Starting /dee2/code/volunteer_pipeline.sh SRR4237653 current disk space = 3050743967744 free memory = 1581991564 SRR4237653 SRAfilesize 686e35b0744a864d6e5d49b916808d8a SRR4237653.sra SRR4237653.sra file validated SRR4237653 is paired end SRR4237653 is conventional basespace SRR4237653 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237653_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.87975 34.0 33.0 34.0 27.0 34.0 2 32.906 34.0 33.0 34.0 28.0 34.0 3 33.079 34.0 33.0 34.0 32.0 34.0 4 33.27625 34.0 33.0 34.0 32.0 34.0 5 33.23825 34.0 33.0 34.0 33.0 34.0 6 36.9115 38.0 37.0 38.0 36.0 38.0 7 37.34075 38.0 38.0 38.0 37.0 38.0 8 37.45775 38.0 38.0 38.0 37.0 38.0 9 37.48475 38.0 38.0 38.0 37.0 38.0 10-14 37.4088 38.0 38.0 38.0 37.2 38.0 15-19 37.0778 38.0 38.0 38.0 35.6 38.0 20-24 37.3991 38.0 38.0 38.0 37.2 38.0 25-29 37.406099999999995 38.0 38.0 38.0 37.0 38.0 30-34 36.95925 38.0 38.0 38.0 35.2 38.0 35-39 37.344550000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.2705 38.0 38.0 38.0 36.8 38.0 45-49 37.19805 38.0 38.0 38.0 36.6 38.0 50-54 37.1229 38.0 38.0 38.0 36.0 38.0 55-59 36.7132 38.0 37.8 38.0 34.8 38.0 60-64 37.032650000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.03805 38.0 38.0 38.0 36.0 38.0 70-74 37.01995 38.0 38.0 38.0 36.0 38.0 75-79 36.9462 38.0 38.0 38.0 35.8 38.0 80-84 35.83855 38.0 36.2 38.0 30.2 38.0 85-89 36.748599999999996 38.0 37.8 38.0 35.2 38.0 90-94 36.795399999999994 38.0 38.0 38.0 35.0 38.0 95-99 36.69355 38.0 38.0 38.0 34.8 38.0 100-104 36.664249999999996 38.0 38.0 38.0 34.6 38.0 105-109 36.4317 38.0 38.0 38.0 34.0 38.0 110-114 36.416250000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.28615 38.0 38.0 38.0 33.8 38.0 120-124 36.292 38.0 38.0 38.0 34.0 38.0 125-129 36.11065 38.0 38.0 38.0 33.2 38.0 130-134 35.9157 38.0 36.8 38.0 32.6 38.0 135-139 35.6082 38.0 36.0 38.0 31.2 38.0 140-144 35.492399999999996 38.0 36.0 38.0 31.8 38.0 145-149 34.928250000000006 38.0 36.0 38.0 30.4 38.0 150 29.93375 35.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 0.0 13 2.0 14 0.0 15 0.0 16 1.0 17 1.0 18 2.0 19 1.0 20 5.0 21 5.0 22 3.0 23 6.0 24 9.0 25 12.0 26 13.0 27 17.0 28 28.0 29 23.0 30 40.0 31 55.0 32 93.0 33 78.0 34 120.0 35 226.0 36 586.0 37 2672.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.14928203738825 11.053914928203739 9.347060417231102 40.449742617176916 2 21.975 15.275 36.7 26.05 3 19.025 20.150000000000002 26.224999999999998 34.599999999999994 4 23.200000000000003 29.625 22.05 25.124999999999996 5 21.91095547773887 33.366683341670836 25.03751875937969 19.684842421210604 6 18.602904356534804 34.651977966950426 26.164246369554334 20.58087130696044 7 13.850000000000001 26.700000000000003 41.55 17.9 8 16.675 26.400000000000002 32.65 24.275 9 17.299999999999997 24.75 34.1 23.849999999999998 10-14 19.895 30.325000000000003 26.640000000000004 23.14 15-19 19.36 29.580000000000002 26.855 24.205 20-24 19.98 29.48 27.084999999999997 23.455000000000002 25-29 20.235 29.095 27.534999999999997 23.135 30-34 19.585 29.285 27.255000000000003 23.875 35-39 20.365 28.93 27.245 23.46 