Starting /dee2/code/volunteer_pipeline.sh SRR4237657 current disk space = 3050694205440 free memory = 1579940000 SRR4237657 SRAfilesize a71e5b5f8a54ad6b89976d6497c754b8 SRR4237657.sra SRR4237657.sra file validated SRR4237657 is paired end SRR4237657 is conventional basespace SRR4237657 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237657_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15125 34.0 33.0 34.0 32.0 34.0 2 33.26075 34.0 33.0 34.0 33.0 34.0 3 33.3065 34.0 33.0 34.0 33.0 34.0 4 33.26975 34.0 33.0 34.0 33.0 34.0 5 33.325 34.0 33.0 34.0 33.0 34.0 6 36.2225 38.0 37.0 38.0 34.0 38.0 7 37.026 38.0 38.0 38.0 36.0 38.0 8 37.1815 38.0 38.0 38.0 36.0 38.0 9 37.417 38.0 38.0 38.0 37.0 38.0 10-14 37.39245 38.0 38.0 38.0 37.2 38.0 15-19 37.35985 38.0 38.0 38.0 37.0 38.0 20-24 37.380250000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.28914999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.31755 38.0 38.0 38.0 37.0 38.0 35-39 37.27145 38.0 38.0 38.0 37.0 38.0 40-44 37.2127 38.0 38.0 38.0 36.8 38.0 45-49 37.1754 38.0 38.0 38.0 37.0 38.0 50-54 36.327099999999994 38.0 37.2 38.0 31.0 38.0 55-59 37.042950000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.9131 38.0 38.0 38.0 35.6 38.0 65-69 36.733799999999995 38.0 38.0 38.0 35.2 38.0 70-74 36.826449999999994 38.0 38.0 38.0 35.6 38.0 75-79 36.92100000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.766650000000006 38.0 38.0 38.0 35.2 38.0 85-89 36.73465 38.0 38.0 38.0 35.4 38.0 90-94 36.74895000000001 38.0 38.0 38.0 35.2 38.0 95-99 36.619749999999996 38.0 38.0 38.0 35.0 38.0 100-104 36.571749999999994 38.0 38.0 38.0 34.8 38.0 105-109 35.84185 38.0 37.2 38.0 31.2 38.0 110-114 36.22545000000001 38.0 37.6 38.0 33.8 38.0 115-119 36.247400000000006 38.0 38.0 38.0 33.8 38.0 120-124 36.21355 38.0 38.0 38.0 33.8 38.0 125-129 36.13875 38.0 38.0 38.0 33.8 38.0 130-134 35.931650000000005 38.0 37.6 38.0 32.8 38.0 135-139 35.81515 38.0 37.6 38.0 32.8 38.0 140-144 35.701699999999995 38.0 37.2 38.0 32.6 38.0 145-149 35.2459 38.0 36.0 38.0 31.8 38.0 150 30.91525 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 1.0 10 1.0 11 1.0 12 2.0 13 0.0 14 1.0 15 0.0 16 4.0 17 1.0 18 6.0 19 3.0 20 3.0 21 5.0 22 3.0 23 9.0 24 11.0 25 10.0 26 20.0 27 21.0 28 27.0 29 35.0 30 40.0 31 47.0 32 73.0 33 67.0 34 113.0 35 196.0 36 446.0 37 2852.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.54946155772602 11.445028800400701 8.81542699724518 37.1900826446281 2 23.25 14.124999999999998 35.675000000000004 26.950000000000003 3 20.75 18.975 26.275 34.0 4 23.3 28.225 22.675 25.8 5 22.475 34.125 23.549999999999997 19.85 6 18.46858305774612 37.08979903332485 23.403714067667263 21.037903841261766 7 14.725 26.75 41.125 17.4 8 17.025000000000002 25.05 32.35 25.575 9 17.275 24.25 33.7 24.775 10-14 19.145 30.075000000000003 27.785 22.994999999999997 15-19 19.465 29.244999999999997 27.985 23.305 20-24 19.32 29.459999999999997 27.529999999999998 23.69 25-29 19.725 29.044999999999998 27.62 23.61 30-34 19.375 29.799999999999997 27.275 23.549999999999997 35-39 19.35 30.075000000000003 27.29 23.285 40-44 19.73 29.5 27.534999999999997 23.235 45-49 19.985 29.29 27.084999999999997 23.64 50-54 19.689999999999998 29.825000000000003 27.57 22.915 55-59 19.465 29.244999999999997 27.279999999999998 24.01 60-64 19.875 29.160000000000004 27.47 23.494999999999997 65-69 19.835 29.335 27.18 23.65 70-74 20.025000000000002 28.794999999999998 27.355 23.825 75-79 19.72 29.2 27.485 23.595 80-84 19.685 28.645 27.85 23.82 85-89 20.025000000000002 28.405 