Starting /dee2/code/volunteer_pipeline.sh SRR4237656 current disk space = 3050639773696 free memory = 1567120748 SRR4237656 SRAfilesize 4f5bcf1380475cb1fe4c6c5890c4d33a SRR4237656.sra SRR4237656.sra file validated SRR4237656 is paired end SRR4237656 is conventional basespace SRR4237656 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237656_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.36025 34.0 33.0 34.0 33.0 34.0 2 33.368 34.0 33.0 34.0 33.0 34.0 3 33.4455 34.0 34.0 34.0 33.0 34.0 4 33.37475 34.0 34.0 34.0 33.0 34.0 5 33.403 34.0 34.0 34.0 33.0 34.0 6 36.063 38.0 37.0 38.0 34.0 38.0 7 37.165 38.0 38.0 38.0 36.0 38.0 8 37.26525 38.0 38.0 38.0 36.0 38.0 9 37.46375 38.0 38.0 38.0 37.0 38.0 10-14 37.54065 38.0 38.0 38.0 38.0 38.0 15-19 37.5111 38.0 38.0 38.0 38.0 38.0 20-24 37.504149999999996 38.0 38.0 38.0 37.8 38.0 25-29 37.5186 38.0 38.0 38.0 38.0 38.0 30-34 36.51065 38.0 37.6 38.0 33.2 38.0 35-39 37.345549999999996 38.0 38.0 38.0 36.8 38.0 40-44 37.372249999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.19025 38.0 38.0 38.0 36.4 38.0 50-54 37.21655 38.0 38.0 38.0 36.8 38.0 55-59 37.2297 38.0 38.0 38.0 37.0 38.0 60-64 37.20015 38.0 38.0 38.0 37.0 38.0 65-69 37.161500000000004 38.0 38.0 38.0 36.8 38.0 70-74 37.106399999999994 38.0 38.0 38.0 36.4 38.0 75-79 37.00095 38.0 38.0 38.0 36.0 38.0 80-84 36.9927 38.0 38.0 38.0 36.0 38.0 85-89 36.8242 38.0 38.0 38.0 35.6 38.0 90-94 35.68115 38.0 35.8 38.0 30.0 38.0 95-99 36.405499999999996 38.0 37.6 38.0 34.2 38.0 100-104 36.82545 38.0 38.0 38.0 35.6 38.0 105-109 36.83615 38.0 38.0 38.0 35.8 38.0 110-114 36.6755 38.0 38.0 38.0 35.2 38.0 115-119 36.57405 38.0 38.0 38.0 35.0 38.0 120-124 36.56895 38.0 38.0 38.0 35.0 38.0 125-129 36.3651 38.0 38.0 38.0 34.0 38.0 130-134 36.3394 38.0 38.0 38.0 34.2 38.0 135-139 34.53054999999999 37.8 34.2 38.0 27.2 38.0 140-144 35.7459 38.0 37.2 38.0 33.0 38.0 145-149 35.5441 38.0 38.0 38.0 33.0 38.0 150 30.18825 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 2.0 15 6.0 16 3.0 17 1.0 18 1.0 19 3.0 20 3.0 21 2.0 22 2.0 23 7.0 24 10.0 25 8.0 26 9.0 27 23.0 28 20.0 29 21.0 30 26.0 31 39.0 32 64.0 33 76.0 34 107.0 35 178.0 36 511.0 37 2873.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.0 12.45 8.475000000000001 32.074999999999996 2 23.63090772693173 15.378844711177795 33.4333583395849 27.556889222305575 3 20.175 20.349999999999998 26.575 32.9 4 22.125 28.475 24.075 25.324999999999996 5 22.75 33.800000000000004 24.15 19.3 6 18.855823499230375 35.94150846587994 23.31965110312981 21.883016931759876 7 14.2 25.900000000000002 41.975 17.925 8 16.45 25.874999999999996 31.175000000000004 26.5 9 17.8 24.725 33.375 24.099999999999998 10-14 19.8 30.115 26.755000000000003 23.330000000000002 15-19 20.0 29.26 27.36 23.380000000000003 20-24 19.900000000000002 29.28 26.784999999999997 24.035 25-29 19.78 29.2 27.275 23.745 30-34 20.14 28.735 27.750000000000004 23.375 35-39 19.915 29.044999999999998 27.405 23.635 40-44 19.81 29.04 27.339999999999996 23.810000000000002 45-49 20.23 29.785 26.83 23.155 50-54 20.044999999999998 29.220000000000002 27.52 23.215 55-59 20.23 28.76 27.3 23.71 60-64 20.03 28.87 27.615000000000002 23.485 65-69 20.61 28.815 27.07 23.505000000000003 70-74 19.97 28.955 27.245 23.830000000000002 75-79 