Starting /dee2/code/volunteer_pipeline.sh SRR4237652 current disk space = 3050870095872 free memory = 1581579716 SRR4237652 SRAfilesize 836fe98b48fa29a75df023f80ac0384a SRR4237652.sra SRR4237652.sra file validated SRR4237652 is paired end SRR4237652 is conventional basespace SRR4237652 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237652_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2125 34.0 33.0 34.0 32.0 34.0 2 33.29525 34.0 33.0 34.0 33.0 34.0 3 33.3335 34.0 33.0 34.0 33.0 34.0 4 33.322 34.0 33.0 34.0 33.0 34.0 5 33.3015 34.0 33.0 34.0 33.0 34.0 6 36.7625 38.0 37.0 38.0 35.0 38.0 7 37.1715 38.0 38.0 38.0 36.0 38.0 8 37.3625 38.0 38.0 38.0 37.0 38.0 9 37.405 38.0 38.0 38.0 37.0 38.0 10-14 37.416250000000005 38.0 38.0 38.0 37.2 38.0 15-19 37.4096 38.0 38.0 38.0 37.0 38.0 20-24 37.40885 38.0 38.0 38.0 37.0 38.0 25-29 37.419349999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.373450000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.3474 38.0 38.0 38.0 37.0 38.0 40-44 37.2478 38.0 38.0 38.0 36.6 38.0 45-49 37.1502 38.0 38.0 38.0 36.0 38.0 50-54 37.13765 38.0 38.0 38.0 36.0 38.0 55-59 37.0671 38.0 38.0 38.0 36.0 38.0 60-64 37.06385 38.0 38.0 38.0 36.0 38.0 65-69 37.06635 38.0 38.0 38.0 36.0 38.0 70-74 36.9357 38.0 38.0 38.0 35.8 38.0 75-79 36.4077 38.0 37.4 38.0 33.4 38.0 80-84 36.7883 38.0 38.0 38.0 35.0 38.0 85-89 36.4373 38.0 37.6 38.0 33.0 38.0 90-94 36.5606 38.0 37.8 38.0 34.2 38.0 95-99 36.62405 38.0 38.0 38.0 34.6 38.0 100-104 36.5171 38.0 38.0 38.0 34.0 38.0 105-109 36.459900000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.368050000000004 38.0 38.0 38.0 33.8 38.0 115-119 36.288650000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.2253 38.0 38.0 38.0 33.6 38.0 125-129 36.1686 38.0 37.6 38.0 33.6 38.0 130-134 35.869299999999996 38.0 36.8 38.0 32.6 38.0 135-139 35.77695 38.0 36.2 38.0 32.6 38.0 140-144 35.4981 38.0 36.0 38.0 31.0 38.0 145-149 35.05615 38.0 36.0 38.0 31.2 38.0 150 29.55875 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 3.0 15 1.0 16 0.0 17 3.0 18 2.0 19 5.0 20 1.0 21 1.0 22 2.0 23 11.0 24 5.0 25 14.0 26 17.0 27 15.0 28 30.0 29 32.0 30 30.0 31 51.0 32 52.0 33 85.0 34 141.0 35 229.0 36 539.0 37 2730.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.025 12.2 8.649999999999999 37.125 2 23.417563172379285 14.585939454590942 35.02626970227671 26.970227670753065 3 20.325 19.325 26.424999999999997 33.925 4 22.55 30.775000000000002 22.175 24.5 5 22.900000000000002 34.9 22.325 19.875 6 18.234261349385502 36.14246300476549 23.927765237020317 21.695510408828696 7 13.525 27.250000000000004 41.475 17.75 8 17.45 25.025 31.55 25.974999999999998 9 16.35 25.25 35.375 23.025000000000002 10-14 19.66 30.035 26.565 23.74 15-19 19.54 29.104999999999997 27.85 23.505000000000003 20-24 19.8 28.775000000000002 27.700000000000003 23.724999999999998 25-29 19.715 29.595 26.935 23.755000000000003 30-34 19.74 29.349999999999998 27.24 23.669999999999998 35-39 19.675 29.435 27.27 23.62 40-44 19.265 29.744999999999997 27.22 23.77 45-49 19.905 29.095 27.3 23.7 50-54 19.855 29.535 27.055 23.555 55-59 19.919999999999998 28.355000000000004 27.544999999999998 24.18 60-64 20.24 29.18 27.08 23.5 65-69 19.98 29.01 27.41 23.599999999999998 70-74 19.355 29.75 27.02 23.875 75-79 19.8 28.625 27.544999999999998 24.03 80-84 19.755 29.715000000000003 26.875 23.655 85-89 20.805 28.65 27.075 23.47 90-94 20.07 29.035 26.905 23.990000000000002 95-99 20.36 28.52 27.560000000000002 23.56 100-104 20.165 28.449999999999996 