27.765 23.805 90-94 20.375 28.32 28.07 23.235 95-99 19.875 29.349999999999998 27.650000000000002 23.125 100-104 20.205000000000002 28.970000000000002 27.08 23.745 105-109 20.085 28.965000000000003 27.205000000000002 23.745 110-114 20.43 28.405 27.61 23.555 115-119 20.085 28.360000000000003 27.875 23.68 120-124 20.51 29.09 27.145000000000003 23.255 125-129 20.22 28.275 27.565 23.94 130-134 20.29 28.37 27.965 23.375 135-139 20.66 28.825 26.784999999999997 23.73 140-144 20.57 27.71 27.72 24.0 145-149 20.395 29.220000000000002 27.095000000000002 23.29 150 19.1 28.225 28.15 24.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 0.5 23 1.0 24 1.0 25 4.5 26 8.0 27 7.5 28 11.5 29 19.0 30 24.0 31 30.5 32 40.0 33 56.0 34 68.5 35 79.0 36 101.0 37 116.5 38 125.5 39 165.5 40 211.5 41 222.5 42 246.0 43 276.0 44 269.0 45 243.5 46 241.5 47 256.5 48 225.5 49 186.5 50 163.5 51 134.0 52 115.0 53 86.0 54 68.0 55 59.5 56 37.5 57 25.5 58 20.5 59 12.5 60 7.0 61 8.0 62 6.5 63 3.0 64 3.0 65 2.5 66 2.0 67 2.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 1.725 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5875 0.0 0.0 0.0 0.0 110-111 0.7875000000000001 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.225 0.0 0.0 0.0 0.0 120-121 1.4 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 2.0375 0.0 0.0 0.0 0.0 126-127 2.3 0.0 0.0 0.0 0.0 128-129 2.5999999999999996 0.0 0.0 0.0 0.0 130-131 2.775 0.0 0.0 0.0 0.0 132-133 3.0250000000000004 0.0 0.0 0.0 0.0 134-135 3.2874999999999996 0.0 0.0 0.0 0.0 136-137 3.6500000000000004 0.0 0.0 0.0 0.0 138 3.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCACG 10 0.0069845165 143.925 9 >>END_MODULE SRR4237657 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237657_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.512 33.0 33.0 34.0 32.0 34.0 2 32.56775 33.0 33.0 34.0 32.0 34.0 3 31.89225 33.0 33.0 34.0 28.0 34.0 4 32.36375 33.0 33.0 34.0 31.0 34.0 5 32.58475 34.0 33.0 34.0 32.0 34.0 6 36.57475 38.0 38.0 38.0 35.0 38.0 7 36.51475 38.0 38.0 38.0 34.0 38.0 8 36.79575 38.0 38.0 38.0 36.0 38.0 9 36.591 38.0 38.0 38.0 35.0 38.0 10-14 36.6395 38.0 38.0 38.0 35.4 38.0 15-19 36.73195 38.0 38.0 38.0 35.8 38.0 20-24 36.29245 38.0 37.8 38.0 33.2 38.0 25-29 36.2607 38.0 37.8 38.0 33.6 38.0 30-34 36.7196 38.0 38.0 38.0 35.8 38.0 35-39 36.70485 38.0 38.0 38.0 36.0 38.0 40-44 36.6571 38.0 38.0 38.0 35.8 38.0 45-49 36.370549999999994 38.0 38.0 38.0 34.4 38.0 50-54 35.5606 38.0 36.2 38.0 30.0 38.0 55-59 36.3198 38.0 37.8 38.0 34.2 38.0 60-64 36.41329999999999 38.0 38.0 38.0 34.6 38.0 65-69 36.122 38.0 37.8 38.0 32.8 38.0 70-74 35.948800000000006 38.0 37.2 38.0 31.2 38.0 75-79 36.160000000000004 38.0 37.8 38.0 32.8 38.0 80-84 36.456 38.0 38.0 38.0 35.0 38.0 85-89 36.3389 38.0 38.0 38.0 34.4 38.0 90-94 36.28 38.0 38.0 38.0 34.2 38.0 95-99 36.1996 38.0 38.0 38.0 34.0 38.0 100-104 36.13315 38.0 38.0 38.0 34.0 38.0 105-109 36.02025 38.0 38.0 38.0 33.8 38.0 110-114 35.897349999999996 38.0 38.0 38.0 33.6 38.0 115-119 34.58455 38.0 35.0 38.0 26.2 38.0 120-124 34.79365 38.0 36.0 38.0 27.2 38.0 125-129 35.4984 38.0 37.8 38.0 31.4 38.0 130-134 35.3118 38.0 37.8 38.0 30.6 38.0 135-139 34.7468 38.0 36.0 38.0 27.4 38.0 140-144 34.8441 38.0 36.0 38.0 29.0 38.0 145-149 34.35935 38.0 36.0 38.0 27.4 38.0 150 29.14075 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 7.0 4 2.0 5 3.0 6 1.0 7 4.0 8 2.0 9 2.0 10 2.0 11 2.0 12 4.0 13 6.0 14 4.0 15 6.0 16 3.0 17 7.0 18 7.0 19 3.0 20 10.0 21 18.0 22 12.0 23 10.0 24 17.0 25 18.0 26 24.0 27 28.0 28 32.0 29 29.0 30 47.0 31 49.0 32 76.0 33 72.0 34 132.0 35 233.0 36 488.0 37 2626.