Starting /dee2/code/volunteer_pipeline.sh SRR4237654 current disk space = 3051050237952 free memory = 1032152280 SRR4237654 SRAfilesize 889e75bd2566c6886aabb94c78a0ce43 SRR4237654.sra SRR4237654.sra file validated SRR4237654 is paired end SRR4237654 is conventional basespace SRR4237654 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237654_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.504 33.0 32.0 34.0 2.0 34.0 2 32.08725 34.0 32.0 34.0 27.0 34.0 3 32.387 34.0 32.0 34.0 27.0 34.0 4 32.81075 34.0 33.0 34.0 32.0 34.0 5 32.5855 34.0 33.0 34.0 32.0 34.0 6 36.60325 38.0 37.0 38.0 34.0 38.0 7 36.9885 38.0 38.0 38.0 36.0 38.0 8 37.13675 38.0 38.0 38.0 36.0 38.0 9 37.173 38.0 38.0 38.0 36.0 38.0 10-14 37.215250000000005 38.0 38.0 38.0 36.2 38.0 15-19 37.2293 38.0 38.0 38.0 36.4 38.0 20-24 37.22405 38.0 38.0 38.0 36.2 38.0 25-29 37.00005 38.0 38.0 38.0 35.6 38.0 30-34 37.17755 38.0 38.0 38.0 36.2 38.0 35-39 36.34695000000001 38.0 37.2 38.0 31.2 38.0 40-44 36.97235 38.0 38.0 38.0 36.0 38.0 45-49 36.6429 38.0 37.8 38.0 34.0 38.0 50-54 36.90235 38.0 38.0 38.0 35.8 38.0 55-59 35.928549999999994 38.0 36.8 38.0 29.8 38.0 60-64 36.768950000000004 38.0 38.0 38.0 35.0 38.0 65-69 36.8815 38.0 38.0 38.0 35.2 38.0 70-74 36.85035 38.0 38.0 38.0 35.2 38.0 75-79 36.7761 38.0 38.0 38.0 35.0 38.0 80-84 36.8248 38.0 38.0 38.0 35.2 38.0 85-89 36.653499999999994 38.0 38.0 38.0 34.2 38.0 90-94 36.678 38.0 38.0 38.0 34.4 38.0 95-99 35.5707 38.0 36.6 38.0 29.0 38.0 100-104 35.37565 38.0 36.2 38.0 28.0 38.0 105-109 36.070949999999996 38.0 37.2 38.0 33.0 38.0 110-114 36.09415 38.0 37.2 38.0 33.2 38.0 115-119 36.15365 38.0 37.4 38.0 33.4 38.0 120-124 35.998650000000005 38.0 37.2 38.0 32.8 38.0 125-129 35.7762 38.0 36.8 38.0 31.8 38.0 130-134 35.696999999999996 38.0 36.4 38.0 31.4 38.0 135-139 35.4823 38.0 36.0 38.0 30.4 38.0 140-144 34.9979 38.0 35.4 38.0 28.2 38.0 145-149 34.20815 38.0 34.6 38.0 27.0 38.0 150 28.71875 33.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 2.0 17 1.0 18 2.0 19 1.0 20 2.0 21 4.0 22 3.0 23 4.0 24 11.0 25 14.0 26 16.0 27 31.0 28 33.0 29 36.0 30 61.0 31 75.0 32 102.0 33 121.0 34 173.0 35 301.0 36 646.0 37 2353.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.468184471687096 12.95971978984238 7.793345008756567 32.77875072971395 2 22.95 15.0 33.875 28.175 3 19.400000000000002 22.400000000000002 25.5 32.7 4 23.75 29.9 22.475 23.875 5 21.325 34.025 24.275 20.375 6 17.925 36.1 25.75 20.225 7 13.15 25.575 43.15 18.125 8 15.7 25.224999999999998 33.225 25.85 9 16.950000000000003 25.0 33.825 24.224999999999998 10-14 19.470000000000002 30.555 26.76 23.215 15-19 19.7 30.055 27.615000000000002 22.63 20-24 19.77 29.515 27.01 23.705000000000002 25-29 19.564999999999998 29.715000000000003 27.825 22.895 30-34 19.82 29.525000000000002 27.145000000000003 23.51 35-39 19.205 29.544999999999998 27.139999999999997 24.11 40-44 19.62 29.134999999999998 27.775 23.47 45-49 19.5 29.38 27.49 23.630000000000003 50-54 19.55 28.645 27.765 24.04 55-59 19.55 29.9 27.27 23.28 60-64 19.915 29.315 27.084999999999997 23.685000000000002 65-69 19.24 29.285 27.584999999999997 23.89 70-74 19.634999999999998 29.095 27.395000000000003 23.875 75-79 19.335 30.130000000000003 26.71 23.825 80-84 19.725 28.860000000000003 27.415 24.0 85-89 19.955000000000002 29.475 27.279999999999998 23.29 90-94 20.39 28.804999999999996 27.025 23.78 95-99 19.71 28.76 27.279999999999998 24.25 100-104 20.64 28.7 27.355 23.305 105-109 20.21 29.049999999999997 27.3 23.44 110-114 20.105 28.27 28.1 23.525 115-119 19.605 29.12 27.415 23.86 120-124 19.975 28.389999999999997 27.355 24.279999999999998 125-129 19.96 28.115000000000002 27.665 24.26 130-134 20.44 28.199999999999996 27.355 24.005000000000003 135-139 20.435 28.78 26.795 23.990000000000002 140-144 20.935000000000002 28.645 26.834999999999997 23.585 145-149 20.54 28.87 26.729999999999997 23.86 150 20.45 28.4 26.6 24.