27.450000000000003 23.935000000000002 105-109 20.305 28.485 27.195000000000004 24.015 110-114 20.085 28.875 27.525 23.515 115-119 20.72 28.565 26.889999999999997 23.825 120-124 20.705000000000002 28.275 26.995 24.025 125-129 20.349999999999998 28.59 27.005000000000003 24.055 130-134 20.7 28.21 26.834999999999997 24.255 135-139 20.685000000000002 28.38 26.355 24.58 140-144 20.385 29.020000000000003 26.26 24.335 145-149 20.43 28.605000000000004 26.669999999999998 24.295 150 19.748110831234257 28.790931989924434 26.347607052896727 25.113350125944585 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 4.0 26 4.5 27 10.0 28 13.0 29 12.0 30 18.0 31 31.5 32 38.5 33 44.0 34 62.0 35 81.0 36 94.5 37 111.5 38 135.0 39 179.0 40 197.0 41 213.0 42 244.5 43 253.0 44 271.5 45 269.5 46 245.5 47 235.5 48 213.0 49 191.5 50 172.0 51 136.5 52 115.0 53 97.5 54 74.0 55 55.5 56 42.0 57 30.0 58 23.5 59 17.0 60 12.0 61 9.0 62 8.5 63 9.0 64 5.5 65 3.0 66 3.0 67 1.0 68 0.5 69 1.5 70 3.0 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.325 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.5750000000000002 0.0 0.0 0.0 0.0 110-111 1.9249999999999998 0.0 0.0 0.0 0.0 112-113 2.25 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.9375 0.0 0.0 0.0 0.0 118-119 3.3375 0.0 0.0 0.0 0.0 120-121 3.6625 0.0 0.0 0.0 0.0 122-123 4.0 0.0 0.0 0.0 0.0 124-125 4.4625 0.0 0.0 0.0 0.0 126-127 4.85 0.0 0.0 0.0 0.0 128-129 5.324999999999999 0.0 0.0 0.0 0.0 130-131 5.8375 0.0 0.0 0.0 0.0 132-133 6.3875 0.0 0.0 0.0 0.0 134-135 6.975 0.0 0.0 0.0 0.0 136-137 7.6625 0.0 0.0 0.0 0.0 138 8.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 20 0.006154893 28.784998 100-104 >>END_MODULE SRR4237652 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237652_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.52525 33.0 33.0 34.0 32.0 34.0 2 32.7255 33.0 33.0 34.0 32.0 34.0 3 31.3495 33.0 32.0 34.0 25.0 34.0 4 32.33925 33.0 33.0 34.0 31.0 34.0 5 32.63125 33.0 33.0 34.0 32.0 34.0 6 36.94175 38.0 38.0 38.0 36.0 38.0 7 37.12225 38.0 38.0 38.0 37.0 38.0 8 36.90975 38.0 38.0 38.0 36.0 38.0 9 37.03375 38.0 38.0 38.0 36.0 38.0 10-14 36.49395 38.0 37.6 38.0 33.8 38.0 15-19 36.621900000000004 38.0 37.8 38.0 34.6 38.0 20-24 37.056400000000004 38.0 38.0 38.0 36.8 38.0 25-29 37.0141 38.0 38.0 38.0 37.0 38.0 30-34 36.9391 38.0 38.0 38.0 36.6 38.0 35-39 36.507549999999995 38.0 37.8 38.0 34.2 38.0 40-44 36.84035 38.0 38.0 38.0 36.0 38.0 45-49 36.88074999999999 38.0 38.0 38.0 36.2 38.0 50-54 36.86075 38.0 38.0 38.0 36.0 38.0 55-59 36.850950000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.87145 38.0 38.0 38.0 36.0 38.0 65-69 36.7049 38.0 38.0 38.0 35.8 38.0 70-74 36.6998 38.0 38.0 38.0 35.8 38.0 75-79 36.725699999999996 38.0 38.0 38.0 35.8 38.0 80-84 36.597699999999996 38.0 38.0 38.0 35.4 38.0 85-89 36.54445 38.0 38.0 38.0 35.2 38.0 90-94 36.55625 38.0 38.0 38.0 35.0 38.0 95-99 35.9024 38.0 37.4 38.0 31.8 38.0 100-104 36.360850000000006 38.0 38.0 38.0 34.4 38.0 105-109 36.324799999999996 38.0 38.0 38.0 34.2 38.0 110-114 36.23855 38.0 38.0 38.0 34.0 38.0 115-119 34.220600000000005 37.2 31.6 38.0 28.0 38.0 120-124 35.66 38.0 37.2 38.0 31.8 38.0 125-129 35.95174999999999 38.0 38.0 38.0 33.8 38.0 130-134 35.69415 38.0 37.8 38.0 32.4 38.0 135-139 35.49040000000001 38.0 37.4 38.0 32.0 38.0 140-144 33.92485 38.0 33.8 38.0 25.4 38.0 145-149 34.4186 38.0 35.4 38.0 28.8 38.0 150 28.188 33.0 26.