Starting /dee2/code/volunteer_pipeline.sh SRR4237655 current disk space = 3050888167424 free memory = 1455217820 SRR4237655 SRAfilesize e42c1eeee5e4f7f63b2b640184e2347c SRR4237655.sra SRR4237655.sra file validated SRR4237655 is paired end SRR4237655 is conventional basespace SRR4237655 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237655_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3625 34.0 33.0 34.0 33.0 34.0 2 33.40425 34.0 33.0 34.0 33.0 34.0 3 33.42525 34.0 34.0 34.0 33.0 34.0 4 33.40375 34.0 34.0 34.0 33.0 34.0 5 33.43025 34.0 34.0 34.0 33.0 34.0 6 36.849 38.0 37.0 38.0 36.0 38.0 7 37.332 38.0 38.0 38.0 37.0 38.0 8 37.44025 38.0 38.0 38.0 37.0 38.0 9 37.4655 38.0 38.0 38.0 38.0 38.0 10-14 37.50095 38.0 38.0 38.0 37.8 38.0 15-19 37.5099 38.0 38.0 38.0 38.0 38.0 20-24 37.50005 38.0 38.0 38.0 37.8 38.0 25-29 37.4379 38.0 38.0 38.0 38.0 38.0 30-34 37.4091 38.0 38.0 38.0 37.4 38.0 35-39 37.38425 38.0 38.0 38.0 37.2 38.0 40-44 37.26455 38.0 38.0 38.0 37.0 38.0 45-49 37.24550000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.1781 38.0 38.0 38.0 36.8 38.0 55-59 37.1361 38.0 38.0 38.0 36.2 38.0 60-64 37.1408 38.0 38.0 38.0 36.2 38.0 65-69 37.11575 38.0 38.0 38.0 36.2 38.0 70-74 36.897749999999995 38.0 38.0 38.0 35.8 38.0 75-79 36.727250000000005 38.0 38.0 38.0 35.4 38.0 80-84 36.9085 38.0 38.0 38.0 35.8 38.0 85-89 36.455149999999996 38.0 37.6 38.0 33.8 38.0 90-94 36.329100000000004 38.0 37.6 38.0 33.2 38.0 95-99 36.77475 38.0 38.0 38.0 35.0 38.0 100-104 36.8013 38.0 38.0 38.0 35.2 38.0 105-109 36.6627 38.0 38.0 38.0 34.8 38.0 110-114 36.424150000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.61319999999999 38.0 38.0 38.0 34.8 38.0 120-124 36.4632 38.0 38.0 38.0 34.2 38.0 125-129 36.30175 38.0 38.0 38.0 33.8 38.0 130-134 36.1178 38.0 37.8 38.0 33.4 38.0 135-139 35.916 38.0 37.6 38.0 32.8 38.0 140-144 35.71469999999999 38.0 37.0 38.0 32.8 38.0 145-149 35.277699999999996 38.0 36.6 38.0 31.8 38.0 150 30.87375 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 0.0 14 2.0 15 0.0 16 0.0 17 2.0 18 2.0 19 3.0 20 3.0 21 2.0 22 2.0 23 7.0 24 9.0 25 12.0 26 9.0 27 27.0 28 19.0 29 34.0 30 36.0 31 49.0 32 64.0 33 68.0 34 117.0 35 184.0 36 429.0 37 2917.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.18463847885915 12.184138103577684 9.181886414811109 32.44933700275207 2 22.55 14.575 35.4 27.474999999999998 3 19.45 20.349999999999998 27.375 32.824999999999996 4 23.9 28.000000000000004 23.075000000000003 25.025 5 22.075 33.35 24.4 20.175 6 17.768283488313646 34.958532294546366 25.6848454385524 21.588338778587584 7 15.2 26.6 40.575 17.625 8 17.7 25.775 31.374999999999996 25.15 9 16.650000000000002 24.6 34.25 24.5 10-14 19.695 30.55 26.87 22.884999999999998 15-19 19.650000000000002 29.23 27.305 23.815 20-24 19.515 29.475 27.82 23.189999999999998 25-29 19.805 29.09 27.439999999999998 23.665 30-34 19.765 29.395 27.075 23.765 35-39 19.405 28.994999999999997 27.900000000000002 23.7 40-44 19.935 28.705000000000002 27.805000000000003 23.555 45-49 19.59 28.73 27.765 23.915 50-54 19.715 29.015 27.694999999999997 23.575 55-59 20.05 28.96 27.034999999999997 23.955000000000002 60-64 19.555 28.535 27.73 24.18 65-69 19.915 28.845 27.500000000000004 23.74 70-74 19.755 28.970000000000002 27.33 23.945 75-79 19.814999999999998 29.075 27.145000000000003 23.965 80-84 19.86 28.785 27.235 24.12 85-89 20.21 28.98 27.05 23.76 90-94 19.915 28.465 27.725 23.895 95-99 20.195 28.215 27.845 23.745 100-104 