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 0.5 23 1.0 24 1.5 25 1.5 26 4.5 27 11.0 28 17.5 29 20.0 30 24.0 31 30.0 32 40.5 33 53.0 34 69.0 35 84.5 36 92.0 37 107.5 38 139.0 39 171.5 40 195.5 41 224.5 42 254.0 43 274.5 44 281.5 45 283.5 46 273.5 47 236.5 48 202.0 49 181.5 50 168.5 51 135.0 52 101.5 53 78.5 54 61.0 55 52.0 56 33.5 57 24.5 58 16.0 59 11.0 60 11.0 61 8.0 62 5.0 63 3.0 64 2.0 65 2.0 66 2.0 67 1.0 68 2.0 69 1.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.9 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.25 0.0 0.0 0.0 0.0 120-121 1.4125 0.0 0.0 0.0 0.0 122-123 1.5125000000000002 0.0 0.0 0.0 0.0 124-125 1.7625 0.0 0.0 0.0 0.0 126-127 1.925 0.0 0.0 0.0 0.0 128-129 2.2125000000000004 0.0 0.0 0.0 0.0 130-131 2.4375 0.0 0.0 0.0 0.0 132-133 2.7625 0.0 0.0 0.0 0.0 134-135 3.025 0.0 0.0 0.0 0.0 136-137 3.4124999999999996 0.0 0.0 0.0 0.0 138 3.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237654 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237654_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.145 33.0 33.0 34.0 30.0 34.0 2 32.22975 33.0 33.0 34.0 31.0 34.0 3 32.334 33.0 33.0 34.0 31.0 34.0 4 32.18225 33.0 33.0 34.0 31.0 34.0 5 32.08825 33.0 33.0 34.0 31.0 34.0 6 36.238 38.0 38.0 38.0 33.0 38.0 7 36.4065 38.0 38.0 38.0 34.0 38.0 8 36.31625 38.0 38.0 38.0 34.0 38.0 9 36.3195 38.0 38.0 38.0 34.0 38.0 10-14 36.1819 38.0 38.0 38.0 33.2 38.0 15-19 36.240300000000005 38.0 38.0 38.0 33.6 38.0 20-24 36.23825 38.0 38.0 38.0 33.8 38.0 25-29 36.0886 38.0 38.0 38.0 33.0 38.0 30-34 36.02765000000001 38.0 38.0 38.0 32.8 38.0 35-39 36.19885000000001 38.0 38.0 38.0 34.0 38.0 40-44 36.1732 38.0 38.0 38.0 34.0 38.0 45-49 35.79105 38.0 37.4 38.0 31.2 38.0 50-54 36.113 38.0 38.0 38.0 33.4 38.0 55-59 36.0004 38.0 37.8 38.0 32.6 38.0 60-64 35.56695 38.0 37.4 38.0 29.2 38.0 65-69 35.5623 38.0 36.8 38.0 30.0 38.0 70-74 35.33225 38.0 36.6 38.0 27.6 38.0 75-79 35.71035 38.0 37.2 38.0 31.0 38.0 80-84 35.4889 38.0 37.2 38.0 30.2 38.0 85-89 35.6364 38.0 37.0 38.0 30.6 38.0 90-94 35.643299999999996 38.0 37.0 38.0 30.8 38.0 95-99 35.537000000000006 38.0 37.0 38.0 31.0 38.0 100-104 35.2642 38.0 37.0 38.0 28.8 38.0 105-109 35.179700000000004 38.0 37.0 38.0 28.6 38.0 110-114 35.164249999999996 38.0 37.0 38.0 28.4 38.0 115-119 34.958600000000004 38.0 36.2 38.0 27.8 38.0 120-124 34.6831 38.0 36.0 38.0 26.4 38.0 125-129 34.14355 38.0 35.2 38.0 23.6 38.0 130-134 33.69795 38.0 33.4 38.0 21.4 38.0 135-139 33.345600000000005 38.0 33.0 38.0 18.6 38.0 140-144 32.89965 38.0 33.0 38.0 14.2 38.0 145-149 31.549850000000003 38.0 33.0 38.0 6.0 38.0 150 23.9985 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 9.0 4 6.0 5 4.0 6 3.0 7 3.0 8 4.0 9 3.0 10 2.0 11 3.0 12 3.0 13 3.0 14 3.0 15 4.0 16 4.0 17 6.0 18 9.0 19 6.0 20 8.0 21 19.0 22 20.0 23 29.0 24 21.0 25 32.0 26 32.0 27 38.0 28 44.0 29 48.0 30 73.0 31 94.0 32 91.0 33 163.0 34 186.0 35 303.0 36 599.0 37 2107.