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 4.0 4 3.0 5 4.0 6 2.0 7 2.0 8 1.0 9 2.0 10 1.0 11 1.0 12 1.0 13 2.0 14 0.0 15 3.0 16 2.0 17 6.0 18 5.0 19 10.0 20 4.0 21 0.0 22 6.0 23 18.0 24 12.0 25 17.0 26 19.0 27 19.0 28 26.0 29 27.0 30 51.0 31 58.0 32 62.0 33 77.0 34 132.0 35 203.0 36 541.0 37 2668.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.699999999999996 20.849999999999998 12.8 25.650000000000002 2 26.674999999999997 25.2 32.45 15.675 3 21.2 26.674999999999997 33.7 18.425 4 26.125 32.300000000000004 23.45 18.125 5 26.05 36.475 22.675 14.799999999999999 6 20.65 38.175 23.375 17.8 7 20.9 21.15 39.75 18.2 8 21.15 24.325 29.2 25.324999999999996 9 22.275 23.25 31.374999999999996 23.1 10-14 24.154999999999998 28.63 25.94 21.275 15-19 23.625 27.065 28.494999999999997 20.815 20-24 23.3 28.23 27.639999999999997 20.830000000000002 25-29 23.965 27.825 27.57 20.64 30-34 23.375 28.444999999999997 27.72 20.46 35-39 23.185 28.28 27.97 20.565 40-44 24.2 27.644999999999996 27.935 20.22 45-49 24.02 27.63 28.075 20.275000000000002 50-54 23.73 28.13 27.495000000000005 20.645 55-59 23.61 27.779999999999998 27.884999999999998 20.724999999999998 60-64 23.205000000000002 28.335 28.449999999999996 20.01 65-69 23.095 27.950000000000003 28.715000000000003 20.24 70-74 24.18 27.685 27.765 20.369999999999997 75-79 23.04 27.625 29.060000000000002 20.275000000000002 80-84 23.995 27.415 28.189999999999998 20.4 85-89 23.87 27.42 28.749999999999996 19.96 90-94 23.44 27.810000000000002 28.42 20.330000000000002 95-99 23.75 27.584999999999997 28.16 20.505000000000003 100-104 24.41 27.815 27.715 20.06 105-109 24.04 27.83 27.92 20.21 110-114 23.849999999999998 27.935 28.645 19.57 115-119 24.94 27.644999999999996 27.61 19.805 120-124 24.26 27.93 28.415000000000003 19.395 125-129 24.535 27.474999999999998 27.815 20.175 130-134 25.27 27.83 27.6 19.3 135-139 24.7 27.93 27.55 19.82 140-144 25.28 27.560000000000002 27.715 19.445 145-149 25.365 27.939999999999998 27.295 19.400000000000002 150 25.324999999999996 28.025 27.224999999999998 19.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 0.5 21 1.0 22 0.5 23 0.5 24 1.5 25 2.5 26 3.0 27 4.5 28 6.0 29 10.5 30 11.0 31 16.0 32 21.0 33 31.5 34 52.5 35 64.0 36 79.0 37 101.5 38 137.5 39 164.0 40 198.0 41 229.0 42 259.0 43 278.0 44 285.0 45 287.0 46 275.5 47 265.5 48 227.5 49 187.5 50 169.0 51 143.5 52 120.0 53 98.0 54 71.0 55 57.0 56 41.0 57 26.5 58 16.5 59 13.5 60 9.5 61 5.5 62 5.5 63 6.0 64 4.0 65 2.0 66 2.0 67 2.5 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.425 0.0 0.0 0.0 0.0 108-109 1.5750000000000002 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 3.1625 0.0 0.0 0.0 0.0 120-121 3.4875 0.0 0.0 0.0 0.0 122-123 3.8125 0.0 0.0 0.0 0.0 124-125 4.2875 0.0 0.0 0.0 0.0 126-127 4.675 0.0 0.0 0.0 0.0 128-129 5.137499999999999 0.0 0.0 0.0 0.0 130-131 5.65 0.0 0.0 0.0 0.0 132-133 6.1375 0.0 0.0 0.0 0.0 134-135 6.725 0.0 0.0 0.0 0.0 136-137 7.4125 0.0 0.0 0.0 0.0 138 7.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2096761 spots for SRR4237652.sra Written 2096761 spots for SRR4237652.sra Read 2096761 spots for SRR4237652.sra Written 2096761 spots for SRR4237652.sra Read 2096761 spots for SRR4237652.sra Written 2096761 spots for SRR4237652.sra Read 2096761 spots for SRR4237652.sra Written 2096761 spots for SRR4237652.sra Read 2096761 spots for SRR4237652.sra Written 2096761 spots for SRR4237652.sra Read 2096761 spots for SRR4237652.sra Written 2096761 spots for SRR4237652.sra Read 2096761 spots for SRR4237652.sra Written 2096761 spots for SRR4237652.sra Read 2096761 spots for SRR4237652.sra Written 2096761 spots