Starting /dee2/code/volunteer_pipeline.sh SRR4237658 current disk space = 3050619154432 free memory = 1578355436 SRR4237658 SRAfilesize 08e63653fe943a74b2b1ed63411d5770 SRR4237658.sra SRR4237658.sra file validated SRR4237658 is paired end SRR4237658 is conventional basespace SRR4237658 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237658_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.81575 33.0 32.0 34.0 2.0 34.0 2 32.14225 34.0 32.0 34.0 27.0 34.0 3 32.346 34.0 32.0 34.0 27.0 34.0 4 32.86775 34.0 33.0 34.0 32.0 34.0 5 32.61775 33.0 33.0 34.0 32.0 34.0 6 36.64575 38.0 37.0 38.0 34.0 38.0 7 37.0235 38.0 38.0 38.0 36.0 38.0 8 37.14425 38.0 38.0 38.0 36.0 38.0 9 37.17925 38.0 38.0 38.0 37.0 38.0 10-14 37.27225 38.0 38.0 38.0 37.0 38.0 15-19 37.28425 38.0 38.0 38.0 36.8 38.0 20-24 37.27935 38.0 38.0 38.0 36.8 38.0 25-29 37.06505 38.0 38.0 38.0 36.2 38.0 30-34 37.18599999999999 38.0 38.0 38.0 36.8 38.0 35-39 36.201049999999995 38.0 37.0 38.0 30.8 38.0 40-44 37.09505 38.0 38.0 38.0 36.2 38.0 45-49 36.7508 38.0 37.8 38.0 34.8 38.0 50-54 37.0193 38.0 38.0 38.0 36.0 38.0 55-59 35.991550000000004 38.0 36.6 38.0 30.0 38.0 60-64 36.8606 38.0 38.0 38.0 35.2 38.0 65-69 36.8952 38.0 38.0 38.0 35.2 38.0 70-74 36.85825 38.0 38.0 38.0 35.8 38.0 75-79 36.89789999999999 38.0 38.0 38.0 35.6 38.0 80-84 36.84445 38.0 38.0 38.0 35.8 38.0 85-89 36.703700000000005 38.0 38.0 38.0 34.6 38.0 90-94 36.67954999999999 38.0 38.0 38.0 34.6 38.0 95-99 35.634949999999996 38.0 36.6 38.0 29.2 38.0 100-104 35.47035000000001 38.0 36.4 38.0 28.0 38.0 105-109 36.15845 38.0 37.4 38.0 33.2 38.0 110-114 36.172349999999994 38.0 37.8 38.0 33.8 38.0 115-119 36.21835 38.0 37.8 38.0 33.8 38.0 120-124 36.04225 38.0 37.8 38.0 33.6 38.0 125-129 35.744600000000005 38.0 37.0 38.0 31.6 38.0 130-134 35.739700000000006 38.0 37.0 38.0 32.4 38.0 135-139 35.52419999999999 38.0 36.0 38.0 31.4 38.0 140-144 35.10025 38.0 36.0 38.0 29.2 38.0 145-149 34.276599999999995 38.0 35.2 38.0 26.2 38.0 150 28.7785 33.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 2.0 15 3.0 16 1.0 17 4.0 18 2.0 19 5.0 20 2.0 21 2.0 22 6.0 23 8.0 24 7.0 25 14.0 26 27.0 27 19.0 28 25.0 29 47.0 30 62.0 31 69.0 32 76.0 33 117.0 34 180.0 35 259.0 36 630.0 37 2432.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.206482593037215 11.524609843937576 8.61344537815126 38.655462184873954 2 23.275000000000002 15.299999999999999 34.725 26.700000000000003 3 19.55 21.5 24.85 34.1 4 23.625 30.55 22.25 23.575 5 22.025 34.25 23.525 20.200000000000003 6 18.075 36.199999999999996 24.05 21.675 7 14.149999999999999 26.974999999999998 41.05 17.825 8 17.349999999999998 25.924999999999997 31.55 25.174999999999997 9 17.825 24.175 33.050000000000004 24.95 10-14 20.125 30.48 26.290000000000003 23.105 15-19 19.665 29.42 26.955000000000002 23.96 20-24 19.509999999999998 29.345 27.455000000000002 23.69 25-29 19.220000000000002 29.270000000000003 27.534999999999997 23.974999999999998 30-34 19.61 29.299999999999997 27.139999999999997 23.95 35-39 19.515 29.525000000000002 26.950000000000003 24.01 40-44 20.095 29.12 27.375 23.41 45-49 20.145 29.099999999999998 27.465 23.29 50-54 19.84 29.14 27.055 23.965 55-59 19.900000000000002 29.645 26.75 23.705000000000002 60-64 20.21 28.71 27.339999999999996 23.74 65-69 20.424999999999997 29.060000000000002 26.935 23.580000000000002 70-74 20.235 29.54 