Starting /dee2/code/volunteer_pipeline.sh SRR4237651 current disk space = 3050832609280 free memory = 1581736212 SRR4237651 SRAfilesize bc4cf7b65e48b187544337e6d84943ff SRR4237651.sra SRR4237651.sra file validated SRR4237651 is paired end SRR4237651 is conventional basespace SRR4237651 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237651_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.188 34.0 33.0 34.0 32.0 34.0 2 33.32 34.0 33.0 34.0 33.0 34.0 3 33.37725 34.0 33.0 34.0 33.0 34.0 4 33.29325 34.0 33.0 34.0 33.0 34.0 5 33.303 34.0 33.0 34.0 33.0 34.0 6 33.353 38.0 36.0 38.0 2.0 38.0 7 36.345 38.0 37.0 38.0 31.0 38.0 8 36.6575 38.0 38.0 38.0 31.0 38.0 9 37.31125 38.0 38.0 38.0 37.0 38.0 10-14 37.44075 38.0 38.0 38.0 37.4 38.0 15-19 37.42445 38.0 38.0 38.0 37.0 38.0 20-24 37.373799999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.33375 38.0 38.0 38.0 37.0 38.0 30-34 37.3404 38.0 38.0 38.0 37.0 38.0 35-39 37.33725 38.0 38.0 38.0 37.0 38.0 40-44 37.21424999999999 38.0 38.0 38.0 36.6 38.0 45-49 37.17895 38.0 38.0 38.0 36.8 38.0 50-54 37.1656 38.0 38.0 38.0 36.8 38.0 55-59 37.087950000000006 38.0 38.0 38.0 36.4 38.0 60-64 37.16155 38.0 38.0 38.0 36.4 38.0 65-69 37.0975 38.0 38.0 38.0 36.0 38.0 70-74 36.97324999999999 38.0 38.0 38.0 36.0 38.0 75-79 37.00314999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.861000000000004 38.0 38.0 38.0 35.8 38.0 85-89 36.7647 38.0 38.0 38.0 35.4 38.0 90-94 36.6913 38.0 38.0 38.0 35.2 38.0 95-99 36.5722 38.0 38.0 38.0 35.0 38.0 100-104 36.49395 38.0 38.0 38.0 34.4 38.0 105-109 36.180600000000005 38.0 37.6 38.0 32.8 38.0 110-114 36.3641 38.0 38.0 38.0 34.2 38.0 115-119 36.128099999999996 38.0 37.8 38.0 33.2 38.0 120-124 36.306349999999995 38.0 38.0 38.0 34.0 38.0 125-129 36.1298 38.0 38.0 38.0 33.8 38.0 130-134 35.95295 38.0 37.8 38.0 32.8 38.0 135-139 35.92665 38.0 38.0 38.0 33.4 38.0 140-144 35.6147 38.0 37.2 38.0 32.2 38.0 145-149 34.02175 38.0 34.6 38.0 25.0 38.0 150 30.30475 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 3.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 7.0 18 6.0 19 6.0 20 1.0 21 7.0 22 1.0 23 2.0 24 11.0 25 15.0 26 20.0 27 14.0 28 17.0 29 32.0 30 39.0 31 48.0 32 75.0 33 88.0 34 127.0 35 181.0 36 477.0 37 2820.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.85106382978723 12.165206508135169 8.86107634543179 38.1226533166458 2 24.349999999999998 15.275 32.300000000000004 28.075 3 20.525 19.225 25.6 34.65 4 22.125 28.65 23.474999999999998 25.75 5 23.575 34.325 22.825 19.275000000000002 6 17.954419121734297 36.52028904947193 23.513062812673706 22.012229016120067 7 13.625000000000002 28.749999999999996 40.125 17.5 8 16.75 26.0 32.025 25.224999999999998 9 16.975 25.55 33.575 23.9 10-14 19.395 31.424999999999997 26.875 22.305 15-19 19.505 30.455 27.72 22.32 20-24 19.445 30.56 27.029999999999998 22.965 25-29 19.195 30.535 27.265 23.005 30-34 19.465 30.485 26.779999999999998 23.27 35-39 19.759999999999998 30.09 26.87 23.28 40-44 19.55 30.575000000000003 26.740000000000002 23.135 45-49 19.98 30.095 