for SRR4237652.sra Read 2096761 spots for SRR4237652.sra Written 2096761 spots for SRR4237652.sra Read 2096761 spots for SRR4237652.sra Written 2096761 spots for SRR4237652.sra Read 2096761 spots for SRR4237652.sra Written 2096761 spots for SRR4237652.sra Read 2096761 spots for SRR4237652.sra Written 2096761 spots for SRR4237652.sra Read 2096761 spots for SRR4237652.sra Written 2096761 spots for SRR4237652.sra Read 2096761 spots for SRR4237652.sra Written 2096761 spots for SRR4237652.sra Read 2096761 spots for SRR4237652.sra Written 2096761 spots for SRR4237652.sra Read 2096761 spots for SRR4237652.sra Written 2096761 spots for SRR4237652.sra Read 2096761 spots for SRR4237652.sra Written 2096761 spots for SRR4237652.sra Read 2096761 spots for SRR4237652.sra Written 2096761 spots for SRR4237652.sra Read 2096761 spots for SRR4237652.sra Written 2096761 spots for SRR4237652.sra Read 2096766 spots for SRR4237652.sra Written 2096766 spots for SRR4237652.sra SRR ids: ['SRR4237652.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xyrbnqu6 SRR4237652.sra spots: 41935225 blocks: [[1, 2096761], [2096762, 4193522], [4193523, 6290283], [6290284, 8387044], [8387045, 10483805], [10483806, 12580566], [12580567, 14677327], [14677328, 16774088], [16774089, 18870849], [18870850, 20967610], [20967611, 23064371], [23064372, 25161132], [25161133, 27257893], [27257894, 29354654], [29354655, 31451415], [31451416, 33548176], [33548177, 35644937], [35644938, 37741698], [37741699, 39838459], [39838460, 41935225]] SRR4237652 file size 14106866 SRR4237652 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237652 SRR4237652_1.fastq SRR4237652_2.fastq Input file: SRR4237652_1.fastq Paired file: SRR4237652_2.fastq trimmed: SRR4237652-trimmed-pair1.fastq, SRR4237652-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:56:29 2025 >> started Wed Feb 12 20:57:16 2025 >> done (47.071s) 41935225 read pairs processed; of these: 86336 ( 0.21%) short read pairs filtered out after trimming by size control 53353 ( 0.13%) empty read pairs filtered out after trimming by size control 41795536 (99.67%) read pairs available; of these: 15094856 (36.12%) trimmed read pairs available after processing 26700680 (63.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 8 0.00% 20 6 0.00% 21 1 0.00% 22 4 0.00% 23 8 0.00% 24 6 0.00% 25 4 0.00% 26 9 0.00% 27 16 0.00% 28 10 0.00% 29 15 0.00% 30 12 0.00% 31 11 0.00% 32 22 0.00% 33 17 0.00% 34 21 0.00% 35 31 0.00% 36 21 0.00% 37 23 0.00% 38 48 0.00% 39 34 0.00% 40 56 0.00% 41 59 0.00% 42 54 0.00% 43 62 0.00% 44 64 0.00% 45 94 0.00% 46 84 0.00% 47 111 0.00% 48 125 0.00% 49 143 0.00% 50 139 0.00% 51 215 0.00% 52 212 0.00% 53 235 0.00% 54 246 0.00% 55 289 0.00% 56 325 0.00% 57 372 0.00% 58 472 0.00% 59 497 0.00% 60 637 0.00% 61 656 0.00% 62 731 0.00% 63 878 0.00% 64 961 0.00% 65 1091 0.00% 66 1326 0.00% 67 1639 0.00% 68 2128 0.01% 69 3052 0.01% 70 2622 0.01% 71 2451 0.01% 72 2791 0.01% 73 3111 0.01% 74 3460 0.01% 75 3701 0.01% 76 4412 0.01% 77 4799 0.01% 78 5356 0.01% 79 5813 0.01% 80 6690 0.02% 81 7736 0.02% 82 8880 0.02% 83 10527 0.03% 84 17815 0.04% 85 20278 0.05% 86 17439 0.04% 87 20743 0.05% 88 24693 0.06% 89 20970 0.05% 90 22329 0.05% 91 25131 0.06% 92 27979 0.07% 93 27525 0.07% 94 30600 0.07% 95 32852 0.08% 96 34642 0.08% 97 36831 0.09% 98 38677 0.09% 99 40949 0.10% 100 44102 0.11% 101 46387 0.11% 102 49242 0.12% 103 52613 0.13% 104 55411 0.13% 105 58925 0.14% 106 62196 0.15% 107 64992 0.16% 108 68682 0.16% 109 73098 0.17% 110 75630 0.18% 