40-44 19.97 29.575000000000003 26.810000000000002 23.645 45-49 19.895 28.895 27.775 23.435 50-54 19.689999999999998 29.81 27.11 23.39 55-59 20.335 29.205 26.825 23.635 60-64 20.064999999999998 28.904999999999998 27.6 23.43 65-69 20.085 28.22 27.73 23.965 70-74 20.235 28.725 27.105 23.935000000000002 75-79 19.78 29.385 27.05 23.785 80-84 19.695 29.335 27.215 23.755000000000003 85-89 20.115 28.735 27.35 23.799999999999997 90-94 19.744999999999997 29.12 27.339999999999996 23.794999999999998 95-99 20.080000000000002 28.720000000000002 27.495000000000005 23.705000000000002 100-104 20.72 28.705000000000002 26.99 23.585 105-109 20.119999999999997 28.165000000000003 28.21 23.505000000000003 110-114 20.605 28.68 27.205000000000002 23.51 115-119 20.055 29.104999999999997 27.105 23.735 120-124 20.880000000000003 28.355000000000004 26.96 23.805 125-129 20.78 28.470000000000002 27.395000000000003 23.355 130-134 20.965 28.139999999999997 26.435 24.46 135-139 21.11 28.215 26.345000000000002 24.33 140-144 20.505000000000003 28.58 26.334999999999997 24.58 145-149 21.060000000000002 27.955000000000002 26.265 24.72 150 21.271763815291443 26.82311380267474 26.924047438808984 24.98107494322483 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 2.5 23 3.0 24 3.0 25 2.0 26 4.5 27 10.0 28 13.0 29 14.5 30 20.5 31 32.5 32 38.5 33 49.0 34 61.5 35 67.0 36 89.0 37 113.0 38 136.0 39 161.0 40 196.0 41 227.5 42 247.5 43 258.5 44 262.0 45 260.0 46 251.0 47 251.5 48 233.5 49 203.0 50 165.0 51 140.0 52 119.5 53 90.5 54 70.0 55 49.5 56 39.5 57 32.5 58 26.5 59 15.5 60 7.0 61 5.0 62 3.5 63 5.0 64 2.5 65 0.5 66 2.0 67 3.0 68 2.5 69 2.0 70 2.0 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.725 2 0.0 3 0.0 4 0.0 5 0.05 6 0.15 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.9249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.23750000000000002 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.325 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.9375 0.0 0.0 0.0 0.0 106-107 2.2750000000000004 0.0 0.0 0.0 0.0 108-109 2.4875 0.0 0.0 0.0 0.0 110-111 2.7874999999999996 0.0 0.0 0.0 0.0 112-113 3.1 0.0 0.0 0.0 0.0 114-115 3.375 0.0 0.0 0.0 0.0 116-117 3.7625 0.0 0.0 0.0 0.0 118-119 4.4 0.0 0.0 0.0 0.0 120-121 5.2375 0.0 0.0 0.0 0.0 122-123 5.9125 0.0 0.0 0.0 0.0 124-125 6.3125 0.0 0.0 0.0 0.0 126-127 7.112500000000001 0.0 0.0 0.0 0.0 128-129 8.0125 0.0 0.0 0.0 0.0 130-131 8.9125 0.0 0.0 0.0 0.0 132-133 9.7375 0.0 0.0 0.0 0.0 134-135 10.55 0.0 0.0 0.0 0.0 136-137 11.425 0.0 0.0 0.0 0.0 138 12.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAAGT 10 0.0069790767 143.96251 3 >>END_MODULE SRR4237653 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237653_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.677 33.0 33.0 34.0 32.0 34.0 2 32.945 34.0 33.0 34.0 32.0 34.0 3 32.99125 34.0 33.0 34.0 32.0 34.0 4 32.80925 34.0 33.0 34.0 32.0 34.0 5 32.87825 34.0 33.0 34.0 32.0 34.0 6 37.08425 38.0 38.0 38.0 37.0 38.0 7 37.163 38.0 38.0 38.0 37.0 38.0 8 37.19725 38.0 38.0 38.0 37.0 38.0 9 37.12025 38.0 38.0 38.0 37.0 38.0 10-14 37.19995 38.0 38.0 38.0 37.0 