20.685000000000002 28.694999999999997 27.139999999999997 23.48 80-84 20.615 28.875 27.46 23.05 85-89 20.69 28.875 27.250000000000004 23.185 90-94 20.595 29.035 27.01 23.36 95-99 20.44 28.965000000000003 26.950000000000003 23.645 100-104 20.66 29.65 26.745 22.945 105-109 20.685000000000002 29.09 26.0 24.224999999999998 110-114 21.265 28.555000000000003 26.455000000000002 23.724999999999998 115-119 20.875 29.075 26.61 23.44 120-124 21.345 28.665000000000003 25.88 24.11 125-129 20.9 28.355000000000004 26.035000000000004 24.709999999999997 130-134 21.2 28.825 25.490000000000002 24.485 135-139 20.305 28.360000000000003 25.745 25.590000000000003 140-144 21.115000000000002 27.900000000000002 24.965 26.02 145-149 19.985 28.12 25.495 26.400000000000002 150 20.427672955974842 27.471698113207548 25.710691823899374 26.38993710691824 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.5 22 1.0 23 1.5 24 3.5 25 6.5 26 7.5 27 8.0 28 9.5 29 12.0 30 17.0 31 26.5 32 38.0 33 46.5 34 59.0 35 85.0 36 104.0 37 113.0 38 127.0 39 157.5 40 198.0 41 197.5 42 209.0 43 249.0 44 270.0 45 263.5 46 253.0 47 254.0 48 245.0 49 211.0 50 166.0 51 139.5 52 113.0 53 86.5 54 73.0 55 67.0 56 45.0 57 29.0 58 27.5 59 17.5 60 10.0 61 9.5 62 9.5 63 8.0 64 5.0 65 2.0 66 3.0 67 3.0 68 2.0 69 2.0 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 2.55 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64841788046208 99.2 2 0.3264691109994977 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025113008538422906 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCATCTCGTATGC 6 0.15 TruSeq Adapter, Index 16 (98% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.21250000000000002 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.36250000000000004 0.0 0.0 0.0 0.0 76-77 0.44999999999999996 0.0 0.0 0.0 0.0 78-79 0.55 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.8 0.0 0.0 0.0 0.0 84-85 1.1 0.0 0.0 0.0 0.0 86-87 1.2625 0.0 0.0 0.0 0.0 88-89 1.4375 0.0 0.0 0.0 0.0 90-91 1.825 0.0 0.0 0.0 0.0 92-93 2.175 0.0 0.0 0.0 0.0 94-95 2.6624999999999996 0.0 0.0 0.0 0.0 96-97 3.1875 0.0 0.0 0.0 0.0 98-99 3.6125 0.0 0.0 0.0 0.0 100-101 4.1 0.0 0.0 0.0 0.0 102-103 4.8125 0.0 0.0 0.0 0.0 104-105 5.675000000000001 0.0 0.0 0.0 0.0 106-107 6.3375 0.0 0.0 0.0 0.0 108-109 7.1125 0.0 0.0 0.0 0.0 110-111 8.1375 0.0 0.0 0.0 0.0 112-113 8.9375 0.0 0.0 0.0 0.0 114-115 9.8875 0.0 0.0 0.0 0.0 116-117 10.912500000000001 0.0 0.0 0.0 0.0 118-119 11.8875 0.0 0.0 0.0 0.0 120-121 12.8625 0.0 0.0 0.0 0.0 122-123 13.9 0.0 0.0 0.0 0.0 124-125 14.875 0.0 0.0 0.0 0.0 126-127 15.9125 0.0 0.0 0.0 0.0 128-129 16.862499999999997 0.0 0.0 0.0 0.0 130-131 17.775 0.0 0.0 0.0 0.0 132-133 18.725 0.0 0.0 0.0 0.0 134-135 19.725 0.0 0.0 0.0 0.0 136-137 20.95 0.0 0.0 0.0 0.0 138 21.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATTGA 10 0.0067234724 145.74683 4 CGATGAT 10 0.0067234724 145.74683 1 >>END_MODULE SRR4237656 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237656_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62075 33.0 33.0 34.0 32.0 34.0 2 31.18 33.0 32.0 34.0 18.0 34.0 3 32.48525 33.0 33.0 34.0 31.0 34.0 4 32.62 33.0 33.0 34.0 32.0 34.0 5 32.756 34.0 33.0 34.0 32.0 34.0 6 36.94975 38.0 38.0 38.0 37.0 38.0 7 37.07875 38.0 38.0 38.0 37.0 38.0 8 37.071 38.0 38.0 