR4237650.sra SRR4237650.sra file validated SRR4237650 is paired end SRR4237650 is conventional basespace SRR4237650 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237650_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.26825 34.0 33.0 34.0 33.0 34.0 2 33.408 34.0 33.0 34.0 33.0 34.0 3 33.41325 34.0 34.0 34.0 33.0 34.0 4 33.356 34.0 34.0 34.0 33.0 34.0 5 33.40425 34.0 34.0 34.0 33.0 34.0 6 36.74725 38.0 37.0 38.0 35.0 38.0 7 37.337 38.0 38.0 38.0 37.0 38.0 8 37.45425 38.0 38.0 38.0 37.0 38.0 9 37.535 38.0 38.0 38.0 38.0 38.0 10-14 37.53465 38.0 38.0 38.0 38.0 38.0 15-19 37.53385 38.0 38.0 38.0 38.0 38.0 20-24 37.54055 38.0 38.0 38.0 38.0 38.0 25-29 37.470000000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.0975 38.0 38.0 38.0 35.8 38.0 35-39 37.50600000000001 38.0 38.0 38.0 38.0 38.0 40-44 37.43025 38.0 38.0 38.0 37.2 38.0 45-49 37.42755 38.0 38.0 38.0 37.0 38.0 50-54 37.2994 38.0 38.0 38.0 36.8 38.0 55-59 37.23715 38.0 38.0 38.0 36.8 38.0 60-64 37.32955 38.0 38.0 38.0 37.0 38.0 65-69 37.259 38.0 38.0 38.0 37.0 38.0 70-74 37.23555 38.0 38.0 38.0 37.0 38.0 75-79 37.17275 38.0 38.0 38.0 37.0 38.0 80-84 37.085350000000005 38.0 38.0 38.0 36.2 38.0 85-89 37.02334999999999 38.0 38.0 38.0 36.2 38.0 90-94 37.02325 38.0 38.0 38.0 36.2 38.0 95-99 36.984449999999995 38.0 38.0 38.0 36.0 38.0 100-104 36.9032 38.0 38.0 38.0 36.0 38.0 105-109 36.699850000000005 38.0 38.0 38.0 35.2 38.0 110-114 36.61575 38.0 38.0 38.0 34.8 38.0 115-119 35.5916 38.0 36.6 38.0 29.0 38.0 120-124 36.545950000000005 38.0 38.0 38.0 34.6 38.0 125-129 36.475300000000004 38.0 38.0 38.0 34.6 38.0 130-134 36.36875 38.0 38.0 38.0 34.0 38.0 135-139 36.313700000000004 38.0 38.0 38.0 34.0 38.0 140-144 36.0573 38.0 38.0 38.0 33.8 38.0 145-149 34.62215 38.0 35.6 38.0 27.0 38.0 150 30.55575 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 3.0 15 0.0 16 1.0 17 2.0 18 0.0 19 5.0 20 4.0 21 8.0 22 1.0 23 4.0 24 3.0 25 7.0 26 14.0 27 16.0 28 20.0 29 24.0 30 31.0 31 40.0 32 67.0 33 64.0 34 99.0 35 164.0 36 385.0 37 3036.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.20395890754197 12.50313204710599 9.320972187421699 31.971936857930345 2 22.6 16.150000000000002 33.2 28.050000000000004 3 20.724999999999998 22.3 25.674999999999997 31.3 4 23.01726294721041 30.673004753565174 22.742056542406804 23.567675756817614 5 22.325 35.475 22.725 19.475 6 17.599999999999998 36.875 24.474999999999998 21.05 7 13.5 27.125 41.099999999999994 18.275 8 16.650000000000002 25.55 32.475 25.324999999999996 9 17.125 25.45 32.675 24.75 10-14 19.759999999999998 30.380000000000003 27.265 22.595000000000002 15-19 19.64 30.354999999999997 26.75 23.255 20-24 19.38 29.75 27.665 23.205000000000002 25-29 19.21 29.94 27.075 23.775 30-34 19.425 29.525000000000002 27.305 23.745 35-39 19.74 30.04 26.805 23.415 40-44 19.475 30.04 27.155 23.330000000000002 45-49 19.235 29.695 27.52 23.549999999999997 50-54 19.79 29.154999999999998 27.74 23.315 55-59 19.13 29.720000000000002 27.355 23.794999999999998 60-64 19.825 28.799999999999997 27.794999999999998 23.580000000000002 65-69 19.505 30.154999999999998 