27.095000000000002 22.830000000000002 50-54 19.400000000000002 29.525000000000002 27.150000000000002 23.925 55-59 19.38 30.095 27.145000000000003 23.380000000000003 60-64 19.48 29.94 27.11 23.47 65-69 19.45 30.03 27.365000000000002 23.155 70-74 19.41 29.65 27.54 23.400000000000002 75-79 19.595000000000002 29.535 27.32 23.549999999999997 80-84 19.564999999999998 30.175 26.77 23.49 85-89 19.36 30.064999999999998 27.045 23.53 90-94 20.165 29.330000000000002 27.169999999999998 23.335 95-99 20.185 29.225 27.005000000000003 23.585 100-104 20.1 29.310000000000002 27.015 23.575 105-109 19.97 29.744999999999997 27.065 23.22 110-114 19.935 29.895 26.745 23.425 115-119 20.225 29.654999999999998 26.33 23.79 120-124 19.975 30.115 25.985000000000003 23.925 125-129 20.8 28.845 26.345000000000002 24.01 130-134 21.005 29.54 26.185000000000002 23.27 135-139 20.635 29.509999999999998 25.88 23.974999999999998 140-144 21.065 29.24 25.779999999999998 23.915 145-149 20.23 29.470000000000002 25.785000000000004 24.515 150 20.7 28.1 25.924999999999997 25.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 1.5 22 1.5 23 2.5 24 3.5 25 6.5 26 6.5 27 9.0 28 18.0 29 19.5 30 26.0 31 36.5 32 46.5 33 62.0 34 74.0 35 97.5 36 115.5 37 133.0 38 146.5 39 169.0 40 206.5 41 231.5 42 256.0 43 258.0 44 243.5 45 238.0 46 246.0 47 236.5 48 209.0 49 193.0 50 156.5 51 113.5 52 99.5 53 91.0 54 67.0 55 41.0 56 31.5 57 26.0 58 17.5 59 16.5 60 15.0 61 8.0 62 5.0 63 3.0 64 1.0 65 2.0 66 3.0 67 2.0 68 0.5 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 10.05 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.6375 0.0 0.0 0.0 0.0 106-107 1.8375 0.0 0.0 0.0 0.0 108-109 2.2 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.7125 0.0 0.0 0.0 0.0 114-115 3.1375 0.0 0.0 0.0 0.0 116-117 3.6375 0.0 0.0 0.0 0.0 118-119 4.0375 0.0 0.0 0.0 0.0 120-121 4.5875 0.0 0.0 0.0 0.0 122-123 5.199999999999999 0.0 0.0 0.0 0.0 124-125 5.8125 0.0 0.0 0.0 0.0 126-127 6.324999999999999 0.0 0.0 0.0 0.0 128-129 6.825 0.0 0.0 0.0 0.0 130-131 7.525 0.0 0.0 0.0 0.0 132-133 8.2375 0.0 0.0 0.0 0.0 134-135 8.975 0.0 0.0 0.0 0.0 136-137 9.4375 0.0 0.0 0.0 0.0 138 9.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237651 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237651_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6175 33.0 33.0 34.0 32.0 34.0 2 32.7915 34.0 33.0 34.0 32.0 34.0 3 32.7795 34.0 33.0 34.0 32.0 34.0 4 32.74525 34.0 33.0 34.0 32.0 34.0 5 32.3865 34.0 33.0 34.0 31.0 34.0 6 36.818 38.0 38.0 38.0 36.0 38.0 7 36.726 38.0 38.0 38.0 35.0 38.0 8 36.84275 38.0 38.0 38.0 36.0 38.0 9 36.916 38.0 38.0 38.0 36.0 38.0 10-14 36.8323 38.0 38.0 38.0 35.8 38.0 15-19 36.8915 38.0 38.0 38.0 36.0 38.0 20-24 36.5869 38.0 38.0 38.0 34.6 38.0 25-29 36.8827 38.0 38.0 38.0 36.0 38.0 30-34 36.7857 38.0 38.0 38.0 36.0 38.0 35-39 36.81735 38.0 38.0 38.0 36.0 38.0 40-44 36.859399999999994 38.0 38.0 38.0 36.0 38.0 45-49 36.7258 38.0 38.0 38.0 35.8 38.0 50-54 36.43065 38.0 38.0 38.0 34.2 38.0 55-59 35.88875 38.0 37.0 38.0 30.6 38.0 60-64 36.5952 38.0 