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.875 22.125 10.975 22.025 2 29.849999999999998 24.75 30.725 14.674999999999999 3 21.725 28.625 31.474999999999998 18.175 4 24.224999999999998 34.699999999999996 23.549999999999997 17.525 5 25.074999999999996 38.175 21.0 15.75 6 21.0 39.45 22.1 17.45 7 20.5 20.075000000000003 40.45 18.975 8 21.475 24.55 28.775000000000002 25.2 9 22.275 25.0 29.65 23.075000000000003 10-14 24.115000000000002 28.37 27.275 20.24 15-19 23.605 27.35 28.389999999999997 20.655 20-24 23.724999999999998 27.965 27.985 20.325 25-29 23.919999999999998 27.634999999999998 27.900000000000002 20.544999999999998 30-34 23.36 28.060000000000002 28.315 20.265 35-39 23.855 28.449999999999996 27.54 20.155 40-44 23.955000000000002 27.27 28.365000000000002 20.41 45-49 23.515 27.884999999999998 28.22 20.380000000000003 50-54 23.055 27.650000000000002 28.705000000000002 20.59 55-59 23.674999999999997 27.865000000000002 28.62 19.84 60-64 23.494999999999997 27.845 28.384999999999998 20.275000000000002 65-69 22.84 27.839999999999996 28.910000000000004 20.41 70-74 23.064999999999998 28.355000000000004 28.095 20.485 75-79 23.200000000000003 27.67 28.444999999999997 20.685000000000002 80-84 23.39 28.07 28.125 20.415 85-89 23.995 27.145000000000003 28.804999999999996 20.055 90-94 23.599999999999998 27.315 28.875 20.21 95-99 23.485 27.38 28.185 20.95 100-104 23.525 28.360000000000003 27.955000000000002 20.16 105-109 23.79 27.560000000000002 28.46 20.19 110-114 23.535 27.35 28.67 20.445 115-119 23.825 28.105000000000004 28.294999999999998 19.775000000000002 120-124 23.77 28.244999999999997 28.244999999999997 19.74 125-129 24.035 27.779999999999998 28.51 19.675 130-134 24.165 27.235 28.895 19.705000000000002 135-139 23.825 27.785 28.345 20.044999999999998 140-144 24.29 27.49 28.285 19.935 145-149 24.9 27.500000000000004 28.01 19.59 150 24.85 27.325 28.199999999999996 19.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 1.0 22 2.0 23 2.0 24 2.0 25 2.5 26 3.0 27 4.0 28 6.5 29 7.0 30 11.0 31 23.0 32 29.0 33 39.5 34 53.5 35 67.0 36 80.5 37 100.0 38 123.5 39 154.5 40 200.0 41 239.0 42 264.0 43 283.0 44 298.5 45 292.5 46 256.5 47 234.5 48 232.5 49 211.0 50 177.0 51 134.5 52 113.5 53 96.5 54 66.5 55 47.5 56 36.0 57 31.5 58 21.5 59 11.0 60 10.0 61 8.0 62 3.5 63 4.0 64 3.5 65 0.5 66 1.0 67 1.0 68 0.0 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.225 0.0 0.0 0.0 0.0 120-121 1.3875 0.0 0.0 0.0 0.0 122-123 1.4874999999999998 0.0 0.0 0.0 0.0 124-125 1.7875 0.0 0.0 0.0 0.0 126-127 1.9375 0.0 0.0 0.0 0.0 128-129 2.2125000000000004 0.0 0.0 0.0 0.0 130-131 2.4125 0.0 0.0 0.0 0.0 132-133 2.775 0.0 0.0 0.0 0.0 134-135 3.0374999999999996 0.0 0.0 0.0 0.0 136-137 3.4124999999999996 0.0 0.0 0.0 0.0 138 3.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATAAC 10 0.006973645 144.0 4 TCCATCC 10 0.006973645 144.0 7 >>END_MODULE Read 2609248 spots for SRR4237654.sra Written 2609248 spots for SRR4237654.sra Read 2609248 spots for SRR4237654.sra Written 2609248 spots for SRR4237654.sra Read 2609248 spots for SRR4237654.sra Written 2609248 spots for SRR4237654.sra Read 2609248 spots for SRR4237654.sra Written 2609248 spots for SRR4237654.sra Read 2609248 spots for SRR4237654.sra Written 2609248 spots for SRR4237654.sra Read 2609248 spots for SRR4237654.sra Written 2609248 spots for SRR4237654.sra Read 2609248 spots for SRR4237654.sra Written 2609248 spots for SRR4237654.sra Read 2609248 spots for SRR4237654.sra Written 2609248 spots for SRR4237654.sra