26.325 24.015 70-74 19.82 29.785 26.55 23.845 75-79 19.48 29.580000000000002 26.900000000000002 24.04 80-84 19.42 29.385 27.79 23.405 85-89 19.625 29.67 27.095000000000002 23.61 90-94 20.330000000000002 28.825 26.900000000000002 23.945 95-99 19.84 29.099999999999998 27.025 24.035 100-104 19.805 29.895 26.955000000000002 23.345 105-109 20.275000000000002 29.07 27.025 23.630000000000003 110-114 20.43 29.43 26.924999999999997 23.215 115-119 20.4 28.83 26.825 23.945 120-124 20.455000000000002 29.485 26.26 23.799999999999997 125-129 20.93 29.415000000000003 26.495 23.16 130-134 20.805 28.43 26.645000000000003 24.12 135-139 20.9 28.705000000000002 26.555 23.84 140-144 21.240000000000002 28.79 25.885 24.085 145-149 20.794999999999998 28.46 26.525 24.22 150 20.538635791593254 28.2154543166373 26.831109992449033 24.414799899320414 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 3.0 23 3.5 24 3.5 25 5.0 26 6.0 27 7.5 28 10.5 29 20.0 30 29.5 31 32.0 32 43.5 33 54.0 34 60.0 35 91.5 36 113.0 37 127.5 38 148.0 39 169.5 40 204.0 41 213.0 42 208.5 43 237.0 44 264.0 45 251.0 46 239.0 47 254.0 48 243.0 49 212.5 50 174.0 51 129.5 52 117.0 53 94.0 54 66.0 55 45.0 56 28.5 57 23.5 58 18.0 59 16.0 60 11.5 61 5.5 62 3.5 63 2.0 64 2.0 65 1.5 66 0.5 67 1.0 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.075 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.675 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0125 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.05 0.025 0.0 0.0 0.0 78-79 0.075 0.025 0.0 0.0 0.0 80-81 0.1125 0.025 0.0 0.0 0.0 82-83 0.125 0.025 0.0 0.0 0.0 84-85 0.16249999999999998 0.025 0.0 0.0 0.0 86-87 0.2625 0.025 0.0 0.0 0.0 88-89 0.2875 0.025 0.0 0.0 0.0 90-91 0.38749999999999996 0.025 0.0 0.0 0.0 92-93 0.475 0.025 0.0 0.0 0.0 94-95 0.675 0.025 0.0 0.0 0.0 96-97 0.85 0.025 0.0 0.0 0.0 98-99 0.9625 0.025 0.0 0.0 0.0 100-101 1.15 0.025 0.0 0.0 0.0 102-103 1.3 0.025 0.0 0.0 0.0 104-105 1.6 0.025 0.0 0.0 0.0 106-107 1.775 0.025 0.0 0.0 0.0 108-109 1.975 0.025 0.0 0.0 0.0 110-111 2.1375 0.025 0.0 0.0 0.0 112-113 2.3125 0.025 0.0 0.0 0.0 114-115 2.6500000000000004 0.025 0.0 0.0 0.0 116-117 2.9625 0.025 0.0 0.0 0.0 118-119 3.4749999999999996 0.025 0.0 0.0 0.0 120-121 4.0875 0.025 0.0 0.0 0.0 122-123 4.4375 0.025 0.0 0.0 0.0 124-125 4.824999999999999 0.025 0.0 0.0 0.0 126-127 5.425 0.025 0.0 0.0 0.0 128-129 5.975 0.025 0.0 0.0 0.0 130-131 6.425 0.025 0.0 0.0 0.0 132-133 6.975 0.025 0.0 0.0 0.0 134-135 7.425 0.025 0.0 0.0 0.0 136-137 8.1625 0.025 0.0 0.0 0.0 138 8.75 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGAAGT 10 0.006973645 144.0 1 >>END_MODULE SRR4237650 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237650_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7545 33.0 33.0 34.0 32.0 34.0 2 32.42325 33.0 33.0 34.0 31.0 34.0 3 32.7045 34.0 33.0 34.0 32.0 34.0 4 32.71375 34.0 33.0 34.0 32.0 34.0 5 32.695 34.0 33.0 34.0 32.0 34.0 6 36.89075 38.0 38.0 38.0 36.0 38.0 7 36.89875 38.0 38.0 38.0 37.0 38.0 8 36.87825 38.0 38.0 38.0 36.0 38.0 9 36.81175 38.0 38.0 38.0 36.0 38.0 10-14 36.8148 