38.0 38.0 35.0 38.0 65-69 36.6362 38.0 38.0 38.0 35.2 38.0 70-74 36.61195 38.0 38.0 38.0 35.4 38.0 75-79 36.613899999999994 38.0 38.0 38.0 35.6 38.0 80-84 36.59734999999999 38.0 38.0 38.0 35.4 38.0 85-89 36.4859 38.0 38.0 38.0 35.0 38.0 90-94 36.3337 38.0 38.0 38.0 34.2 38.0 95-99 36.296350000000004 38.0 38.0 38.0 34.2 38.0 100-104 35.1666 38.0 36.0 38.0 28.2 38.0 105-109 35.44945 38.0 37.2 38.0 28.6 38.0 110-114 36.083 38.0 38.0 38.0 34.0 38.0 115-119 35.94575 38.0 38.0 38.0 33.8 38.0 120-124 35.751549999999995 38.0 38.0 38.0 33.2 38.0 125-129 35.63845 38.0 38.0 38.0 33.0 38.0 130-134 34.9428 38.0 36.8 38.0 27.4 38.0 135-139 35.00905 38.0 36.6 38.0 29.6 38.0 140-144 34.106649999999995 38.0 35.2 38.0 23.8 38.0 145-149 34.064499999999995 38.0 35.4 38.0 24.2 38.0 150 27.33775 33.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 5.0 4 2.0 5 2.0 6 2.0 7 1.0 8 0.0 9 3.0 10 4.0 11 1.0 12 1.0 13 0.0 14 5.0 15 7.0 16 3.0 17 6.0 18 3.0 19 13.0 20 9.0 21 10.0 22 8.0 23 14.0 24 18.0 25 24.0 26 20.0 27 23.0 28 21.0 29 27.0 30 45.0 31 58.0 32 65.0 33 91.0 34 135.0 35 213.0 36 503.0 37 2647.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.525 21.6 13.350000000000001 25.525 2 29.025000000000002 25.474999999999998 30.375000000000004 15.125 3 20.9 28.575 32.775 17.75 4 26.450000000000003 32.175 23.724999999999998 17.65 5 25.275 36.5 22.6 15.625 6 20.7 37.974999999999994 23.95 17.375 7 20.525 20.5 39.85 19.125 8 22.15 25.4 28.575 23.875 9 22.25 24.5 30.55 22.7 10-14 23.52 29.23 26.634999999999998 20.615 15-19 23.805 27.325 28.76 20.11 20-24 23.044999999999998 27.485 28.794999999999998 20.674999999999997 25-29 23.669999999999998 27.279999999999998 28.494999999999997 20.555 30-34 23.53 28.575 28.139999999999997 19.755 35-39 23.44 27.725 27.779999999999998 21.055 40-44 24.135 27.345000000000002 28.815 19.705000000000002 45-49 23.78 27.310000000000002 28.525 20.385 50-54 23.150000000000002 28.1 28.255000000000003 20.495 55-59 23.755000000000003 27.055 28.935 20.255000000000003 60-64 23.52 27.26 29.04 20.18 65-69 23.494999999999997 27.38 28.865000000000002 20.26 70-74 23.635 27.605 28.58 20.18 75-79 23.345 27.384999999999998 29.060000000000002 20.21 80-84 23.085 27.185 29.555 20.175 85-89 23.395 27.245 28.96 20.4 90-94 23.51 27.325 29.15 20.015 95-99 23.385 27.35 29.185 20.080000000000002 100-104 24.11 27.744999999999997 28.565 19.580000000000002 105-109 24.310000000000002 27.575 28.375 19.74 110-114 23.435 27.089999999999996 29.244999999999997 20.23 115-119 24.525 26.825 28.634999999999998 20.015 120-124 24.32 27.415 28.689999999999998 19.575 125-129 23.794999999999998 27.405 28.53 20.27 130-134 24.95 27.025 28.525 19.5 135-139 24.86 26.765 28.485 19.89 140-144 25.085 27.725 27.825 19.365 145-149 25.44 27.865000000000002 27.834999999999997 18.86 150 25.55 26.825 29.125 18.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 1.5 26 4.0 27 6.5 28 8.0 29 12.0 30 24.0 31 28.5 32 29.5 33 40.0 34 59.5 35 74.0 36 90.5 37 106.0 38 132.0 39 170.5 40 211.5 41 236.0 42 248.0 43 279.0 44 285.5 45 274.0 46 271.0 47 251.0 48 221.0 49 196.0 50 162.5 51 131.5 52 104.5 53 85.0 54 69.5 55 47.0 56 31.5 57 26.5 58 18.0 59 8.0 60 6.5 61 9.5 62 9.5 63 8.0 64 5.0 65 3.0 66 2.0 67 1.0 68 2.5 69 2.5 70 1.