20.21 28.465 27.650000000000002 23.674999999999997 105-109 19.994999999999997 28.525 27.755000000000003 23.724999999999998 110-114 20.575 28.310000000000002 27.305 23.810000000000002 115-119 20.59 28.705000000000002 26.965 23.74 120-124 20.549999999999997 28.115000000000002 27.255000000000003 24.08 125-129 20.645 29.13 26.669999999999998 23.555 130-134 20.495 28.694999999999997 26.85 23.96 135-139 20.474999999999998 28.03 27.595 23.9 140-144 20.915 28.565 27.034999999999997 23.485 145-149 20.865000000000002 27.939999999999998 27.05 24.145 150 21.55 28.075 26.075 24.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.5 21 2.0 22 1.0 23 1.5 24 1.5 25 2.0 26 3.5 27 9.0 28 13.5 29 14.5 30 23.5 31 35.5 32 38.5 33 43.5 34 55.5 35 72.5 36 96.5 37 112.0 38 114.5 39 138.5 40 195.0 41 217.5 42 245.0 43 283.0 44 280.0 45 269.5 46 260.5 47 260.0 48 234.5 49 190.0 50 165.5 51 147.5 52 110.0 53 85.0 54 77.0 55 49.0 56 31.0 57 28.0 58 24.0 59 17.5 60 13.5 61 11.0 62 6.0 63 4.0 64 3.0 65 2.0 66 1.5 67 2.0 68 2.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.525 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 0.9624999999999999 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.7625 0.0 0.0 0.0 0.0 116-117 2.025 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.8125 0.0 0.0 0.0 0.0 122-123 3.1500000000000004 0.0 0.0 0.0 0.0 124-125 3.6 0.0 0.0 0.0 0.0 126-127 3.9250000000000003 0.0 0.0 0.0 0.0 128-129 4.2375 0.0 0.0 0.0 0.0 130-131 4.675000000000001 0.0 0.0 0.0 0.0 132-133 5.05 0.0 0.0 0.0 0.0 134-135 5.475 0.0 0.0 0.0 0.0 136-137 6.05 0.0 0.0 0.0 0.0 138 6.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAATT 10 0.006973645 144.0 2 >>END_MODULE SRR4237655 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237655_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9135 33.0 33.0 34.0 32.0 34.0 2 32.913 34.0 33.0 34.0 32.0 34.0 3 33.01925 34.0 33.0 34.0 32.0 34.0 4 32.92675 34.0 33.0 34.0 32.0 34.0 5 32.9345 34.0 33.0 34.0 32.0 34.0 6 37.1165 38.0 38.0 38.0 37.0 38.0 7 37.11825 38.0 38.0 38.0 37.0 38.0 8 37.04375 38.0 38.0 38.0 36.0 38.0 9 37.0045 38.0 38.0 38.0 37.0 38.0 10-14 37.00425 38.0 38.0 38.0 37.0 38.0 15-19 37.0028 38.0 38.0 38.0 36.6 38.0 20-24 36.9855 38.0 38.0 38.0 36.8 38.0 25-29 36.41655 38.0 38.0 38.0 34.0 38.0 30-34 36.8263 38.0 38.0 38.0 36.2 38.0 35-39 36.62735 38.0 38.0 38.0 35.2 38.0 40-44 36.60115 38.0 38.0 38.0 35.2 38.0 45-49 36.372550000000004 38.0 38.0 38.0 33.6 38.0 50-54 36.7048 38.0 38.0 38.0 35.8 38.0 55-59 36.8316 38.0 38.0 38.0 36.4 38.0 60-64 36.80605 38.0 38.0 38.0 36.4 38.0 65-69 36.80805 38.0 38.0 38.0 36.2 38.0 70-74 36.6545 38.0 38.0 38.0 35.6 38.0 75-79 36.786699999999996 38.0 38.0 38.0 36.2 38.0 80-84 36.64735 38.0 38.0 38.0 35.8 38.0 85-89 36.596000000000004 38.0 38.0 38.0 35.8 38.0 90-94 36.55575 38.0 38.0 38.0 35.4 38.0 95-99 36.52065 38.0 38.0 38.0 35.2 38.0 100-104 36.4793 38.0 38.0 38.0 35.6 38.0 105-109 36.22895 38.0 38.0 38.0 34.4 38.0 110-114 36.23440000000001 38.0 38.0 38.0 34.2 38.0 115-119 36.18425 38.0 38.0 38.0 34.0 38.0 120-124 36.0572 38.0 38.0 38.0 34.0 38.0 125-129 36.06585 38.0 38.0 38.0 34.2 38.0 130-134 36.0253 38.0 38.0 38.0 34.0 38.0 135-139 35.93335 38.0 38.0 38.0 33.8 38.0 140-144 35.548950000000005 38.0 38.0 38.0 32.6 38.0 145-149 35.3093 38.0 38.0 38.0 32.6 38.0 150 30.20525 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 6.0 4 3.0 5 4.0 6 1.0 7 3.0 8 2.0 9 2.0 10 4.0 11 1.0 12 3.0 13 5.0 14 3.0 15 4.0 16 4.0 17 7.0 18 4.0 19 8.0 20 8.0 21 5.0 22 9.0 23 14.0 24 14.0 25 13.0 26 14.0 27 29.0 28 23.0 29 32.0 30 39.0 31 35.0 32 50.0 33 63.0 34 86.0 35 150.0 36 291.0 37 3058.