38.0 38.0 38.0 36.2 38.0 15-19 36.74705 38.0 38.0 38.0 36.0 38.0 20-24 36.7895 38.0 38.0 38.0 36.2 38.0 25-29 36.72685 38.0 38.0 38.0 36.0 38.0 30-34 35.84035 38.0 37.0 38.0 30.2 38.0 35-39 36.60525 38.0 38.0 38.0 35.8 38.0 40-44 35.33245 38.0 36.2 38.0 28.0 38.0 45-49 35.6584 38.0 36.4 38.0 30.2 38.0 50-54 36.108799999999995 38.0 37.8 38.0 33.0 38.0 55-59 36.4283 38.0 38.0 38.0 35.2 38.0 60-64 36.547250000000005 38.0 38.0 38.0 35.8 38.0 65-69 36.593 38.0 38.0 38.0 36.0 38.0 70-74 36.527649999999994 38.0 38.0 38.0 35.8 38.0 75-79 36.21685 38.0 38.0 38.0 34.2 38.0 80-84 36.3121 38.0 38.0 38.0 34.8 38.0 85-89 36.33305 38.0 38.0 38.0 35.0 38.0 90-94 36.27935 38.0 38.0 38.0 34.4 38.0 95-99 36.2674 38.0 38.0 38.0 34.8 38.0 100-104 36.1964 38.0 38.0 38.0 34.4 38.0 105-109 36.18435000000001 38.0 38.0 38.0 34.2 38.0 110-114 36.021550000000005 38.0 38.0 38.0 34.0 38.0 115-119 35.9168 38.0 38.0 38.0 34.0 38.0 120-124 35.7688 38.0 38.0 38.0 33.8 38.0 125-129 35.699149999999996 38.0 38.0 38.0 33.2 38.0 130-134 35.60445 38.0 38.0 38.0 33.0 38.0 135-139 35.3981 38.0 38.0 38.0 32.0 38.0 140-144 35.138850000000005 38.0 37.6 38.0 31.0 38.0 145-149 34.70085 38.0 37.4 38.0 30.4 38.0 150 28.81625 35.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 13.0 4 7.0 5 8.0 6 2.0 7 4.0 8 2.0 9 2.0 10 3.0 11 3.0 12 1.0 13 3.0 14 2.0 15 5.0 16 5.0 17 8.0 18 3.0 19 9.0 20 7.0 21 8.0 22 2.0 23 11.0 24 13.0 25 14.0 26 29.0 27 20.0 28 24.0 29 34.0 30 41.0 31 33.0 32 69.0 33 67.0 34 104.0 35 171.0 36 430.0 37 2830.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.65 22.525000000000002 11.450000000000001 20.375 2 28.325 25.874999999999996 30.275000000000002 15.525 3 22.425 28.925 31.45 17.2 4 24.25 35.475 22.725 17.549999999999997 5 24.575 38.025 21.9 15.5 6 20.200000000000003 37.475 25.15 17.175 7 20.225 19.900000000000002 41.375 18.5 8 21.95 23.724999999999998 28.299999999999997 26.025 9 21.475 25.25 30.0 23.275000000000002 10-14 23.43 28.299999999999997 27.02 21.25 15-19 23.035 28.12 28.24 20.605 20-24 23.955000000000002 27.794999999999998 27.750000000000004 20.5 25-29 23.71 28.050000000000004 28.02 20.22 30-34 22.75 28.134999999999998 28.665000000000003 20.45 35-39 23.095 27.565 28.37 20.97 40-44 24.08 27.105 28.115000000000002 20.7 45-49 23.28 27.744999999999997 28.4 20.575 50-54 23.380000000000003 28.02 28.27 20.330000000000002 55-59 23.49 27.42 28.560000000000002 20.53 60-64 24.035 27.694999999999997 28.18 20.09 65-69 23.455000000000002 27.6 28.494999999999997 20.45 70-74 24.04 27.71 28.395 19.855 75-79 23.305 27.584999999999997 28.465 20.645 80-84 23.885 27.275 28.46 20.380000000000003 85-89 23.830000000000002 27.21 28.384999999999998 20.575 90-94 23.965 26.83 29.175 20.03 95-99 23.48 27.37 28.76 20.39 100-104 23.880000000000003 27.24 29.104999999999997 19.775000000000002 105-109 23.775 27.375 28.884999999999998 19.965 110-114 24.05 27.82 28.485 19.645000000000003 115-119 24.785 27.29 28.125 19.8 120-124 24.92 27.279999999999998 28.544999999999998 19.255 125-129 24.81 27.05 28.49 19.650000000000002 130-134 24.915000000000003 26.674999999999997 29.14 19.27 135-139 25.245 27.605 27.655 19.495 140-144 24.595 27.950000000000003 28.494999999999997 18.96 145-149 25.195 27.51 27.63 19.665 150 25.674999999999997 27.975 28.000000000000004 18.