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.5 21.15 13.100000000000001 25.25 2 27.800000000000004 25.650000000000002 31.35 15.2 3 21.325 27.900000000000002 31.25 19.525000000000002 4 24.8 34.275 23.625 17.299999999999997 5 27.275 36.5 21.0 15.225 6 18.875 39.675 23.724999999999998 17.724999999999998 7 19.85 20.275000000000002 40.949999999999996 18.925 8 21.95 25.224999999999998 28.325 24.5 9 20.9 24.375 30.125 24.6 10-14 23.474999999999998 28.910000000000004 26.665 20.95 15-19 23.56 28.144999999999996 27.815 20.48 20-24 23.24 28.425 28.095 20.24 25-29 23.365 28.645 27.560000000000002 20.43 30-34 22.7 28.49 28.275 20.535 35-39 23.305 27.994999999999997 28.189999999999998 20.51 40-44 22.855 27.944999999999997 28.54 20.66 45-49 23.11 28.044999999999998 28.33 20.515 50-54 23.205000000000002 28.17 28.08 20.544999999999998 55-59 23.849999999999998 28.084999999999997 27.705000000000002 20.36 60-64 23.635 27.705000000000002 28.34 20.32 65-69 23.745 28.09 28.255000000000003 19.91 70-74 23.810000000000002 27.860000000000003 28.18 20.150000000000002 75-79 23.630000000000003 27.779999999999998 28.645 19.945 80-84 24.099999999999998 27.224999999999998 28.265 20.41 85-89 23.54 28.000000000000004 28.29 20.169999999999998 90-94 23.44 27.805000000000003 28.34 20.415 95-99 23.715 27.810000000000002 27.85 20.625 100-104 24.104999999999997 27.689999999999998 28.299999999999997 19.905 105-109 23.59 27.925 28.13 20.355 110-114 23.575 27.800000000000004 28.335 20.29 115-119 24.45 27.455000000000002 28.22 19.875 120-124 23.630000000000003 28.225 28.310000000000002 19.835 125-129 23.77 28.01 28.275 19.945 130-134 24.335 27.894999999999996 27.800000000000004 19.97 135-139 24.104999999999997 27.71 27.965 20.22 140-144 24.224999999999998 27.465 28.27 20.04 145-149 24.884999999999998 27.845 27.765 19.505 150 25.25 27.575 27.250000000000004 19.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.5 23 1.5 24 1.0 25 2.5 26 3.0 27 4.0 28 6.0 29 9.5 30 16.0 31 19.0 32 31.5 33 39.5 34 47.5 35 60.0 36 73.5 37 105.5 38 146.0 39 191.0 40 208.5 41 226.0 42 266.5 43 265.5 44 272.5 45 279.5 46 273.5 47 265.0 48 228.5 49 207.0 50 181.5 51 136.0 52 106.0 53 95.5 54 70.0 55 47.5 56 35.5 57 22.5 58 17.0 59 11.5 60 5.0 61 2.5 62 2.0 63 2.5 64 1.5 65 1.0 66 1.0 67 1.5 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.8999999999999999 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.325 0.0 0.0 0.0 0.0 122-123 1.6125 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.2 0.0 0.0 0.0 0.0 128-129 2.5 0.0 0.0 0.0 0.0 130-131 2.675 0.0 0.0 0.0 0.0 132-133 2.925 0.0 0.0 0.0 0.0 134-135 3.175 0.0 0.0 0.0 0.0 136-137 3.5250000000000004 0.0 0.0 0.0 0.0 138 3.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGTTA 10 0.006973645 144.0 5 >>END_MODULE Read 2573415 spots for SRR4237657.sra Written 2573415 spots for SRR4237657.sra Read 2573415 spots for SRR4237657.sra Written 2573415 spots for SRR4237657.sra Read 2573415 spots for SRR4237657.sra Written 2573415 spots for SRR4237657.sra Read 2573415 spots for SRR4237657.sra Written 2573415 spots for SRR4237657.sra Read 2573415 spots for SRR4237657.sra Written 2573415 spots for SRR4237657.sra Read 2573415 spots for SRR4237657.sra Written 2573415 spots for SRR4237657.sra Read 2573422 spots for SRR4237657.sra Written 2573422 spots for SRR4237657.sra Read 2573415 spots for SRR4237657.sra Written 2573415 spots for SRR4237657.sra Read 2573415 spots for SRR4237657.sra Written 2573415 spots for SRR4237657.sra