38.0 15-19 37.11455 38.0 38.0 38.0 37.0 38.0 20-24 37.0616 38.0 38.0 38.0 36.4 38.0 25-29 37.0825 38.0 38.0 38.0 37.0 38.0 30-34 37.054050000000004 38.0 38.0 38.0 36.6 38.0 35-39 36.99635 38.0 38.0 38.0 36.4 38.0 40-44 37.04375 38.0 38.0 38.0 36.8 38.0 45-49 37.01395 38.0 38.0 38.0 36.4 38.0 50-54 37.01085 38.0 38.0 38.0 36.8 38.0 55-59 36.938300000000005 38.0 38.0 38.0 36.2 38.0 60-64 36.988 38.0 38.0 38.0 36.4 38.0 65-69 36.863 38.0 38.0 38.0 36.2 38.0 70-74 36.82190000000001 38.0 38.0 38.0 36.0 38.0 75-79 36.84245 38.0 38.0 38.0 36.0 38.0 80-84 36.760949999999994 38.0 38.0 38.0 35.8 38.0 85-89 36.6786 38.0 38.0 38.0 35.4 38.0 90-94 36.7195 38.0 38.0 38.0 36.0 38.0 95-99 36.49735 38.0 38.0 38.0 35.2 38.0 100-104 36.48615 38.0 38.0 38.0 34.6 38.0 105-109 36.3718 38.0 38.0 38.0 34.0 38.0 110-114 36.27485 38.0 38.0 38.0 34.0 38.0 115-119 36.19865 38.0 38.0 38.0 34.0 38.0 120-124 36.105000000000004 38.0 38.0 38.0 34.0 38.0 125-129 35.819 38.0 38.0 38.0 33.0 38.0 130-134 35.638 38.0 38.0 38.0 32.2 38.0 135-139 35.4328 38.0 37.8 38.0 31.6 38.0 140-144 33.5587 37.2 32.2 38.0 27.0 38.0 145-149 33.154700000000005 37.4 32.8 38.0 22.8 38.0 150 28.7005 35.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 1.0 5 1.0 6 1.0 7 1.0 8 1.0 9 2.0 10 2.0 11 1.0 12 2.0 13 6.0 14 1.0 15 4.0 16 2.0 17 3.0 18 7.0 19 11.0 20 0.0 21 11.0 22 6.0 23 12.0 24 10.0 25 18.0 26 22.0 27 28.0 28 25.0 29 33.0 30 41.0 31 42.0 32 67.0 33 69.0 34 110.0 35 165.0 36 468.0 37 2823.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.45340050377833 20.025188916876573 12.846347607052897 26.675062972292192 2 29.03951975987994 24.662331165582792 31.81590795397699 14.48224112056028 3 20.730182545636406 30.00750187546887 29.882470617654416 19.379844961240313 4 26.33559066967645 34.91346877351392 21.11863556558816 17.63230499122147 5 25.90738423028786 38.32290362953692 21.176470588235293 14.593241551939926 6 19.2 39.6 24.425 16.775000000000002 7 19.7 20.3 41.325 18.675 8 21.975 23.175 29.4 25.45 9 22.625 23.974999999999998 29.875 23.525 10-14 23.805 28.794999999999998 26.46 20.94 15-19 23.380000000000003 28.365000000000002 27.36 20.895 20-24 23.11 28.205000000000002 27.505000000000003 21.18 25-29 23.575 27.584999999999997 27.825 21.015 30-34 23.555 27.68 28.444999999999997 20.32 35-39 24.075 27.63 27.98 20.315 40-44 23.825 28.134999999999998 27.42 20.62 45-49 23.189999999999998 28.07 28.215 20.525 50-54 23.585 28.050000000000004 27.955000000000002 20.41 55-59 24.04 28.08 27.805000000000003 20.075000000000003 60-64 23.18 28.285 28.43 20.105 65-69 23.895 27.415 28.634999999999998 20.055 70-74 23.445 27.49 28.355000000000004 20.71 75-79 23.380000000000003 27.425 28.835 20.36 80-84 23.74 28.449999999999996 27.855 19.955000000000002 85-89 23.68618430921546 27.816390819540977 28.136406820341016 20.361018050902548 90-94 23.810000000000002 27.88 28.32 19.99 95-99 23.775 27.93 28.34 19.955000000000002 100-104 24.485 27.67 28.02 19.825 105-109 23.815 27.625 28.005000000000003 20.555 110-114 24.205 27.92 28.28 19.595000000000002 115-119 24.32 28.050000000000004 27.275 20.355 120-124 