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.025 21.775 12.25 21.95 2 27.750000000000004 26.35 29.325000000000003 16.575 3 21.325 28.525 30.599999999999998 19.55 4 24.375 35.0 23.200000000000003 17.424999999999997 5 25.525 35.475 22.6 16.400000000000002 6 21.224999999999998 38.3 23.275000000000002 17.2 7 20.575 21.175 40.375 17.875 8 22.675 24.55 27.875 24.9 9 21.9 25.674999999999997 29.825000000000003 22.6 10-14 24.13 28.84 26.369999999999997 20.66 15-19 22.735 28.355000000000004 27.800000000000004 21.11 20-24 23.3 28.215 28.015 20.47 25-29 23.494999999999997 27.839999999999996 28.255000000000003 20.41 30-34 23.565 27.67 28.375 20.39 35-39 23.155 28.26 27.884999999999998 20.7 40-44 23.825 27.810000000000002 28.189999999999998 20.175 45-49 23.79 28.205000000000002 27.884999999999998 20.119999999999997 50-54 23.41 27.794999999999998 28.365000000000002 20.43 55-59 23.265 27.865000000000002 28.63 20.24 60-64 23.830000000000002 27.534999999999997 28.33 20.305 65-69 23.46 27.584999999999997 28.42 20.535 70-74 23.799999999999997 28.155 27.939999999999998 20.105 75-79 23.57 27.894999999999996 28.355000000000004 20.18 80-84 23.74 27.61 28.54 20.11 85-89 24.14 27.200000000000003 28.025 20.635 90-94 24.055 27.150000000000002 28.935 19.86 95-99 23.685000000000002 27.725 28.1 20.49 100-104 23.79 27.465 28.705000000000002 20.04 105-109 23.84 27.625 28.375 20.16 110-114 23.849999999999998 28.37 27.665 20.115 115-119 24.625 28.244999999999997 27.48 19.650000000000002 120-124 23.880000000000003 27.875 28.025 20.22 125-129 24.265 27.939999999999998 27.650000000000002 20.145 130-134 24.87 27.73 27.575 19.825 135-139 24.565 27.775 27.915 19.744999999999997 140-144 25.119999999999997 28.18 27.175 19.525000000000002 145-149 25.06 28.315 27.22 19.405 150 24.349999999999998 28.000000000000004 27.975 19.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 1.0 22 1.0 23 2.0 24 3.0 25 3.5 26 4.0 27 5.0 28 9.0 29 11.5 30 15.5 31 21.5 32 25.0 33 32.0 34 52.0 35 73.0 36 84.0 37 95.0 38 124.5 39 161.5 40 205.0 41 236.5 42 255.5 43 280.5 44 284.0 45 274.5 46 273.0 47 262.5 48 221.0 49 195.5 50 175.5 51 139.5 52 109.0 53 87.5 54 76.0 55 53.0 56 33.5 57 29.0 58 21.0 59 17.0 60 14.5 61 8.5 62 6.0 63 4.0 64 3.5 65 3.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.7375 0.0 0.0 0.0 0.0 116-117 2.025 0.0 0.0 0.0 0.0 118-119 2.3625 0.0 0.0 0.0 0.0 120-121 2.8375 0.0 0.0 0.0 0.0 122-123 3.175 0.0 0.0 0.0 0.0 124-125 3.5625 0.0 0.0 0.0 0.0 126-127 3.9250000000000003 0.0 0.0 0.0 0.0 128-129 4.2125 0.0 0.0 0.0 0.0 130-131 4.725 0.0 0.0 0.0 0.0 132-133 5.125 0.0 0.0 0.0 0.0 134-135 5.5375 0.0 0.0 0.0 0.0 136-137 6.0875 0.0 0.0 0.0 0.0 138 6.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 30 0.0015031899 23.999998 110-114 >>END_MODULE Read 2231978 spots for SRR4237655.sra Written 2231978 spots for SRR4237655.sra Read 2231978 spots for SRR4237655.sra Written 2231978 spots for SRR4237655.sra Read 2231978 spots for SRR4237655.sra Written 2231978 spots for SRR4237655.sra Read 2231978 spots for SRR4237655.sra Written 2231978 spots for SRR4237655.sra Read 2231978 spots for SRR4237655.sra Written 2231978 spots for SRR4237655.sra Read 2231978 spots for SRR4237655.sra Written 2231978 spots for SRR4237655.sra Read 2231978 spots for SRR4237655.sra Written 2231978 spots for