Read 2573415 spots for SRR4237657.sra Written 2573415 spots for SRR4237657.sra Read 2573415 spots for SRR4237657.sra Written 2573415 spots for SRR4237657.sra Read 2573415 spots for SRR4237657.sra Written 2573415 spots for SRR4237657.sra Read 2573415 spots for SRR4237657.sra Written 2573415 spots for SRR4237657.sra Read 2573415 spots for SRR4237657.sra Written 2573415 spots for SRR4237657.sra Read 2573415 spots for SRR4237657.sra Written 2573415 spots for SRR4237657.sra Read 2573415 spots for SRR4237657.sra Written 2573415 spots for SRR4237657.sra Read 2573415 spots for SRR4237657.sra Written 2573415 spots for SRR4237657.sra Read 2573415 spots for SRR4237657.sra Written 2573415 spots for SRR4237657.sra Read 2573415 spots for SRR4237657.sra Written 2573415 spots for SRR4237657.sra Read 2573415 spots for SRR4237657.sra Written 2573415 spots for SRR4237657.sra SRR ids: ['SRR4237657.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xddxwxd9 SRR4237657.sra spots: 51468307 blocks: [[1, 2573415], [2573416, 5146830], [5146831, 7720245], [7720246, 10293660], [10293661, 12867075], [12867076, 15440490], [15440491, 18013905], [18013906, 20587320], [20587321, 23160735], [23160736, 25734150], [25734151, 28307565], [28307566, 30880980], [30880981, 33454395], [33454396, 36027810], [36027811, 38601225], [38601226, 41174640], [41174641, 43748055], [43748056, 46321470], [46321471, 48894885], [48894886, 51468307]] SRR4237657 file size 17318696 SRR4237657 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237657 SRR4237657_1.fastq SRR4237657_2.fastq Input file: SRR4237657_1.fastq Paired file: SRR4237657_2.fastq trimmed: SRR4237657-trimmed-pair1.fastq, SRR4237657-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:43:06 2025 >> started Wed Feb 12 21:44:02 2025 >> done (55.935s) 51468307 read pairs processed; of these: 72437 ( 0.14%) short read pairs filtered out after trimming by size control 49745 ( 0.10%) empty read pairs filtered out after trimming by size control 51346125 (99.76%) read pairs available; of these: 16001022 (31.16%) trimmed read pairs available after processing 35345103 (68.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 10 0.00% 20 3 0.00% 21 10 0.00% 22 9 0.00% 23 14 0.00% 24 10 0.00% 25 9 0.00% 26 7 0.00% 27 16 0.00% 28 16 0.00% 29 8 0.00% 30 22 0.00% 31 17 0.00% 32 13 0.00% 33 20 0.00% 34 19 0.00% 35 31 0.00% 36 17 0.00% 37 33 0.00% 38 29 0.00% 39 36 0.00% 40 47 0.00% 41 42 0.00% 42 55 0.00% 43 73 0.00% 44 55 0.00% 45 73 0.00% 46 78 0.00% 47 82 0.00% 48 96 0.00% 49 127 0.00% 50 112 0.00% 51 127 0.00% 52 168 0.00% 53 186 0.00% 54 216 0.00% 55 206 0.00% 56 239 0.00% 57 260 0.00% 58 310 0.00% 59 341 0.00% 60 367 0.00% 61 452 0.00% 62 418 0.00% 63 475 0.00% 64 585 0.00% 65 712 0.00% 66 837 0.00% 67 1425 0.00% 68 1930 0.00% 69 3346 0.01% 70 2467 0.00% 71 1381 0.00% 72 1452 0.00% 73 1579 0.00% 74 1829 0.00% 75 2053 0.00% 76 2238 0.00% 77 2402 0.00% 78 2730 0.01% 79 3049 0.01% 80 3462 0.01% 81 3900 0.01% 82 4586 0.01% 83 6532 0.01% 84 28096 0.05% 85 11113 0.02% 86 10388 0.02% 87 11546 0.02% 88 11999 0.02% 89 13506 0.03% 90 14272 0.03% 91 17829 0.03% 92 18141 0.04% 93 16436 0.03% 94 19296 0.04% 95 19502 0.04% 96 21179 0.04% 97 22260 0.04% 98 22545 0.04% 99 23547 0.05% 100 24659 0.05% 101 26341 0.05% 102 27931 0.05% 103 29927 0.06% 104 31634 0.06% 105 34018 0.07% 106 36439 0.07% 107 38341 0.07% 108 40870 0.08% 109 43142 0.08% 110 44289 0.09% 111 46213 0.09% 112 49021 0.10% 113 51745 0.10% 114 54622 0.11% 115 58590 0.11% 116 61356 0.12% 117 63885 0.12% 118 