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.5 19 1.0 20 0.5 21 1.5 22 2.0 23 1.5 24 1.5 25 2.0 26 5.0 27 8.0 28 9.0 29 10.5 30 15.5 31 17.0 32 22.5 33 32.5 34 45.5 35 67.5 36 93.0 37 114.5 38 138.0 39 166.5 40 185.0 41 199.0 42 232.0 43 276.5 44 285.5 45 270.5 46 290.5 47 294.5 48 240.5 49 199.0 50 167.0 51 134.5 52 120.0 53 91.5 54 61.5 55 47.0 56 37.0 57 30.0 58 22.5 59 16.0 60 12.5 61 8.0 62 2.5 63 2.0 64 2.0 65 1.5 66 1.5 67 1.0 68 1.5 69 1.5 70 0.5 71 0.5 72 0.5 73 1.0 74 1.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8500000000000001 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.2 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.0250000000000004 0.0 0.0 0.0 0.0 112-113 2.2249999999999996 0.0 0.0 0.0 0.0 114-115 2.575 0.0 0.0 0.0 0.0 116-117 2.95 0.0 0.0 0.0 0.0 118-119 3.4625 0.0 0.0 0.0 0.0 120-121 4.05 0.0 0.0 0.0 0.0 122-123 4.4375 0.0 0.0 0.0 0.0 124-125 4.8125 0.0 0.0 0.0 0.0 126-127 5.3125 0.0 0.0 0.0 0.0 128-129 5.75 0.0 0.0 0.0 0.0 130-131 6.225 0.0 0.0 0.0 0.0 132-133 6.8 0.0 0.0 0.0 0.0 134-135 7.300000000000001 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138 8.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTAACA 10 0.006973645 144.0 5 AAAAAAA 100 8.420508E-4 11.5199995 135-139 >>END_MODULE Read 1779816 spots for SRR4237650.sra Written 1779816 spots for SRR4237650.sra Read 1779816 spots for SRR4237650.sra Written 1779816 spots for SRR4237650.sra Read 1779816 spots for SRR4237650.sra Written 1779816 spots for SRR4237650.sra Read 1779816 spots for SRR4237650.sra Written 1779816 spots for SRR4237650.sra Read 1779816 spots for SRR4237650.sra Written 1779816 spots for SRR4237650.sra Read 1779816 spots for SRR4237650.sra Written 1779816 spots for SRR4237650.sra Read 1779816 spots for SRR4237650.sra Written 1779816 spots for SRR4237650.sra Read 1779816 spots for SRR4237650.sra Written 1779816 spots for SRR4237650.sra Read 1779816 spots for SRR4237650.sra Written 1779816 spots for SRR4237650.sra Read 1779816 spots for SRR4237650.sra Written 1779816 spots for SRR4237650.sra Read 1779816 spots for SRR4237650.sra Written 1779816 spots for SRR4237650.sra Read 1779816 spots for SRR4237650.sra Written 1779816 spots for SRR4237650.sra Read 1779816 spots for SRR4237650.sra Written 1779816 spots for SRR4237650.sra Read 1779816 spots for SRR4237650.sra Written 1779816 spots for SRR4237650.sra Read 1779816 spots for SRR4237650.sra Written 1779816 spots for SRR4237650.sra Read 1779816 spots for SRR4237650.sra Written 1779816 spots for SRR4237650.sra Read 1779816 spots for SRR4237650.sra Written 1779816 spots for SRR4237650.sra Read 1779816 spots for SRR4237650.sra Written 1779816 spots for SRR4237650.sra Read 1779816 spots for SRR4237650.sra Written 1779816 spots for SRR4237650.sra Read 1779831 spots for SRR4237650.sra Written 1779831 spots for SRR4237650.sra SRR ids: ['SRR4237650.