24.665 27.544999999999998 27.985 19.805 125-129 25.5 28.22 26.995 19.285 130-134 25.915 27.805000000000003 26.790000000000003 19.49 135-139 25.865 27.810000000000002 27.345000000000002 18.98 140-144 26.431254695717506 27.598297019784624 26.641622839969948 19.328825444527926 145-149 26.25 28.095 26.43 19.225 150 25.99797877716018 27.614957049014656 27.968671045982816 18.418393127842343 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 1.0 22 1.5 23 2.5 24 4.5 25 4.0 26 2.0 27 5.0 28 9.5 29 12.5 30 17.5 31 18.5 32 21.5 33 33.5 34 44.0 35 62.0 36 84.5 37 107.5 38 130.0 39 158.5 40 199.5 41 241.5 42 260.0 43 274.5 44 294.5 45 284.0 46 255.0 47 242.0 48 228.5 49 200.5 50 176.0 51 152.5 52 121.5 53 85.0 54 63.0 55 42.5 56 33.0 57 34.5 58 26.0 59 17.5 60 13.0 61 9.0 62 6.0 63 5.0 64 3.0 65 2.5 66 1.5 67 1.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.05 3 0.025 4 0.325 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.17500000000000002 145-149 0.0 150 1.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.3 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.9500000000000002 0.0 0.0 0.0 0.0 106-107 2.3 0.0 0.0 0.0 0.0 108-109 2.5125 0.0 0.0 0.0 0.0 110-111 2.825 0.0 0.0 0.0 0.0 112-113 3.1625 0.0 0.0 0.0 0.0 114-115 3.45 0.0 0.0 0.0 0.0 116-117 3.8125 0.0 0.0 0.0 0.0 118-119 4.45 0.0 0.0 0.0 0.0 120-121 5.3 0.0 0.0 0.0 0.0 122-123 5.987500000000001 0.0 0.0 0.0 0.0 124-125 6.375 0.0 0.0 0.0 0.0 126-127 7.175 0.0 0.0 0.0 0.0 128-129 8.05 0.0 0.0 0.0 0.0 130-131 8.925 0.0 0.0 0.0 0.0 132-133 9.7 0.0 0.0 0.0 0.0 134-135 10.45 0.0 0.0 0.0 0.0 136-137 11.3125 0.0 0.0 0.0 0.0 138 11.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTTAT 10 0.006973645 144.0 6 AAAGGCT 10 0.006973645 144.0 4 >>END_MODULE Read 2587103 spots for SRR4237653.sra Written 2587103 spots for SRR4237653.sra Read 2587112 spots for SRR4237653.sra Written 2587112 spots for SRR4237653.sra Read 2587103 spots for SRR4237653.sra Written 2587103 spots for SRR4237653.sra Read 2587103 spots for SRR4237653.sra Written 2587103 spots for SRR4237653.sra Read 2587103 spots for SRR4237653.sra Written 2587103 spots for SRR4237653.sra Read 2587103 spots for SRR4237653.sra Written 2587103 spots for SRR4237653.sra Read 2587103 spots for SRR4237653.sra Written 2587103 spots for SRR4237653.sra Read 2587103 spots for SRR4237653.sra Written 2587103 spots for SRR4237653.sra Read 2587103 spots for SRR4237653.sra Written 2587103 spots for SRR4237653.sra Read 2587103 spots for SRR4237653.sra Written 2587103 spots for SRR4237653.sra Read 2587103 spots for SRR4237653.sra Written 2587103 spots for SRR4237653.sra Read 2587103 spots for SRR4237653.sra Written 2587103 spots for SRR4237653.sra Read 2587103 spots for SRR4237653.sra Written 2587103 spots for SRR4237653.sra Read 2587103 spots for SRR4237653.sra Written 2587103 spots for SRR4237653.sra Read 2587103 spots for SRR4237653.sra Written 2587103 spots for SRR4237653.sra Read 2587103 spots for SRR4237653.sra Written 2587103 spots for SRR4237653.sra Read 2587103 spots for SRR4237653.sra Written 2587103 spots for SRR4237653.sra Read 2587103 spots for SRR4237653.sra Written 2587103 spots for SRR4237653.sra Read 2587103 spots for SRR4237653.sra Written 2587103 spots for SRR4237653.sra Read 2587103 spots for SRR4237653.sra Written 2587103 spots for SRR4237653.sra SRR ids: ['SRR4237653.