38.0 37.0 38.0 9 37.08475 38.0 38.0 38.0 37.0 38.0 10-14 37.01595 38.0 38.0 38.0 37.0 38.0 15-19 37.04475 38.0 38.0 38.0 37.0 38.0 20-24 37.0076 38.0 38.0 38.0 37.0 38.0 25-29 36.9694 38.0 38.0 38.0 37.0 38.0 30-34 36.97565 38.0 38.0 38.0 37.0 38.0 35-39 36.906099999999995 38.0 38.0 38.0 37.0 38.0 40-44 36.850699999999996 38.0 38.0 38.0 36.8 38.0 45-49 36.8757 38.0 38.0 38.0 37.0 38.0 50-54 36.783699999999996 38.0 38.0 38.0 36.4 38.0 55-59 36.7917 38.0 38.0 38.0 36.4 38.0 60-64 36.8183 38.0 38.0 38.0 36.2 38.0 65-69 36.67125 38.0 38.0 38.0 36.0 38.0 70-74 36.3512 38.0 37.8 38.0 34.2 38.0 75-79 36.49955 38.0 38.0 38.0 35.4 38.0 80-84 36.41615 38.0 38.0 38.0 35.0 38.0 85-89 35.488749999999996 38.0 37.0 38.0 28.0 38.0 90-94 35.6366 38.0 37.2 38.0 30.2 38.0 95-99 36.2388 38.0 38.0 38.0 34.4 38.0 100-104 36.33815 38.0 38.0 38.0 34.8 38.0 105-109 36.14919999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.1402 38.0 38.0 38.0 34.2 38.0 115-119 36.03605 38.0 38.0 38.0 34.0 38.0 120-124 35.994350000000004 38.0 38.0 38.0 34.0 38.0 125-129 35.726099999999995 38.0 38.0 38.0 33.2 38.0 130-134 35.6744 38.0 38.0 38.0 33.2 38.0 135-139 35.345099999999995 38.0 37.4 38.0 31.4 38.0 140-144 34.9512 38.0 36.8 38.0 30.2 38.0 145-149 34.469699999999996 38.0 36.0 38.0 28.8 38.0 150 27.449 33.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 7.0 4 6.0 5 2.0 6 5.0 7 3.0 8 3.0 9 6.0 10 2.0 11 1.0 12 1.0 13 4.0 14 1.0 15 3.0 16 4.0 17 8.0 18 5.0 19 3.0 20 8.0 21 2.0 22 8.0 23 9.0 24 12.0 25 15.0 26 18.0 27 18.0 28 21.0 29 24.0 30 40.0 31 35.0 32 62.0 33 76.0 34 115.0 35 174.0 36 412.0 37 2874.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.825 22.15 12.125 22.900000000000002 2 28.325 24.8 31.574999999999996 15.299999999999999 3 21.099999999999998 28.175 32.225 18.5 4 24.5 34.025 24.375 17.1 5 25.324999999999996 38.074999999999996 21.7 14.899999999999999 6 20.625 37.2 24.15 18.025 7 18.175 20.724999999999998 41.125 19.975 8 21.75 24.7 29.2 24.349999999999998 9 23.05 24.675 28.925 23.35 10-14 23.46 28.535 26.979999999999997 21.025 15-19 23.355 27.284999999999997 28.465 20.895 20-24 23.32 28.27 28.15 20.26 25-29 23.405 27.55 28.075 20.97 30-34 23.49 27.29 29.18 20.04 35-39 22.830000000000002 27.950000000000003 28.405 20.815 40-44 23.805 27.779999999999998 28.225 20.19 45-49 23.205000000000002 27.41 28.410000000000004 20.974999999999998 50-54 22.825 27.615000000000002 28.22 21.34 55-59 23.54 27.13 28.685 20.645 60-64 23.02 27.700000000000003 28.494999999999997 20.785 65-69 22.605 28.294999999999998 28.485 20.615 70-74 24.224999999999998 26.63 28.555000000000003 20.59 75-79 23.400000000000002 27.060000000000002 29.354999999999997 20.185 80-84 23.244999999999997 27.605 29.13 20.02 85-89 24.05 27.51 28.335 20.105 90-94 23.97 27.805000000000003 28.095 20.13 95-99 23.9 27.279999999999998 28.349999999999998 20.47 100-104 24.035 28.044999999999998 27.839999999999996 20.080000000000002 105-109 24.709999999999997 27.565 27.965 19.759999999999998 110-114 25.4 27.715 26.85 20.035 115-119 25.264999999999997 28.095 27.16 19.48 120-124 25.840000000000003 27.93 27.275 18.955 125-129 26.735 27.79 26.625 18.85 130-134 27.04 28.17 25.955000000000002 18.834999999999997 135-139 26.479999999999997 27.650000000000002 26.87 19.0 140-144 27.435 27.52 26.3 18.745 145-149 27.02 28.110000000000003 26.474999999999998 18.395 150 26.450000000000003 28.575 26.450000000000003 18.