26.640000000000004 23.585 75-79 20.135 28.89 26.82 24.154999999999998 80-84 20.31 28.384999999999998 27.51 23.794999999999998 85-89 19.875 29.154999999999998 27.384999999999998 23.585 90-94 20.880000000000003 28.615000000000002 27.015 23.49 95-99 20.02 29.015 27.1 23.865 100-104 20.705000000000002 28.4 27.48 23.415 105-109 20.085 28.485 27.3 24.13 110-114 20.72 28.65 26.97 23.66 115-119 21.044999999999998 28.27 26.895000000000003 23.79 120-124 21.13 28.825 26.735 23.31 125-129 20.74 28.71 26.775 23.775 130-134 21.245 28.43 26.595000000000002 23.73 135-139 20.875 28.83 26.279999999999998 24.015 140-144 21.105 28.110000000000003 25.81 24.975 145-149 21.66 28.93 25.130000000000003 24.279999999999998 150 22.15 28.7 25.025 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.5 23 3.0 24 3.5 25 3.0 26 3.0 27 6.0 28 9.0 29 14.5 30 17.5 31 24.0 32 36.0 33 46.0 34 63.5 35 80.0 36 88.0 37 103.0 38 134.0 39 169.0 40 198.0 41 234.0 42 251.5 43 269.0 44 274.5 45 257.0 46 246.0 47 230.0 48 236.5 49 209.0 50 160.0 51 136.5 52 115.0 53 93.5 54 76.5 55 58.5 56 35.5 57 28.0 58 22.0 59 13.0 60 8.5 61 6.5 62 5.0 63 3.5 64 5.5 65 7.0 66 5.0 67 2.5 68 2.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 16.7 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.1124999999999998 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.575 0.0 0.0 0.0 0.0 104-105 2.05 0.0 0.0 0.0 0.0 106-107 2.3875 0.0 0.0 0.0 0.0 108-109 2.8125 0.0 0.0 0.0 0.0 110-111 3.3375000000000004 0.0 0.0 0.0 0.0 112-113 3.85 0.0 0.0 0.0 0.0 114-115 4.325 0.0 0.0 0.0 0.0 116-117 5.025 0.0 0.0 0.0 0.0 118-119 5.6625 0.0 0.0 0.0 0.0 120-121 6.262499999999999 0.0 0.0 0.0 0.0 122-123 6.9125 0.0 0.0 0.0 0.0 124-125 7.6625 0.0 0.0 0.0 0.0 126-127 8.625 0.0 0.0 0.0 0.0 128-129 9.4375 0.0 0.0 0.0 0.0 130-131 10.25 0.0 0.0 0.0 0.0 132-133 11.125 0.0 0.0 0.0 0.0 134-135 12.0875 0.0 0.0 0.0 0.0 136-137 13.15 0.0 0.0 0.0 0.0 138 13.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCACAT 10 0.006997227 143.8375 8 >>END_MODULE SRR4237658 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237658_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4725 33.0 33.0 34.0 31.0 34.0 2 32.538 33.0 33.0 34.0 31.0 34.0 3 32.5675 33.0 33.0 34.0 31.0 34.0 4 32.399 33.0 33.0 34.0 31.0 34.0 5 32.41725 33.0 33.0 34.0 31.0 34.0 6 36.5685 38.0 38.0 38.0 34.0 38.0 7 36.62925 38.0 38.0 38.0 34.0 38.0 8 36.43675 38.0 38.0 38.0 34.0 38.0 9 36.4855 38.0 38.0 38.0 34.0 38.0 10-14 36.45355000000001 38.0 38.0 38.0 34.2 38.0 15-19 36.562400000000004 38.0 38.0 38.0 34.4 38.0 20-24 36.5668 38.0 38.0 38.0 34.6 38.0 25-29 36.46725000000001 38.0 38.0 38.0 34.0 38.0 30-34 36.373000000000005 38.0 38.0 38.0 33.8 38.0 35-39 36.464999999999996 38.0 38.0 38.0 34.0 38.0 40-44 36.42530000000001 38.0 38.0 38.0 34.0 38.0 45-49 36.021100000000004 38.0 37.6 38.0 32.0 38.0 50-54 36.400400000000005 38.0 38.0 38.0 34.0 38.0 55-59 36.238099999999996 38.0 38.0 38.0 33.4 38.0 60-64 35.877 38.0 37.4 38.0 31.6 38.0 65-69 35.888999999999996 38.0 37.4 38.0 32.2 38.0 70-74 35.575450000000004 38.0 37.0 38.0 28.4 38.0 75-79 36.008500000000005 38.0 37.6 38.0 32.8 38.0 80-84 35.78775 38.0 37.4 38.0 31.4 38.0 85-89 35.95265 38.0 37.8 38.0 32.6 38.0 90-94 35.8377 38.0 37.6 38.0 33.0 38.0 95-99 35.8032 38.0 37.6 38.0 31.8 38.0 100-104 35.54415 38.0 37.0 38.0 30.2 38.0 105-109 35.4735 38.0 37.0 38.0 29.8 38.0 110-114 