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_afwbj91q SRR4237650.sra spots: 35596335 blocks: [[1, 1779816], [1779817, 3559632], [3559633, 5339448], [5339449, 7119264], [7119265, 8899080], [8899081, 10678896], [10678897, 12458712], [12458713, 14238528], [14238529, 16018344], [16018345, 17798160], [17798161, 19577976], [19577977, 21357792], [21357793, 23137608], [23137609, 24917424], [24917425, 26697240], [26697241, 28477056], [28477057, 30256872], [30256873, 32036688], [32036689, 33816504], [33816505, 35596335]] SRR4237650 file size 11971205 SRR4237650 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237650 SRR4237650_1.fastq SRR4237650_2.fastq Input file: SRR4237650_1.fastq Paired file: SRR4237650_2.fastq trimmed: SRR4237650-trimmed-pair1.fastq, SRR4237650-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:41:57 2025 >> started Wed Feb 12 20:42:40 2025 >> done (43.487s) 35596335 read pairs processed; of these: 86866 ( 0.24%) short read pairs filtered out after trimming by size control 50070 ( 0.14%) empty read pairs filtered out after trimming by size control 35459399 (99.62%) read pairs available; of these: 12017013 (33.89%) trimmed read pairs available after processing 23442386 (66.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 9 0.00% 20 4 0.00% 21 5 0.00% 22 7 0.00% 23 10 0.00% 24 11 0.00% 25 9 0.00% 26 17 0.00% 27 9 0.00% 28 6 0.00% 29 20 0.00% 30 29 0.00% 31 17 0.00% 32 16 0.00% 33 21 0.00% 34 24 0.00% 35 27 0.00% 36 33 0.00% 37 32 0.00% 38 41 0.00% 39 44 0.00% 40 42 0.00% 41 51 0.00% 42 51 0.00% 43 64 0.00% 44 80 0.00% 45 89 0.00% 46 107 0.00% 47 115 0.00% 48 126 0.00% 49 150 0.00% 50 185 0.00% 51 175 0.00% 52 231 0.00% 53 252 0.00% 54 274 0.00% 55 309 0.00% 56 337 0.00% 57 393 0.00% 58 449 0.00% 59 511 0.00% 60 581 0.00% 61 651 0.00% 62 746 0.00% 63 849 0.00% 64 951 0.00% 65 1122 0.00% 66 1276 0.00% 67 1483 0.00% 68 1884 0.01% 69 5186 0.01% 70 4581 0.01% 71 2560 0.01% 72 2647 0.01% 73 2882 0.01% 74 3144 0.01% 75 3546 0.01% 76 3903 0.01% 77 4264 0.01% 78 4812 0.01% 79 5373 0.02% 80 6141 0.02% 81 6996 0.02% 82 7953 0.02% 83 9639 0.03% 84 17822 0.05% 85 16901 0.05% 86 16216 0.05% 87 17033 0.05% 88 18971 0.05% 89 19918 0.06% 90 20324 0.06% 91 21507 0.06% 92 25509 0.07% 93 26553 0.07% 94 28193 0.08% 95 29390 0.08% 96 31112 0.09% 97 32473 0.09% 98 33488 0.09% 99 36452 0.10% 100 38232 0.11% 101 40152 0.11% 102 43788 0.12% 103 45716 0.13% 104 48353 0.14% 105 50857 0.14% 106 53608 0.15% 107 55023 0.16% 108 58879 0.17% 109 60029 0.17% 110 62189 0.18% 111 65699 0.19% 112 67754 0.19% 113 70643 0.20% 114 73401 0.21% 115 76202 0.21% 116 78789 0.22% 117 81424 0.23% 118 83649 0.24% 119 84884 0.24% 120 87522 0.25% 121 89990 0.25% 122 92651 0.26% 123 96064 0.27% 124 99288 0.28% 125 102218 0.29% 126 105208 0.30% 127 107610 0.30% 128 110842 0.31% 129 114816 0.32% 130 117378 0.33% 131 120569 0.34% 132 123835 0.35% 133 127613 0.36% 134 132091 0.37% 135 136478 0.38% 136 141168 0.40% 137 146633 0.41% 138 152575 0.43% 139 158660 0.45% 140 165534 0.47% 141 176773 0.50% 142 188279 0.53% 143 205220 0.58% 144 229871 0.65% 145 269434 