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.5 18 1.5 19 0.5 20 2.0 21 1.5 22 2.5 23 3.0 24 3.5 25 4.0 26 3.0 27 9.0 28 12.5 29 10.0 30 16.5 31 26.5 32 30.0 33 32.5 34 50.0 35 83.5 36 106.0 37 114.5 38 128.0 39 157.5 40 182.5 41 215.5 42 248.5 43 262.5 44 263.5 45 262.5 46 257.0 47 247.0 48 240.5 49 204.0 50 164.0 51 147.0 52 127.5 53 96.5 54 72.0 55 54.5 56 38.5 57 25.0 58 17.0 59 15.5 60 12.5 61 9.0 62 8.0 63 6.5 64 6.0 65 7.0 66 4.0 67 0.5 68 1.0 69 1.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59748427672956 98.97500000000001 2 0.27672955974842767 0.5499999999999999 3 0.10062893081761005 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025157232704402514 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 7 0.17500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.3375 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.675 0.0 0.0 0.0 0.0 84-85 0.9875 0.0 0.0 0.0 0.0 86-87 1.1375 0.0 0.0 0.0 0.0 88-89 1.3125 0.0 0.0 0.0 0.0 90-91 1.75 0.0 0.0 0.0 0.0 92-93 2.0875 0.0 0.0 0.0 0.0 94-95 2.5875 0.0 0.0 0.0 0.0 96-97 3.1375 0.0 0.0 0.0 0.0 98-99 3.5375 0.0 0.0 0.0 0.0 100-101 4.0125 0.0 0.0 0.0 0.0 102-103 4.7875 0.0 0.0 0.0 0.0 104-105 5.6375 0.0 0.0 0.0 0.0 106-107 6.35 0.0 0.0 0.0 0.0 108-109 7.1625 0.0 0.0 0.0 0.0 110-111 8.125 0.0 0.0 0.0 0.0 112-113 8.912500000000001 0.0 0.0 0.0 0.0 114-115 9.850000000000001 0.0 0.0 0.0 0.0 116-117 10.8375 0.0 0.0 0.0 0.0 118-119 11.787500000000001 0.0 0.0 0.0 0.0 120-121 12.725 0.0 0.0 0.0 0.0 122-123 13.775 0.0 0.0 0.0 0.0 124-125 14.712499999999999 0.0 0.0 0.0 0.0 126-127 15.6875 0.0 0.0 0.0 0.0 128-129 16.6625 0.0 0.0 0.0 0.0 130-131 17.625 0.0 0.0 0.0 0.0 132-133 18.737499999999997 0.0 0.0 0.0 0.0 134-135 19.6875 0.0 0.0 0.0 0.0 136-137 20.8875 0.0 0.0 0.0 0.0 138 21.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1829436 spots for SRR4237656.sra Written 1829436 spots for SRR4237656.sra Read 1829436 spots for SRR4237656.sra Written 1829436 spots for SRR4237656.sra Read 1829436 spots for SRR4237656.sra Written 1829436 spots for SRR4237656.sra Read 1829436 spots for SRR4237656.sra Written 1829436 spots for SRR4237656.sra Read 1829436 spots for SRR4237656.sra Written 1829436 spots for SRR4237656.sra Read 1829436 spots for SRR4237656.sra Written 1829436 spots for SRR4237656.sra Read 1829436 spots for SRR4237656.sra Written 1829436 spots for SRR4237656.sra Read 1829436 spots for SRR4237656.sra Written 1829436 spots for SRR4237656.sra Read 1829436 spots for SRR4237656.sra Written 1829436 spots for SRR4237656.sra Read 1829436 spots for SRR4237656.sra Written 1829436 spots for SRR4237656.sra Read 1829436 spots for SRR4237656.sra Written 1829436 spots for SRR4237656.sra Read 1829436 spots for SRR4237656.sra Written 1829436 spots for SRR4237656.sra Read 1829454 spots for SRR4237656.sra Written 1829454 spots for SRR4237656.sra Read 1829436 spots for SRR4237656.sra Written 1829436 spots for SRR4237656.sra Read 1829436 spots for SRR4237656.sra Written 1829436 spots for SRR4237656.sra Read 1829436 spots for SRR4237656.sra Written 1829436 spots for SRR4237656.sra Read 1829436 spots for SRR4237656.sra Written 1829436 spots for SRR4237656.sra Read 1829436 spots for SRR4237656.sra Written 1829436 spots for SRR4237656.sra Read 1829436 spots for SRR4237656.sra Written 1829436 spots for SRR4237656.sra Read 1829436 spots for SRR4237656.sra Written 1829436 spots for SRR4237656.sra SRR ids: ['SRR4237656.