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69887076537015 99.325 2 0.2509410288582183 0.5 3 0.02509410288582183 0.075 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 1.075 0.0 0.0 0.0 0.0 100-101 1.2625 0.0 0.0 0.0 0.0 102-103 1.4249999999999998 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.7625000000000002 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.2875 0.0 0.0 0.0 0.0 112-113 2.5999999999999996 0.0 0.0 0.0 0.0 114-115 2.9875 0.0 0.0 0.0 0.0 116-117 3.5 0.0 0.0 0.0 0.0 118-119 3.9375 0.0 0.0 0.0 0.0 120-121 4.4875 0.0 0.0 0.0 0.0 122-123 5.0875 0.0 0.0 0.0 0.0 124-125 5.6625 0.0 0.0 0.0 0.0 126-127 6.175000000000001 0.0 0.0 0.0 0.0 128-129 6.6625 0.0 0.0 0.0 0.0 130-131 7.3 0.0 0.0 0.0 0.0 132-133 8.0125 0.0 0.0 0.0 0.0 134-135 8.675 0.0 0.0 0.0 0.0 136-137 9.1125 0.0 0.0 0.0 0.0 138 9.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 20 0.006139246 28.8 20-24 >>END_MODULE Read 2174428 spots for SRR4237651.sra Written 2174428 spots for SRR4237651.sra Read 2174428 spots for SRR4237651.sra Written 2174428 spots for SRR4237651.sra Read 2174428 spots for SRR4237651.sra Written 2174428 spots for SRR4237651.sra Read 2174428 spots for SRR4237651.sra Written 2174428 spots for SRR4237651.sra Read 2174428 spots for SRR4237651.sra Written 2174428 spots for SRR4237651.sra Read 2174428 spots for SRR4237651.sra Written 2174428 spots for SRR4237651.sra Read 2174428 spots for SRR4237651.sra Written 2174428 spots for SRR4237651.sra Read 2174428 spots for SRR4237651.sra Written 2174428 spots for SRR4237651.sra Read 2174428 spots for SRR4237651.sra Written 2174428 spots for SRR4237651.sra Read 2174428 spots for SRR4237651.sra Written 2174428 spots for SRR4237651.sra Read 2174428 spots for SRR4237651.sra Written 2174428 spots for SRR4237651.sra Read 2174428 spots for SRR4237651.sra Written 2174428 spots for SRR4237651.sra Read 2174428 spots for SRR4237651.sra Written 2174428 spots for SRR4237651.sra Read 2174445 spots for SRR4237651.sra Written 2174445 spots for SRR4237651.sra Read 2174428 spots for SRR4237651.sra Written 2174428 spots for SRR4237651.sra Read 2174428 spots for SRR4237651.sra Written 2174428 spots for SRR4237651.sra Read 2174428 spots for SRR4237651.sra Written 2174428 spots for SRR4237651.sra Read 2174428 spots for SRR4237651.sra Written 2174428 spots for SRR4237651.sra Read 2174428 spots for SRR4237651.sra Written 2174428 spots for SRR4237651.sra Read 2174428 spots for SRR4237651.sra Written 2174428 spots for SRR4237651.sra SRR ids: ['SRR4237651.