35.3729 38.0 37.0 38.0 29.6 38.0 115-119 35.057500000000005 38.0 36.6 38.0 27.8 38.0 120-124 34.868700000000004 38.0 36.0 38.0 27.2 38.0 125-129 34.3589 38.0 35.2 38.0 24.0 38.0 130-134 33.844950000000004 38.0 33.6 38.0 22.0 38.0 135-139 33.298500000000004 38.0 33.0 38.0 18.6 38.0 140-144 32.6508 38.0 33.0 38.0 14.6 38.0 145-149 31.027700000000003 38.0 32.6 38.0 3.8 38.0 150 23.126 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 7.0 4 0.0 5 5.0 6 3.0 7 2.0 8 0.0 9 3.0 10 1.0 11 3.0 12 2.0 13 2.0 14 3.0 15 7.0 16 3.0 17 3.0 18 4.0 19 11.0 20 5.0 21 9.0 22 14.0 23 24.0 24 23.0 25 36.0 26 26.0 27 50.0 28 54.0 29 64.0 30 68.0 31 92.0 32 118.0 33 149.0 34 199.0 35 283.0 36 588.0 37 2130.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.550000000000004 20.65 12.55 26.25 2 27.625 26.075 31.65 14.649999999999999 3 21.875 28.95 31.0 18.175 4 26.900000000000002 33.375 22.55 17.175 5 25.5 36.775000000000006 22.35 15.375 6 19.825 39.050000000000004 23.775 17.349999999999998 7 19.7 20.125 40.9 19.275000000000002 8 22.625 23.799999999999997 28.849999999999998 24.725 9 22.05 24.425 30.099999999999998 23.425 10-14 24.04 28.52 26.405 21.035 15-19 23.105 27.735 28.77 20.39 20-24 23.685000000000002 27.215 28.884999999999998 20.215 25-29 23.48 27.99 28.095 20.435 30-34 23.62 27.785 28.365000000000002 20.23 35-39 23.28 28.185 27.794999999999998 20.74 40-44 23.265 27.755000000000003 28.535 20.445 45-49 23.485 28.22 28.335 19.96 50-54 24.104999999999997 27.650000000000002 28.144999999999996 20.1 55-59 23.84 27.584999999999997 28.249999999999996 20.325 60-64 23.544999999999998 28.185 28.505000000000003 19.765 65-69 23.685000000000002 27.87 27.925 20.52 70-74 23.84 27.644999999999996 28.27 20.244999999999997 75-79 23.84 27.93 28.345 19.885 80-84 23.905 27.529999999999998 28.63 19.935 85-89 23.549999999999997 27.985 28.42 20.044999999999998 90-94 23.435 27.075 28.804999999999996 20.685000000000002 95-99 23.745 27.675 28.244999999999997 20.335 100-104 24.215 28.065 28.1 19.62 105-109 24.67 27.500000000000004 27.68 20.150000000000002 110-114 23.955000000000002 27.525 28.515 20.005 115-119 24.610000000000003 27.694999999999997 27.939999999999998 19.755 120-124 25.15 27.150000000000002 27.38 20.32 125-129 24.79 27.500000000000004 28.175 19.535 130-134 25.535000000000004 27.765 27.500000000000004 19.2 135-139 25.790000000000003 27.935 26.669999999999998 19.605 140-144 26.590000000000003 27.62 26.76 19.03 145-149 26.974999999999998 28.16 26.3 18.565 150 27.800000000000004 27.575 26.75 17.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 1.0 11 1.5 12 0.5 13 0.5 14 0.5 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 0.0 24 2.0 25 2.5 26 3.5 27 5.5 28 8.5 29 9.5 30 10.5 31 18.5 32 28.5 33 38.5 34 52.5 35 64.0 36 83.0 37 103.5 38 123.5 39 165.5 40 208.5 41 239.0 42 259.0 43 294.0 44 287.0 45 256.5 46 255.5 47 260.0 48 249.5 49 200.5 50 163.0 51 138.0 52 116.0 53 95.5 54 70.5 55 48.5 56 32.5 57 32.0 58 23.0 59 9.0 60 7.5 61 6.0 62 6.0 63 6.0 64 3.5 65 1.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.1124999999999998 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.575 0.0 0.0 0.0 0.0 104-105 2.075 0.0 0.0 0.0 0.0 106-107 2.3875 0.0 0.0 0.0 0.0 108-109 2.7625 0.0 0.0 0.0 0.0 110-111 3.2875 0.0 0.0 0.0 0.0 112-113 3.7375 0.0 0.0 0.0 0.0 114-115 4.2 0.0 0.0 0.0 0.0 116-117 4.85 0.0 0.0 0.0 0.0 118-119 5.5 0.0 0.0 0.0 0.0 120-121 6.0625 0.0 0.0 0.0 0.0 122-123 6.75 0.0 0.0 0.0 0.0 124-125 7.487500000000001 0.0 0.0 0.0 0.0 126-127 8.4625 0.0 0.0 0.0 0.0 128-129 9.25 0.0 0.0 0.0 0.0 130-131 10.05 0.0 0.0 0.0 0.0 132-133 10.875 0.0 0.0 0.0 0.0 134-135 11.825 0.0 0.0 0.0 0.0 136-137 12.8125 0.0 0.0 0.0 0.0 138 13.