0.76% 146 333713 0.94% 147 491827 1.39% 148 774498 2.18% 149 5099962 14.38% 150 23442386 66.11% 35459399 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=36 prefix-density=0.17 prefix-fanout=2.5 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=83.79 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=11.8 sequence=AAAAAAAGAGGGATCTAGCAGAGCACTGCCTCTATCCTGGCAATTCATGAGAAAACCATCACAAAAACGGCGACACAAGTACCGGCTA criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=38 prefix-density=0.14 prefix-fanout=2.2 sequence=CTTGCCACCAAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=43 fanout-score=58.87 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=7.2 sequence=CTCTTCTTTTCTCCCGGAAAATGGCCGGTTTAATTTCAAGATCAGTTCCTTGTGCAATCCTAGTAGTCTTGTGCACGGTGGTGCCCATTTTGGCTAAAGATCACACTGTAGGAGATAGTTCAGGCTGGGCAATTGGTATGGATTATAGCACCTGGACTAGTGGCAAGACCTTTTCAGTTGGCGACAGCCTTGTGTTTAACTACGGAGGAGGCCACACGGTGGATGAAGTGAG SRR4237650 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:43:28 Started mapping on | Feb 12 20:43:28 Finished on | Feb 12 20:47:04 Mapping speed, Million of reads per hour | 590.99 Number of input reads | 35459399 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 34003028 Uniquely mapped reads % | 95.89% Average mapped length | 291.31 Number of splices: Total | 28078804 Number of splices: Annotated (sjdb) | 27569120 Number of splices: GT/AG | 27645028 Number of splices: GC/AG | 325680 Number of splices: AT/AC | 27407 Number of splices: Non-canonical | 80689 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 710102 % of reads mapped to multiple loci | 2.00% Number of reads mapped to too many loci | 112834 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.73% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 804572 804572 804572 N_multimapping 710102 710102 710102 N_noFeature 1028125 33568350 1227433 N_ambiguous 382499 2247 145612 UnstrandedReadsAssigned:32592404 PositiveStrandReadsAssigned:432431 NegativeStrandReadsAssigned:32629983 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237650 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237650-trimmed-pair1.fastq SRR4237650-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,459,399 reads, 32,589,204 reads pseudoaligned [quant] estimated average fragment length: 227.991 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR4237650.ke.tsv 34699 SRR4237650.se.tsv 87100 total ==> SRR4237650.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.01 613 10.8958 Potri.005G024800.1.v4.1 1035 808.009 97 3.82167 Potri.004G059700.1.v4.1 961 734.036 39 1.6914 Potri.007G009000.2.v4.1 1416 1189.01 0 0 Potri.003G141000.2.v4.1 2943 2716.01 399.157 4.67854 Potri.016G087400.1.v4.1 270 86.1473 4549 1681.02 Potri.015G069301.1.v4.1 564 340.828 0 0 Potri.010G195200.1.v4.1 1773 1546.01 456 9.38968 Potri.012G127500.1.v4.1 977 750.03 8871 376.523 ==> SRR4237650.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5766 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 556 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR4237650 completed mapping pipeline successfully