111 76561 0.18% 112 79746 0.19% 113 82643 0.20% 114 85956 0.21% 115 90413 0.22% 116 93246 0.22% 117 96477 0.23% 118 100833 0.24% 119 102778 0.25% 120 106277 0.25% 121 109452 0.26% 122 110229 0.26% 123 113630 0.27% 124 119018 0.28% 125 121894 0.29% 126 126229 0.30% 127 129269 0.31% 128 132973 0.32% 129 136949 0.33% 130 142302 0.34% 131 144371 0.35% 132 149339 0.36% 133 154966 0.37% 134 159275 0.38% 135 164767 0.39% 136 171861 0.41% 137 178176 0.43% 138 186360 0.45% 139 195106 0.47% 140 204171 0.49% 141 217946 0.52% 142 234952 0.56% 143 256485 0.61% 144 291048 0.70% 145 334702 0.80% 146 413473 0.99% 147 573798 1.37% 148 1048111 2.51% 149 6678712 15.98% 150 26700680 63.88% 41795536 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=40 prefix-density=0.28 prefix-fanout=2.1 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.12 sequence-density-rank=11 fanout-score=115.80 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=20.0 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=34 prefix-density=0.20 prefix-fanout=2.4 sequence=TCTAGCTAGTGGTTTAATAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=2463.84 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=28.2 sequence=AAGAAGAAGTAAAGGAAGAACAGAAGCCTGTTGAAACAGAGGAGAAGGTTGAAACAGAAACCCCAGTAGAAAAGACTGAGTAATGAGGT SRR4237652 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:57:57 Started mapping on | Feb 12 20:57:58 Finished on | Feb 12 21:01:37 Mapping speed, Million of reads per hour | 687.05 Number of input reads | 41795536 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 40073898 Uniquely mapped reads % | 95.88% Average mapped length | 291.39 Number of splices: Total | 35125476 Number of splices: Annotated (sjdb) | 34515856 Number of splices: GT/AG | 34583898 Number of splices: GC/AG | 416449 Number of splices: AT/AC | 31432 Number of splices: Non-canonical | 93697 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 774391 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 63770 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.07% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 998131 998131 998131 N_multimapping 774391 774391 774391 N_noFeature 1123412 39586595 1374185 N_ambiguous 403028 2246 165054 UnstrandedReadsAssigned:38547458 PositiveStrandReadsAssigned:485057 NegativeStrandReadsAssigned:38534659 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237652 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237652-trimmed-pair1.fastq SRR4237652-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,795,536 reads, 38,377,797 reads pseudoaligned [quant] estimated average fragment length: 224.545 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,220 rounds 52401 SRR4237652.ke.tsv 34699 SRR4237652.se.tsv 87100 total ==> SRR4237652.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.45 789 11.8811 Potri.005G024800.1.v4.1 1035 811.455 113 3.76294 Potri.004G059700.1.v4.1 961 737.477 53 1.94196 Potri.007G009000.2.v4.1 1416 1192.45 0 0 Potri.003G141000.2.v4.1 2943 2719.45 548.088 5.44605 Potri.016G087400.1.v4.1 270 86.647 5175.58 1614.05 Potri.015G069301.1.v4.1 564 343.566 0 0 Potri.010G195200.1.v4.1 1773 1549.45 367 6.40029 Potri.012G127500.1.v4.1 977 753.471 10573 379.179 ==> SRR4237652.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4381 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 786 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 21 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237652 completed mapping pipeline successfully