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xpy4qig5 SRR4237656.sra spots: 36588738 blocks: [[1, 1829436], [1829437, 3658872], [3658873, 5488308], [5488309, 7317744], [7317745, 9147180], [9147181, 10976616], [10976617, 12806052], [12806053, 14635488], [14635489, 16464924], [16464925, 18294360], [18294361, 20123796], [20123797, 21953232], [21953233, 23782668], [23782669, 25612104], [25612105, 27441540], [27441541, 29270976], [29270977, 31100412], [31100413, 32929848], [32929849, 34759284], [34759285, 36588738]] SRR4237656 file size 12305559 SRR4237656 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237656 SRR4237656_1.fastq SRR4237656_2.fastq Input file: SRR4237656_1.fastq Paired file: SRR4237656_2.fastq trimmed: SRR4237656-trimmed-pair1.fastq, SRR4237656-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:59:54 2025 >> started Wed Feb 12 22:00:35 2025 >> done (41.368s) 36588738 read pairs processed; of these: 70700 ( 0.19%) short read pairs filtered out after trimming by size control 80487 ( 0.22%) empty read pairs filtered out after trimming by size control 36437551 (99.59%) read pairs available; of these: 17231308 (47.29%) trimmed read pairs available after processing 19206243 (52.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 8 0.00% 20 15 0.00% 21 12 0.00% 22 16 0.00% 23 26 0.00% 24 13 0.00% 25 21 0.00% 26 24 0.00% 27 21 0.00% 28 26 0.00% 29 35 0.00% 30 32 0.00% 31 42 0.00% 32 65 0.00% 33 56 0.00% 34 72 0.00% 35 76 0.00% 36 90 0.00% 37 104 0.00% 38 107 0.00% 39 152 0.00% 40 157 0.00% 41 220 0.00% 42 229 0.00% 43 259 0.00% 44 285 0.00% 45 336 0.00% 46 371 0.00% 47 446 0.00% 48 497 0.00% 49 617 0.00% 50 735 0.00% 51 821 0.00% 52 871 0.00% 53 1029 0.00% 54 1137 0.00% 55 1387 0.00% 56 1481 0.00% 57 1695 0.00% 58 2096 0.01% 59 2330 0.01% 60 2706 0.01% 61 3216 0.01% 62 3536 0.01% 63 4056 0.01% 64 4450 0.01% 65 5062 0.01% 66 6028 0.02% 67 7503 0.02% 68 9675 0.03% 69 16291 0.04% 70 12877 0.04% 71 11010 0.03% 72 12225 0.03% 73 13725 0.04% 74 14984 0.04% 75 16959 0.05% 76 18679 0.05% 77 20280 0.06% 78 23052 0.06% 79 25727 0.07% 80 28600 0.08% 81 31999 0.09% 82 36163 0.10% 83 40410 0.11% 84 51677 0.14% 85 53384 0.15% 86 54478 0.15% 87 58808 0.16% 88 63499 0.17% 89 68328 0.19% 90 72541 0.20% 91 80615 0.22% 92 85569 0.23% 93 92032 0.25% 94 99438 0.27% 95 104419 0.29% 96 109770 0.30% 97 113967 0.31% 98 117537 0.32% 99 123915 0.34% 100 130043 0.36% 101 134021 0.37% 102 142232 0.39% 103 148394 0.41% 104 155010 0.43% 105 160937 0.44% 106 164581 0.45% 107 167292 0.46% 108 171177 0.47% 109 173132 0.48% 110 176510 0.48% 111 180647 0.50% 112 186118 0.51% 113 190685 0.52% 114 196143 0.54% 115 199934 0.55% 116 200659 0.55% 117 203041 0.56% 118 204609 0.56% 119 204643 0.56% 120 206719 0.57% 121 207255 0.57% 122 210708 0.58% 123 214117 0.59% 124 217488 0.60% 125 218030 0.60% 126 220464 0.61% 127 221177 0.61% 128 221243 0.61% 129 222489 0.61% 130 223246 0.61% 131 222254 0.61% 132 225063 0.62% 133 227750 0.63% 134 226999 0.62% 135 230906 