Read 2609248 spots for SRR4237654.sra Written 2609248 spots for SRR4237654.sra Read 2609248 spots for SRR4237654.sra Written 2609248 spots for SRR4237654.sra Read 2609248 spots for SRR4237654.sra Written 2609248 spots for SRR4237654.sra Read 2609248 spots for SRR4237654.sra Written 2609248 spots for SRR4237654.sra Read 2609248 spots for SRR4237654.sra Written 2609248 spots for SRR4237654.sra Read 2609259 spots for SRR4237654.sra Written 2609259 spots for SRR4237654.sra Read 2609248 spots for SRR4237654.sra Written 2609248 spots for SRR4237654.sra Read 2609248 spots for SRR4237654.sra Written 2609248 spots for SRR4237654.sra Read 2609248 spots for SRR4237654.sra Written 2609248 spots for SRR4237654.sra Read 2609248 spots for SRR4237654.sra Written 2609248 spots for SRR4237654.sra Read 2609248 spots for SRR4237654.sra Written 2609248 spots for SRR4237654.sra Read 2609248 spots for SRR4237654.sra Written 2609248 spots for SRR4237654.sra SRR ids: ['SRR4237654.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2jiphof2 SRR4237654.sra spots: 52184971 blocks: [[1, 2609248], [2609249, 5218496], [5218497, 7827744], [7827745, 10436992], [10436993, 13046240], [13046241, 15655488], [15655489, 18264736], [18264737, 20873984], [20873985, 23483232], [23483233, 26092480], [26092481, 28701728], [28701729, 31310976], [31310977, 33920224], [33920225, 36529472], [36529473, 39138720], [39138721, 41747968], [41747969, 44357216], [44357217, 46966464], [46966465, 49575712], [49575713, 52184971]] SRR4237654 file size 17560150 SRR4237654 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237654 SRR4237654_1.fastq SRR4237654_2.fastq Input file: SRR4237654_1.fastq Paired file: SRR4237654_2.fastq trimmed: SRR4237654-trimmed-pair1.fastq, SRR4237654-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:10:26 2025 >> started Wed Feb 12 21:11:32 2025 >> done (65.899s) 52184971 read pairs processed; of these: 111793 ( 0.21%) short read pairs filtered out after trimming by size control 80291 ( 0.15%) empty read pairs filtered out after trimming by size control 51992887 (99.63%) read pairs available; of these: 18459064 (35.50%) trimmed read pairs available after processing 33533823 (64.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 5 0.00% 20 10 0.00% 21 11 0.00% 22 9 0.00% 23 16 0.00% 24 11 0.00% 25 11 0.00% 26 16 0.00% 27 12 0.00% 28 9 0.00% 29 22 0.00% 30 21 0.00% 31 17 0.00% 32 19 0.00% 33 13 0.00% 34 27 0.00% 35 32 0.00% 36 30 0.00% 37 30 0.00% 38 33 0.00% 39 35 0.00% 40 48 0.00% 41 47 0.00% 42 54 0.00% 43 56 0.00% 44 69 0.00% 45 69 0.00% 46 67 0.00% 47 109 0.00% 48 92 0.00% 49 94 0.00% 50 101 0.00% 51 139 0.00% 52 128 0.00% 53 145 0.00% 54 176 0.00% 55 170 0.00% 56 206 0.00% 57 198 0.00% 58 248 0.00% 59 248 0.00% 60 283 0.00% 61 312 0.00% 62 331 0.00% 63 398 0.00% 64 450 0.00% 65 521 0.00% 66 574 0.00% 67 660 0.00% 68 951 0.00% 69 2171 0.00% 70 1727 0.00% 71 1213 0.00% 72 1130 0.00% 73 1261 0.00% 74 1382 0.00% 75 1682 0.00% 76 1813 0.00% 77 1911 0.00% 78 2241 0.00% 79 2477 0.00% 80 2829 0.01% 81 3302 0.01% 82 3811 0.01% 83 4964 0.01% 84 12892 0.02% 85 13217 0.03% 86 13197 0.03% 87 13575 0.03% 88 13997 0.03% 89 14260 0.03% 90 14752 0.03% 91 15480 0.03% 92 16360 0.03% 93 17098 0.03% 94 17988 0.03% 95 19186 0.04% 96 20506 0.04% 97 21471 0.04% 98 22646 0.04% 99 23768 0.05% 100 25173 0.05% 101 27006 0.05% 102 29349 0.06% 103 30867 0.06% 104 32859 0.06% 105 34861 0.07% 106 36981 0.07% 107 