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTATACC 10 0.006973645 144.0 2 GAGCTTC 20 0.006139246 28.8 65-69 >>END_MODULE Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra Read 3052389 spots for SRR4237658.sra Written 3052389 spots for SRR4237658.sra SRR ids: ['SRR4237658.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dxic0i2l SRR4237658.sra spots: 61047780 blocks: [[1, 3052389], [3052390, 6104778], [6104779, 9157167], [9157168, 12209556], [12209557, 15261945], [15261946, 18314334], [18314335, 21366723], [21366724, 24419112], [24419113, 27471501], [27471502, 30523890], [30523891, 33576279], [33576280, 36628668], [36628669, 39681057], [39681058, 42733446], [42733447, 45785835], [45785836, 48838224], [48838225, 51890613], [51890614, 54943002], [54943003, 57995391], [57995392, 61047780]] SRR4237658 file size 20546155 SRR4237658 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237658 SRR4237658_1.fastq SRR4237658_2.fastq Input file: SRR4237658_1.fastq Paired file: SRR4237658_2.fastq trimmed: SRR4237658-trimmed-pair1.fastq, SRR4237658-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:57:39 2025 >> started Wed Feb 12 21:58:53 2025 >> done (73.749s) 61047780 read pairs processed; of these: 80775 ( 0.13%) short read pairs filtered out after trimming by size control 64829 ( 0.11%) empty read pairs filtered out after trimming by size control 60902176 (99.76%) read pairs available; of these: 27013976 (44.36%) trimmed read pairs available after processing 33888200 (55.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 5 0.00% 20 8 0.00% 21 5 0.00% 22 9 0.00% 23 10 0.00% 24 8 0.00% 25 15 0.00% 26 15 0.00% 27 20 0.00% 28 13 0.00% 29 22 0.00% 30 19 0.00% 31 34 0.00% 32 38 0.00% 33 27 0.00% 34 29 0.00% 35 38 0.00% 36 38 0.00% 37 60 0.00% 38 66 0.00% 39 73 0.00% 40 88 0.00% 41 106 0.00% 42 121 0.00% 43 112 0.00% 44 139 0.00% 45 159 0.00% 46 197 0.00% 47 238 0.00% 48 269 0.00% 49 296 0.00% 50 331 0.00% 51 368 0.00% 52 425 0.00% 53 456 0.00% 54 466 0.00% 55 637 0.00% 56 696 0.00% 57 767 0.00% 58 868 0.00% 59 993 0.00% 60 1180 0.00% 61 1352 0.00% 62 1532 0.00% 63 1744 0.00% 64 1978 0.00% 65 2248 0.00% 66 2502 0.00% 67 2954 0.00% 68 3941 0.01% 69 6381 0.01% 70 5408 0.01% 71 5003 0.01% 72 5543 0.01% 73 6430 0.01% 74 7235 0.01% 75 8293 0.01% 76 9262 0.02% 77 10150 0.02% 78 11419 0.02% 79 12955 0.02% 80 14517 0.02% 81 16713 0.03% 82 19239 0.03% 83 22238 0.04% 84 30188 0.05% 85 32289 0.05% 86 34774 0.06% 87 37979 0.06% 88 41461 0.07% 89 44519 0.07% 90 48656 0.08% 91 52985 0.09% 92 57158 0.09% 93 62977 0.10% 94 68647 0.11% 95 73953 0.12% 96 80124 0.13% 97 85043 0.14% 98 89790 0.15% 99 96677 0.16% 100 103412 0.17% 101 108420 0.18% 102 117892 0.19% 103 124014 0.20% 104 131387 0.22% 105 139455 0.23% 106 147437 0.24% 107 153323 0.25% 108 159477 0.26% 109 166095 0.27% 110 171231 0.28% 111 178843 0.29% 112 186913 0.31% 113 193937 0.32% 114 201595 0.33% 115 211082 0.35% 116 216019 0.35% 117 225333 0.37% 118 231433 0.38% 119 235223 0.39% 120 241207 0.40% 121 248927 0.41% 122 254264 0.42% 123 