66703 0.13% 119 70098 0.14% 120 71812 0.14% 121 74005 0.14% 122 78470 0.15% 123 82878 0.16% 124 85299 0.17% 125 91105 0.18% 126 94775 0.18% 127 99251 0.19% 128 103156 0.20% 129 108944 0.21% 130 113871 0.22% 131 119695 0.23% 132 124816 0.24% 133 130291 0.25% 134 136824 0.27% 135 145025 0.28% 136 154747 0.30% 137 164571 0.32% 138 176062 0.34% 139 188954 0.37% 140 204170 0.40% 141 221726 0.43% 142 246209 0.48% 143 277528 0.54% 144 322617 0.63% 145 390840 0.76% 146 498444 0.97% 147 716088 1.39% 148 1298444 2.53% 149 8245467 16.06% 150 35345103 68.84% 51346125 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=35 prefix-density=0.18 prefix-fanout=2.4 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=33 fanout-score=186.36 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=14.4 sequence=CAGCAGCAAGAAAACAAGTCAAATTATTCATCAAGGACCAATAAAACAGGCATCGAACTAAAGGGATATTATAAATCACTCAAGCTTGGGGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=31 prefix-density=0.21 prefix-fanout=2.7 sequence=GTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGGCGAGGGTATGGAGGAAGGAGAGTTCTCAGAGGCTCGTGAGGATCTTGCTGCCCTGGAGAAGGATTATGAGGAGGTTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=230.33 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=25.7 sequence=GAAGAAGAAGAAA SRR4237657 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:44:46 Started mapping on | Feb 12 21:44:46 Finished on | Feb 12 21:48:48 Mapping speed, Million of reads per hour | 763.83 Number of input reads | 51346125 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 49478206 Uniquely mapped reads % | 96.36% Average mapped length | 294.49 Number of splices: Total | 43911055 Number of splices: Annotated (sjdb) | 43150156 Number of splices: GT/AG | 43246059 Number of splices: GC/AG | 515714 Number of splices: AT/AC | 43543 Number of splices: Non-canonical | 105739 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1059228 % of reads mapped to multiple loci | 2.06% Number of reads mapped to too many loci | 62401 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.42% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 869053 869053 869053 N_multimapping 1059228 1059228 1059228 N_noFeature 1330961 48856729 1658308 N_ambiguous 504132 3250 207745 UnstrandedReadsAssigned:47643113 PositiveStrandReadsAssigned:618227 NegativeStrandReadsAssigned:47612153 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237657 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237657-trimmed-pair1.fastq SRR4237657-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 51,346,125 reads, 47,293,680 reads pseudoaligned [quant] estimated average fragment length: 246.257 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,262 rounds 52401 SRR4237657.ke.tsv 34699 SRR4237657.se.tsv 87100 total ==> SRR4237657.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.74 1146 13.6253 Potri.005G024800.1.v4.1 1035 789.743 159 4.24345 Potri.004G059700.1.v4.1 961 715.791 50 1.47228 Potri.007G009000.2.v4.1 1416 1170.74 0 0 Potri.003G141000.2.v4.1 2943 2697.74 671.098 5.24316 Potri.016G087400.1.v4.1 270 75.2347 7229.18 2025.25 Potri.015G069301.1.v4.1 564 323.416 0 0 Potri.010G195200.1.v4.1 1773 1527.74 191 2.63506 Potri.012G127500.1.v4.1 977 731.778 15003 432.122 ==> SRR4237657.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8741 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 913 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 86 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR4237657 completed mapping pipeline successfully