0.63% 136 232485 0.64% 137 233175 0.64% 138 238992 0.66% 139 241437 0.66% 140 244094 0.67% 141 251848 0.69% 142 258608 0.71% 143 267044 0.73% 144 284677 0.78% 145 310868 0.85% 146 355020 0.97% 147 433724 1.19% 148 694838 1.91% 149 4441568 12.19% 150 19206243 52.71% 36437551 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=12.85 fanout-score-rank=14 prefix-density=0.30 prefix-fanout=6.5 sequence=GGTGCTGGTGCTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=203.21 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=9.4 sequence=AGCAGCAAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTGAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTACTATCAGTACTCATCTCCTTCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTA criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=37 prefix-density=0.16 prefix-fanout=2.4 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=2240.53 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=28.0 sequence=AAGAAGAAGTAAAGGAAGAACAGAAGCCTGTTGAAACAGAGGAGAAGGTTGAAACAGAAACCCCAGTAGAAAAGACTGAGTAATGAGGT SRR4237656 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:01:20 Started mapping on | Feb 12 22:01:20 Finished on | Feb 12 22:06:02 Mapping speed, Million of reads per hour | 465.16 Number of input reads | 36437551 Average input read length | 280 UNIQUE READS: Uniquely mapped reads number | 33915735 Uniquely mapped reads % | 93.08% Average mapped length | 279.96 Number of splices: Total | 26874029 Number of splices: Annotated (sjdb) | 26389601 Number of splices: GT/AG | 26457774 Number of splices: GC/AG | 312580 Number of splices: AT/AC | 24919 Number of splices: Non-canonical | 78756 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 632241 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 227055 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.45% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1926446 1926446 1926446 N_multimapping 632241 632241 632241 N_noFeature 1103060 33407729 1397672 N_ambiguous 362863 2693 147465 UnstrandedReadsAssigned:32449812 PositiveStrandReadsAssigned:505313 NegativeStrandReadsAssigned:32370598 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=130 echo kmer=125 SRR4237656 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237656-trimmed-pair1.fastq SRR4237656-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,437,551 reads, 32,452,492 reads pseudoaligned [quant] estimated average fragment length: 188.986 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,343 rounds 52401 SRR4237656.ke.tsv 34699 SRR4237656.se.tsv 87100 total ==> SRR4237656.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1830.01 706 13.4024 Potri.005G024800.1.v4.1 1035 847.014 95 3.89642 Potri.004G059700.1.v4.1 961 773.027 21 0.943752 Potri.007G009000.2.v4.1 1416 1228.01 0 0 Potri.003G141000.2.v4.1 2943 2755.01 395.19 4.98327 Potri.016G087400.1.v4.1 270 110.567 3512 1103.47 Potri.015G069301.1.v4.1 564 378.409 0 0 Potri.010G195200.1.v4.1 1773 1585.01 262 5.7425 Potri.012G127500.1.v4.1 977 789.027 9270 408.151 ==> SRR4237656.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3954 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 622 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR4237656 completed mapping pipeline successfully