Starting /dee2/code/volunteer_pipeline.sh SRR4237659 current disk space = 3050533691392 free memory = 1581643632 SRR4237659 SRAfilesize fd0fcc5ed37f7d869b113e0b588960ba SRR4237659.sra SRR4237659.sra file validated SRR4237659 is paired end SRR4237659 is conventional basespace SRR4237659 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237659_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.36275 34.0 33.0 34.0 33.0 34.0 2 33.47125 34.0 34.0 34.0 33.0 34.0 3 33.4725 34.0 34.0 34.0 33.0 34.0 4 33.43325 34.0 34.0 34.0 33.0 34.0 5 33.43575 34.0 34.0 34.0 33.0 34.0 6 36.87225 38.0 37.0 38.0 36.0 38.0 7 37.3175 38.0 38.0 38.0 37.0 38.0 8 37.41725 38.0 38.0 38.0 37.0 38.0 9 37.52825 38.0 38.0 38.0 38.0 38.0 10-14 37.55655 38.0 38.0 38.0 38.0 38.0 15-19 37.52655 38.0 38.0 38.0 38.0 38.0 20-24 37.518 38.0 38.0 38.0 38.0 38.0 25-29 37.493950000000005 38.0 38.0 38.0 37.6 38.0 30-34 37.46535 38.0 38.0 38.0 38.0 38.0 35-39 37.417449999999995 38.0 38.0 38.0 37.4 38.0 40-44 37.3305 38.0 38.0 38.0 36.8 38.0 45-49 37.27755 38.0 38.0 38.0 37.0 38.0 50-54 37.27025 38.0 38.0 38.0 36.8 38.0 55-59 37.234449999999995 38.0 38.0 38.0 36.4 38.0 60-64 37.1866 38.0 38.0 38.0 36.4 38.0 65-69 37.14305 38.0 38.0 38.0 36.2 38.0 70-74 36.9965 38.0 38.0 38.0 35.8 38.0 75-79 36.782 38.0 38.0 38.0 35.4 38.0 80-84 36.9703 38.0 38.0 38.0 35.8 38.0 85-89 36.5841 38.0 37.8 38.0 34.0 38.0 90-94 36.44365 38.0 37.8 38.0 33.8 38.0 95-99 36.898900000000005 38.0 38.0 38.0 35.2 38.0 100-104 36.868399999999994 38.0 38.0 38.0 35.4 38.0 105-109 36.74465 38.0 38.0 38.0 35.0 38.0 110-114 36.4414 38.0 38.0 38.0 34.0 38.0 115-119 36.59335 38.0 38.0 38.0 34.8 38.0 120-124 36.455999999999996 38.0 38.0 38.0 34.0 38.0 125-129 36.42005 38.0 38.0 38.0 34.0 38.0 130-134 36.22115 38.0 38.0 38.0 33.8 38.0 135-139 36.023649999999996 38.0 37.6 38.0 32.8 38.0 140-144 35.76835 38.0 36.8 38.0 33.0 38.0 145-149 35.30915 38.0 36.2 38.0 31.4 38.0 150 31.03925 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 0.0 16 2.0 17 0.0 18 0.0 19 5.0 20 4.0 21 2.0 22 2.0 23 5.0 24 13.0 25 8.0 26 8.0 27 16.0 28 24.0 29 30.0 30 40.0 31 36.0 32 54.0 33 81.0 34 92.0 35 189.0 36 472.0 37 2915.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.75331830703732 11.269722013523667 9.892311545204107 34.08464813423491 2 22.275 15.475 34.025 28.225 3 19.75 20.775 26.700000000000003 32.775 4 23.225 29.675 22.650000000000002 24.45 5 23.225 32.4 23.724999999999998 20.65 6 17.620481927710845 36.04417670682731 24.59839357429719 21.73694779116466 7 14.05 26.05 41.85 18.05 8 17.8 24.825 32.074999999999996 25.3 9 17.7 24.675 33.900000000000006 23.724999999999998 10-14 19.74 30.294999999999998 26.55 23.415 15-19 19.78 29.2 27.894999999999996 23.125 20-24 19.54 29.315 27.589999999999996 23.555 25-29 19.865 28.994999999999997 27.46 23.68 30-34 19.759999999999998 29.42 27.42 23.400000000000002 35-39 19.814999999999998 29.205 27.065 23.915 40-44 19.75 29.395 27.3 23.555 45-49 19.759999999999998 28.73 27.3 24.21 50-54 19.650000000000002 29.435 27.47 23.445 55-59 20.244999999999997 28.53 27.82 23.405 60-64 20.044999999999998 29.37 27.47 23.115 65-69 19.915 28.895 27.63 23.56 70-74 20.345 29.060000000000002 26.87 23.724999999999998 75-79 19.689999999999998 28.655 27.6 24.055 80-84 19.755 28.544999999999998 27.685 24.015 85-89 19.634999999999998 27.744999999999997 28.110000000000003 24.51 90-94 20.235 28.794999999999998 27.025 23.945 95-99 19.37 29.565 27.21 23.855 100-104 19.695 28.26 28.28 23.765 105-109 20.005 28.744999999999997 27.785 23.465 110-114 20.015 28.110000000000003 28.194999999999997 23.68 115-119 20.315 29.265 27.08 23.34 120-124 20.235 29.104999999999997 26.93 23.73 125-129 20.560000000000002 28.465 27.32 23.655 130-134 20.885 28.744999999999997 26.825 23.544999999999998 135-139 20.595 28.615000000000002 27.045 23.745 140-144 21.13 28.675 26.32 23.875 145-149 20.66 28.62 27.235 23.485 150 21.675 28.249999999999996 25.775 24.