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3cc5t_hy SRR4237651.sra spots: 43488577 blocks: [[1, 2174428], [2174429, 4348856], [4348857, 6523284], [6523285, 8697712], [8697713, 10872140], [10872141, 13046568], [13046569, 15220996], [15220997, 17395424], [17395425, 19569852], [19569853, 21744280], [21744281, 23918708], [23918709, 26093136], [26093137, 28267564], [28267565, 30441992], [30441993, 32616420], [32616421, 34790848], [34790849, 36965276], [36965277, 39139704], [39139705, 41314132], [41314133, 43488577]] SRR4237651 file size 14630212 SRR4237651 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237651 SRR4237651_1.fastq SRR4237651_2.fastq Input file: SRR4237651_1.fastq Paired file: SRR4237651_2.fastq trimmed: SRR4237651-trimmed-pair1.fastq, SRR4237651-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:44:12 2025 >> started Wed Feb 12 20:45:04 2025 >> done (51.857s) 43488577 read pairs processed; of these: 93069 ( 0.21%) short read pairs filtered out after trimming by size control 93175 ( 0.21%) empty read pairs filtered out after trimming by size control 43302333 (99.57%) read pairs available; of these: 15893959 (36.70%) trimmed read pairs available after processing 27408374 (63.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 12 0.00% 20 6 0.00% 21 6 0.00% 22 6 0.00% 23 9 0.00% 24 10 0.00% 25 9 0.00% 26 10 0.00% 27 15 0.00% 28 13 0.00% 29 17 0.00% 30 20 0.00% 31 22 0.00% 32 23 0.00% 33 19 0.00% 34 21 0.00% 35 25 0.00% 36 32 0.00% 37 30 0.00% 38 52 0.00% 39 38 0.00% 40 55 0.00% 41 53 0.00% 42 81 0.00% 43 69 0.00% 44 93 0.00% 45 89 0.00% 46 114 0.00% 47 159 0.00% 48 157 0.00% 49 189 0.00% 50 198 0.00% 51 219 0.00% 52 276 0.00% 53 281 0.00% 54 342 0.00% 55 340 0.00% 56 402 0.00% 57 439 0.00% 58 504 0.00% 59 583 0.00% 60 679 0.00% 61 808 0.00% 62 866 0.00% 63 1034 0.00% 64 1171 0.00% 65 1325 0.00% 66 1612 0.00% 67 2202 0.01% 68 3097 0.01% 69 6067 0.01% 70 5217 0.01% 71 3592 0.01% 72 3287 0.01% 73 3580 0.01% 74 3839 0.01% 75 4490 0.01% 76 4849 0.01% 77 5341 0.01% 78 5880 0.01% 79 6643 0.02% 80 7403 0.02% 81 8680 0.02% 82 10082 0.02% 83 11942 0.03% 84 23652 0.05% 85 18445 0.04% 86 20691 0.05% 87 22293 0.05% 88 22828 0.05% 89 23110 0.05% 90 26237 0.06% 91 29100 0.07% 92 31448 0.07% 93 32845 0.08% 94 34844 0.08% 95 37375 0.09% 96 40050 0.09% 97 42585 0.10% 98 45225 0.10% 99 47734 0.11% 100 50712 0.12% 101 53293 0.12% 102 57421 0.13% 103 61486 0.14% 104 65445 0.15% 105 68973 0.16% 106 72832 0.17% 107 75837 0.18% 108 78845 0.18% 109 82817 0.19% 110 84498 0.20% 111 88392 0.20% 112 92593 0.21% 113 96904 0.22% 114 100978 0.23% 115 105605 0.24% 116 109108 0.25% 117 113842 0.26% 118 118145 0.27% 119 120022 0.28% 120 121428 0.28% 121 125900 0.29% 122 127520 0.29% 123 133240 0.31% 124 137433 0.32% 125 143158 0.33% 126 147163 0.34% 127 151097 0.35% 128 155235 0.36% 129 160104 0.37% 130 164437 0.38% 131 166921 0.39% 132 170837 0.39% 133 175479 0.41% 134 179813 0.42% 135 186757 0.43% 136 194546 0.45% 137 201150 0.46% 138 211400 0.49% 139 220080 0.51% 140 230730 0.53% 141 242335 0.56% 142 258078 0.60% 143 280886 0.65% 144 309355 0.71% 145 357268 0.83% 146 432918 1.00% 147 593708 1.37% 148 1010612 2.33% 149 6599431 15.24% 150 27408374 63.30% 43302333 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=34 prefix-density=0.17 prefix-fanout=2.3 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=102.09 