SRR4237655.sra Read 2231978 spots for SRR4237655.sra Written 2231978 spots for SRR4237655.sra Read 2231978 spots for SRR4237655.sra Written 2231978 spots for SRR4237655.sra Read 2231978 spots for SRR4237655.sra Written 2231978 spots for SRR4237655.sra Read 2231978 spots for SRR4237655.sra Written 2231978 spots for SRR4237655.sra Read 2231978 spots for SRR4237655.sra Written 2231978 spots for SRR4237655.sra Read 2231978 spots for SRR4237655.sra Written 2231978 spots for SRR4237655.sra Read 2231978 spots for SRR4237655.sra Written 2231978 spots for SRR4237655.sra Read 2231978 spots for SRR4237655.sra Written 2231978 spots for SRR4237655.sra Read 2231978 spots for SRR4237655.sra Written 2231978 spots for SRR4237655.sra Read 2231978 spots for SRR4237655.sra Written 2231978 spots for SRR4237655.sra Read 2231978 spots for SRR4237655.sra Written 2231978 spots for SRR4237655.sra Read 2231994 spots for SRR4237655.sra Written 2231994 spots for SRR4237655.sra Read 2231978 spots for SRR4237655.sra Written 2231978 spots for SRR4237655.sra SRR ids: ['SRR4237655.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_17d1tlyg SRR4237655.sra spots: 44639576 blocks: [[1, 2231978], [2231979, 4463956], [4463957, 6695934], [6695935, 8927912], [8927913, 11159890], [11159891, 13391868], [13391869, 15623846], [15623847, 17855824], [17855825, 20087802], [20087803, 22319780], [22319781, 24551758], [24551759, 26783736], [26783737, 29015714], [29015715, 31247692], [31247693, 33479670], [33479671, 35711648], [35711649, 37943626], [37943627, 40175604], [40175605, 42407582], [42407583, 44639576]] SRR4237655 file size 15018000 SRR4237655 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237655 SRR4237655_1.fastq SRR4237655_2.fastq Input file: SRR4237655_1.fastq Paired file: SRR4237655_2.fastq trimmed: SRR4237655-trimmed-pair1.fastq, SRR4237655-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:24:04 2025 >> started Wed Feb 12 21:24:57 2025 >> done (53.168s) 44639576 read pairs processed; of these: 109449 ( 0.25%) short read pairs filtered out after trimming by size control 43249 ( 0.10%) empty read pairs filtered out after trimming by size control 44486878 (99.66%) read pairs available; of these: 13011625 (29.25%) trimmed read pairs available after processing 31475253 (70.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 12 0.00% 20 9 0.00% 21 8 0.00% 22 14 0.00% 23 7 0.00% 24 12 0.00% 25 6 0.00% 26 17 0.00% 27 18 0.00% 28 14 0.00% 29 12 0.00% 30 18 0.00% 31 16 0.00% 32 13 0.00% 33 28 0.00% 34 12 0.00% 35 19 0.00% 36 32 0.00% 37 30 0.00% 38 31 0.00% 39 32 0.00% 40 39 0.00% 41 46 0.00% 42 38 0.00% 43 69 0.00% 44 65 0.00% 45 74 0.00% 46 69 0.00% 47 83 0.00% 48 106 0.00% 49 128 0.00% 50 101 0.00% 51 150 0.00% 52 162 0.00% 53 174 0.00% 54 202 0.00% 55 224 0.00% 56 230 0.00% 57 251 0.00% 58 309 0.00% 59 307 0.00% 60 388 0.00% 61 428 0.00% 62 494 0.00% 63 525 0.00% 64 609 0.00% 65 673 0.00% 66 828 0.00% 67 958 0.00% 68 1309 0.00% 69 3784 0.01% 70 6200 0.01% 71 4530 0.01% 72 3018 0.01% 73 2219 0.00% 74 2277 0.01% 75 2530 0.01% 76 2746 0.01% 77 3084 0.01% 78 3368 0.01% 79 3778 0.01% 80 4262 0.01% 81 4809 0.01% 82 5591 0.01% 83 6896 0.02% 84 17627 0.04% 85 14166 0.03% 86 13958 0.03% 87 16041 0.04% 88 17163 0.04% 89 14759 0.03% 90 16113 0.04% 91 17153 0.04% 92 21496 0.05% 93 21208 0.05% 94 24895 0.06% 95 24344 0.05% 96 25600 0.06% 97 26956 0.06% 98 28348 0.06% 99 30414 0.07% 100 32338 0.07% 101 34659 0.08% 102 37186 0.08% 103 39828 