38832 0.07% 108 41014 0.08% 109 43025 0.08% 110 45114 0.09% 111 48195 0.09% 112 50944 0.10% 113 53432 0.10% 114 56614 0.11% 115 59506 0.11% 116 61833 0.12% 117 66446 0.13% 118 68841 0.13% 119 70333 0.14% 120 74605 0.14% 121 77254 0.15% 122 81829 0.16% 123 87124 0.17% 124 90483 0.17% 125 94185 0.18% 126 99683 0.19% 127 104168 0.20% 128 108928 0.21% 129 114781 0.22% 130 120623 0.23% 131 126245 0.24% 132 134357 0.26% 133 142522 0.27% 134 151435 0.29% 135 160357 0.31% 136 171067 0.33% 137 182617 0.35% 138 197359 0.38% 139 212586 0.41% 140 229488 0.44% 141 251411 0.48% 142 280982 0.54% 143 319412 0.61% 144 376120 0.72% 145 463685 0.89% 146 608774 1.17% 147 875011 1.68% 148 1620294 3.12% 149 9668803 18.60% 150 33533823 64.50% 51992887 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=33 prefix-density=0.20 prefix-fanout=2.5 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=193.47 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=17.1 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=42 prefix-density=0.16 prefix-fanout=2.4 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=11 fanout-score=244.07 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=28.7 sequence=AAGAAGAAGAAA SRR4237654 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:12:19 Started mapping on | Feb 12 21:12:19 Finished on | Feb 12 21:17:50 Mapping speed, Million of reads per hour | 565.48 Number of input reads | 51992887 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 49478613 Uniquely mapped reads % | 95.16% Average mapped length | 294.23 Number of splices: Total | 43910987 Number of splices: Annotated (sjdb) | 43153429 Number of splices: GT/AG | 43248359 Number of splices: GC/AG | 518612 Number of splices: AT/AC | 41166 Number of splices: Non-canonical | 102850 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1076795 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 71801 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.60% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1553297 1553297 1553297 N_multimapping 1076795 1076795 1076795 N_noFeature 1386815 48867756 1673354 N_ambiguous 541713 3053 215462 UnstrandedReadsAssigned:47550085 PositiveStrandReadsAssigned:607804 NegativeStrandReadsAssigned:47589797 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237654 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237654-trimmed-pair1.fastq SRR4237654-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 51,992,887 reads, 47,335,612 reads pseudoaligned [quant] estimated average fragment length: 242.717 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,325 rounds 52401 SRR4237654.ke.tsv 34699 SRR4237654.se.tsv 87100 total ==> SRR4237654.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.28 1035 12.134 Potri.005G024800.1.v4.1 1035 793.283 99 2.59887 Potri.004G059700.1.v4.1 961 719.309 79 2.28712 Potri.007G009000.2.v4.1 1416 1174.28 0 0 Potri.003G141000.2.v4.1 2943 2701.28 571.079 4.40254 Potri.016G087400.1.v4.1 270 74.2425 6803.6 1908.38 Potri.015G069301.1.v4.1 564 326.037 0 0 Potri.010G195200.1.v4.1 1773 1531.28 199.872 2.71815 Potri.012G127500.1.v4.1 977 735.299 11913 337.392 ==> SRR4237654.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8754 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 791 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 29 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237654 completed mapping pipeline successfully