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h7q8b3et SRR4237653.sra spots: 51742069 blocks: [[1, 2587103], [2587104, 5174206], [5174207, 7761309], [7761310, 10348412], [10348413, 12935515], [12935516, 15522618], [15522619, 18109721], [18109722, 20696824], [20696825, 23283927], [23283928, 25871030], [25871031, 28458133], [28458134, 31045236], [31045237, 33632339], [33632340, 36219442], [36219443, 38806545], [38806546, 41393648], [41393649, 43980751], [43980752, 46567854], [46567855, 49154957], [49154958, 51742069]] SRR4237653 file size 17410930 SRR4237653 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237653 SRR4237653_1.fastq SRR4237653_2.fastq Input file: SRR4237653_1.fastq Paired file: SRR4237653_2.fastq trimmed: SRR4237653-trimmed-pair1.fastq, SRR4237653-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:57:37 2025 >> started Wed Feb 12 21:58:36 2025 >> done (58.782s) 51742069 read pairs processed; of these: 32515 ( 0.06%) short read pairs filtered out after trimming by size control 27818 ( 0.05%) empty read pairs filtered out after trimming by size control 51681736 (99.88%) read pairs available; of these: 19568469 (37.86%) trimmed read pairs available after processing 32113267 (62.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 11 0.00% 20 8 0.00% 21 9 0.00% 22 11 0.00% 23 11 0.00% 24 10 0.00% 25 13 0.00% 26 7 0.00% 27 18 0.00% 28 13 0.00% 29 21 0.00% 30 21 0.00% 31 24 0.00% 32 25 0.00% 33 22 0.00% 34 18 0.00% 35 32 0.00% 36 46 0.00% 37 38 0.00% 38 42 0.00% 39 49 0.00% 40 70 0.00% 41 71 0.00% 42 76 0.00% 43 78 0.00% 44 82 0.00% 45 90 0.00% 46 133 0.00% 47 125 0.00% 48 160 0.00% 49 164 0.00% 50 179 0.00% 51 219 0.00% 52 219 0.00% 53 237 0.00% 54 330 0.00% 55 325 0.00% 56 392 0.00% 57 432 0.00% 58 559 0.00% 59 668 0.00% 60 701 0.00% 61 797 0.00% 62 918 0.00% 63 1023 0.00% 64 1265 0.00% 65 1386 0.00% 66 1613 0.00% 67 2008 0.00% 68 2372 0.00% 69 3688 0.01% 70 3638 0.01% 71 3070 0.01% 72 3514 0.01% 73 4041 0.01% 74 4475 0.01% 75 5037 0.01% 76 5686 0.01% 77 6334 0.01% 78 7241 0.01% 79 8195 0.02% 80 9237 0.02% 81 10559 0.02% 82 12216 0.02% 83 13985 0.03% 84 17740 0.03% 85 19826 0.04% 86 21700 0.04% 87 23855 0.05% 88 26165 0.05% 89 29463 0.06% 90 30863 0.06% 91 35005 0.07% 92 37337 0.07% 93 41443 0.08% 94 45013 0.09% 95 49357 0.10% 96 53850 0.10% 97 57810 0.11% 98 61129 0.12% 99 65215 0.13% 100 71056 0.14% 101 75172 0.15% 102 80638 0.16% 103 86337 0.17% 104 91851 0.18% 105 98222 0.19% 106 104837 0.20% 107 110092 0.21% 108 114495 0.22% 109 120599 0.23% 110 124553 0.24% 111 130533 0.25% 112 136052 0.26% 113 141670 0.27% 114 148743 0.29% 115 156355 0.30% 116 162037 0.31% 117 168462 0.33% 118 174315 0.34% 119 178100 0.34% 120 183283 0.35% 121 189907 0.37% 122 193120 0.37% 123 198113 0.38% 124 206084 0.40% 125 211766 0.41% 126 217761 0.42% 127 224664 0.43% 128 228785 