0.09% 104 42318 0.10% 105 45787 0.10% 106 48614 0.11% 107 53641 0.12% 108 55314 0.12% 109 56504 0.13% 110 58828 0.13% 111 62240 0.14% 112 65276 0.15% 113 68568 0.15% 114 72665 0.16% 115 76766 0.17% 116 80758 0.18% 117 84243 0.19% 118 87962 0.20% 119 91013 0.20% 120 95468 0.21% 121 98614 0.22% 122 105023 0.24% 123 105470 0.24% 124 109971 0.25% 125 113534 0.26% 126 117951 0.27% 127 122486 0.28% 128 126397 0.28% 129 130924 0.29% 130 135063 0.30% 131 138674 0.31% 132 143738 0.32% 133 148202 0.33% 134 153199 0.34% 135 160469 0.36% 136 171510 0.39% 137 174323 0.39% 138 182406 0.41% 139 190708 0.43% 140 199239 0.45% 141 212682 0.48% 142 226417 0.51% 143 241842 0.54% 144 270722 0.61% 145 307795 0.69% 146 370821 0.83% 147 526669 1.18% 148 833954 1.87% 149 5504105 12.37% 150 31475253 70.75% 44486878 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=40 prefix-density=0.14 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=10 fanout-score=268.91 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=28.7 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=34 prefix-density=0.22 prefix-fanout=2.7 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=12 fanout-score=295.76 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=28.1 sequence=AAGAAGAAGAAG SRR4237655 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:25:45 Started mapping on | Feb 12 21:25:45 Finished on | Feb 12 21:30:13 Mapping speed, Million of reads per hour | 597.58 Number of input reads | 44486878 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 42833352 Uniquely mapped reads % | 96.28% Average mapped length | 292.94 Number of splices: Total | 39648309 Number of splices: Annotated (sjdb) | 38960879 Number of splices: GT/AG | 39023928 Number of splices: GC/AG | 492109 Number of splices: AT/AC | 38179 Number of splices: Non-canonical | 94093 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 888232 % of reads mapped to multiple loci | 2.00% Number of reads mapped to too many loci | 63519 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.55% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 826440 826440 826440 N_multimapping 888232 888232 888232 N_noFeature 1208787 42266426 1560189 N_ambiguous 400619 2719 183175 UnstrandedReadsAssigned:41223946 PositiveStrandReadsAssigned:564207 NegativeStrandReadsAssigned:41089988 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237655 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237655-trimmed-pair1.fastq SRR4237655-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,486,878 reads, 40,834,588 reads pseudoaligned [quant] estimated average fragment length: 232.039 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,236 rounds 52401 SRR4237655.ke.tsv 34699 SRR4237655.se.tsv 87100 total ==> SRR4237655.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.96 1077 14.711 Potri.005G024800.1.v4.1 1035 803.961 116 3.52179 Potri.004G059700.1.v4.1 961 730.002 114 3.81172 Potri.007G009000.2.v4.1 1416 1184.96 0 0 Potri.003G141000.2.v4.1 2943 2711.96 660.07 5.94082 Potri.016G087400.1.v4.1 270 84.031 5083.19 1476.51 Potri.015G069301.1.v4.1 564 337.55 0 0 Potri.010G195200.1.v4.1 1773 1541.96 145.88 2.30921 Potri.012G127500.1.v4.1 977 745.982 17140 560.819 ==> SRR4237655.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4198 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 811 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR4237655 completed mapping pipeline successfully