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.4 sequence=CAAACAAAGCAGCACAAGATGCTGCTTATTTTATTACATACCAAACCATTAATATAAAATTCATCAACCTACTTGGAACCAACAAGAACATCCCACAAGGCATCTCTGCTCCAAATCAAAGATCAAATGCATCCATGCGGTGAG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=6.74 fanout-score-rank=20 prefix-density=0.25 prefix-fanout=4.6 sequence=CAGCACCAGCACCTGAAAAGCCAAAGAAGAGATCCAAAGCTGCAGCGAGTCCAGAATCTCCTGCGGATACTTCTGGGGCAGTAAGCTTTACTGTTCTGAACAATGTTGTGTTCTTTGGAGTTTGCATGGTTGCAGCAATATATTCTTTGTGACACAGAAGGTTTTGATGAGGTTATTGCATGGATTGCTCTCGTTTTTTTAAGTGGGCTATGATTTTGTAGAGTCGGATCGAATCCAATGATTTGTGTGAATAATTGTTGTTATGGTCTCATTGTACCATTCAAGTTTATGCTTAAGATTGAATTTTGAGGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=8 fanout-score=50.57 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=13.8 sequence=TGTTGGTGGTGGTACTGGAGCTGT SRR4237651 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:45:46 Started mapping on | Feb 12 20:45:47 Finished on | Feb 12 20:49:32 Mapping speed, Million of reads per hour | 692.84 Number of input reads | 43302333 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 41423669 Uniquely mapped reads % | 95.66% Average mapped length | 290.55 Number of splices: Total | 30524715 Number of splices: Annotated (sjdb) | 29915968 Number of splices: GT/AG | 30039496 Number of splices: GC/AG | 350481 Number of splices: AT/AC | 30463 Number of splices: Non-canonical | 104275 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 971502 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 142159 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.70% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 959098 959098 959098 N_multimapping 971502 971502 971502 N_noFeature 1272528 40759820 1599956 N_ambiguous 511213 3295 172379 UnstrandedReadsAssigned:39639928 PositiveStrandReadsAssigned:660554 NegativeStrandReadsAssigned:39651334 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237651 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237651-trimmed-pair1.fastq SRR4237651-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,302,333 reads, 39,729,634 reads pseudoaligned [quant] estimated average fragment length: 217.742 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52401 SRR4237651.ke.tsv 34699 SRR4237651.se.tsv 87100 total ==> SRR4237651.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.26 923 13.3899 Potri.005G024800.1.v4.1 1035 818.258 91 2.90604 Potri.004G059700.1.v4.1 961 744.277 37 1.29903 Potri.007G009000.2.v4.1 1416 1199.26 0 0 Potri.003G141000.2.v4.1 2943 2726.26 401.081 3.84429 Potri.016G087400.1.v4.1 270 88.6536 5666.58 1670.23 Potri.015G069301.1.v4.1 564 349.866 0 0 Potri.010G195200.1.v4.1 1773 1556.26 250 4.19768 Potri.012G127500.1.v4.1 977 760.271 10103 347.243 ==> SRR4237651.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7856 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 621 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 21 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR4237651 completed mapping pipeline successfully