0.44% 129 235585 0.46% 130 241642 0.47% 131 244751 0.47% 132 250231 0.48% 133 257658 0.50% 134 261799 0.51% 135 270861 0.52% 136 280233 0.54% 137 288274 0.56% 138 299174 0.58% 139 310444 0.60% 140 318423 0.62% 141 332146 0.64% 142 351886 0.68% 143 370158 0.72% 144 407325 0.79% 145 457543 0.89% 146 533703 1.03% 147 703152 1.36% 148 1221914 2.36% 149 6870129 13.29% 150 32113267 62.14% 51681736 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=43 prefix-density=0.13 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=9 fanout-score=241.96 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=29.9 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.62 fanout-score-rank=35 prefix-density=0.18 prefix-fanout=2.8 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=309.03 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=28.1 sequence=AAGAAGAAGAAG SRR4237653 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:59:43 Started mapping on | Feb 12 21:59:43 Finished on | Feb 12 22:03:22 Mapping speed, Million of reads per hour | 849.56 Number of input reads | 51681736 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 50014521 Uniquely mapped reads % | 96.77% Average mapped length | 289.19 Number of splices: Total | 45803669 Number of splices: Annotated (sjdb) | 45003034 Number of splices: GT/AG | 45081798 Number of splices: GC/AG | 564999 Number of splices: AT/AC | 47011 Number of splices: Non-canonical | 109861 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1050471 % of reads mapped to multiple loci | 2.03% Number of reads mapped to too many loci | 94995 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.97% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 651638 651638 651638 N_multimapping 1050471 1050471 1050471 N_noFeature 1395612 49304275 1841115 N_ambiguous 468630 3120 201714 UnstrandedReadsAssigned:48150279 PositiveStrandReadsAssigned:707126 NegativeStrandReadsAssigned:47971692 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=147 echo kmer=143 SRR4237653 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237653-trimmed-pair1.fastq SRR4237653-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 51,681,736 reads, 47,744,689 reads pseudoaligned [quant] estimated average fragment length: 214.176 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,309 rounds 52401 SRR4237653.ke.tsv 34699 SRR4237653.se.tsv 87100 total ==> SRR4237653.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1804.82 1012.52 11.9156 Potri.005G024800.1.v4.1 1035 821.824 137 3.54071 Potri.004G059700.1.v4.1 961 747.862 110 3.12406 Potri.007G009000.2.v4.1 1416 1202.82 0 0 Potri.003G141000.2.v4.1 2943 2729.82 777.105 6.04634 Potri.016G087400.1.v4.1 270 94.961 6145.17 1374.47 Potri.015G069301.1.v4.1 564 354.814 0 0 Potri.010G195200.1.v4.1 1773 1559.82 137 1.86549 Potri.012G127500.1.v4.1 977 763.835 22370 622.034 ==> SRR4237653.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4518 Potri.001G233950.v4.1 15 Potri.001G122700.v4.1 833 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR4237653 completed mapping pipeline successfully