260251 0.43% 124 268605 0.44% 125 276215 0.45% 126 283028 0.46% 127 290708 0.48% 128 294885 0.48% 129 301423 0.49% 130 308419 0.51% 131 314047 0.52% 132 322362 0.53% 133 331631 0.54% 134 337413 0.55% 135 347999 0.57% 136 357755 0.59% 137 369861 0.61% 138 383852 0.63% 139 396813 0.65% 140 411935 0.68% 141 431802 0.71% 142 459214 0.75% 143 493639 0.81% 144 545124 0.90% 145 625530 1.03% 146 759534 1.25% 147 1010862 1.66% 148 1729965 2.84% 149 9828451 16.14% 150 33888200 55.64% 60902176 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=39 prefix-density=0.20 prefix-fanout=1.9 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=341.80 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=18.4 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=6.87 fanout-score-rank=18 prefix-density=0.25 prefix-fanout=4.5 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGGCGAGGGTATGGAGGAAGGAGAGTTCTCAGAGGCTCGTGAGGATCTTGCTGCCCTGGAGAAGGATTATGAGGAGGTTGGGGCTGAATCTCCCGATGGAGAGGATGGTGATGAAGGAGAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=11 fanout-score=261.84 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=29.3 sequence=AAGAAGAAGAAA SRR4237658 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:59:56 Started mapping on | Feb 12 21:59:56 Finished on | Feb 12 22:04:34 Mapping speed, Million of reads per hour | 788.66 Number of input reads | 60902176 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 58939003 Uniquely mapped reads % | 96.78% Average mapped length | 287.47 Number of splices: Total | 50874254 Number of splices: Annotated (sjdb) | 49970996 Number of splices: GT/AG | 50105694 Number of splices: GC/AG | 591323 Number of splices: AT/AC | 47136 Number of splices: Non-canonical | 130101 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1130514 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 120146 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.13% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 915085 915085 915085 N_multimapping 1130514 1130514 1130514 N_noFeature 1761340 58182982 2155572 N_ambiguous 604465 3703 239768 UnstrandedReadsAssigned:56573198 PositiveStrandReadsAssigned:752318 NegativeStrandReadsAssigned:56543663 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=145 echo kmer=141 SRR4237658 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237658-trimmed-pair1.fastq SRR4237658-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 60,902,176 reads, 56,392,248 reads pseudoaligned [quant] estimated average fragment length: 207.234 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,358 rounds 52401 SRR4237658.ke.tsv 34699 SRR4237658.se.tsv 87100 total ==> SRR4237658.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1811.77 1144 12.1208 Potri.005G024800.1.v4.1 1035 828.766 160 3.70592 Potri.004G059700.1.v4.1 961 754.797 39 0.991843 Potri.007G009000.2.v4.1 1416 1209.77 1 0.0158674 Potri.003G141000.2.v4.1 2943 2736.77 851.312 5.97117 Potri.016G087400.1.v4.1 270 97.6483 6707.6 1318.59 Potri.015G069301.1.v4.1 564 360.467 0 0 Potri.010G195200.1.v4.1 1773 1566.77 162 1.98481 Potri.012G127500.1.v4.1 977 770.774 19281 480.188 ==> SRR4237658.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6704 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 885 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR4237658 completed mapping pipeline successfully