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 3.0 24 4.0 25 3.5 26 5.5 27 9.5 28 14.0 29 19.5 30 20.5 31 21.0 32 33.5 33 50.5 34 61.0 35 80.0 36 93.0 37 99.0 38 133.5 39 158.5 40 183.0 41 224.5 42 247.5 43 247.5 44 260.0 45 279.0 46 270.5 47 246.0 48 221.5 49 206.5 50 176.5 51 139.0 52 123.5 53 104.5 54 72.5 55 51.0 56 38.0 57 27.5 58 19.5 59 16.0 60 11.0 61 5.0 62 2.0 63 2.5 64 5.0 65 4.0 66 1.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.4 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0125 0.0 0.0 0.025 0.0 80-81 0.037500000000000006 0.0 0.0 0.025 0.0 82-83 0.05 0.0 0.0 0.025 0.0 84-85 0.05 0.0 0.0 0.025 0.0 86-87 0.05 0.0 0.0 0.025 0.0 88-89 0.05 0.0 0.0 0.025 0.0 90-91 0.075 0.0 0.0 0.025 0.0 92-93 0.075 0.0 0.0 0.025 0.0 94-95 0.0875 0.0 0.0 0.025 0.0 96-97 0.125 0.0 0.0 0.025 0.0 98-99 0.16249999999999998 0.0 0.0 0.025 0.0 100-101 0.225 0.0 0.0 0.025 0.0 102-103 0.30000000000000004 0.0 0.0 0.025 0.0 104-105 0.4 0.0 0.0 0.025 0.0 106-107 0.4625 0.0 0.0 0.025 0.0 108-109 0.5625 0.0 0.0 0.025 0.0 110-111 0.8 0.0 0.0 0.025 0.0 112-113 0.9375 0.0 0.0 0.025 0.0 114-115 1.1625 0.0 0.0 0.025 0.0 116-117 1.425 0.0 0.0 0.025 0.0 118-119 1.5125000000000002 0.0 0.0 0.025 0.0 120-121 1.675 0.0 0.0 0.025 0.0 122-123 1.9375 0.0 0.0 0.025 0.0 124-125 2.3 0.0 0.0 0.025 0.0 126-127 2.6 0.0 0.0 0.025 0.0 128-129 2.9 0.0 0.0 0.025 0.0 130-131 3.2375 0.0 0.0 0.025 0.0 132-133 3.5125 0.0 0.0 0.025 0.0 134-135 3.8 0.0 0.0 0.025 0.0 136-137 4.0 0.0 0.0 0.025 0.0 138 4.275 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237659 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237659_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84875 33.0 33.0 34.0 32.0 34.0 2 32.8085 34.0 33.0 34.0 32.0 34.0 3 32.9595 34.0 33.0 34.0 32.0 34.0 4 32.91125 34.0 33.0 34.0 32.0 34.0 5 32.94375 34.0 33.0 34.0 32.0 34.0 6 37.09225 38.0 38.0 38.0 37.0 38.0 7 37.1055 38.0 38.0 38.0 37.0 38.0 8 36.8715 38.0 38.0 38.0 36.0 38.0 9 37.03475 38.0 38.0 38.0 37.0 38.0 10-14 36.9706 38.0 38.0 38.0 36.8 38.0 15-19 36.8943 38.0 38.0 38.0 36.4 38.0 20-24 36.883849999999995 38.0 38.0 38.0 36.6 38.0 25-29 36.259100000000004 38.0 37.8 38.0 33.0 38.0 30-34 36.76025 38.0 38.0 38.0 36.2 38.0 35-39 36.5804 38.0 38.0 38.0 35.4 38.0 40-44 36.4936 38.0 38.0 38.0 35.0 38.0 45-49 36.21215 38.0 37.8 38.0 33.0 38.0 50-54 36.594899999999996 38.0 38.0 38.0 34.8 38.0 55-59 36.76205 38.0 38.0 38.0 36.2 38.0 60-64 36.7224 38.0 38.0 38.0 35.8 38.0 65-69 36.74730000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.6055 38.0 38.0 38.0 35.6 38.0 75-79 36.68205 38.0 38.0 38.0 36.0 38.0 80-84 36.5322 38.0 38.0 38.0 35.6 38.0 85-89 36.53795 38.0 38.0 38.0 35.2 38.0 90-94 36.5329 38.0 38.0 38.0 35.4 38.0 95-99 36.443599999999996 38.0 38.0 38.0 35.2 38.0 100-104 36.412850000000006 38.0 38.0 38.0 35.0 38.0 105-109 36.1096 38.0 38.0 38.0 34.0 38.0 110-114 36.09675 38.0 38.0 38.0 33.8 38.0 115-119 36.007 38.0 38.0 38.0 33.8 38.0 120-124 35.862 38.0 38.0 38.0 33.6 38.0 125-129 35.83025 38.0 38.0 38.0 33.6 38.0 130-134 35.74784999999999 38.0 38.0 38.0 33.4 38.0 135-139 35.636900000000004 38.0 38.0 38.0 32.8 38.0 140-144 35.24444999999999 38.0 37.6 38.0 31.4 38.0 145-149 35.00505 38.0 37.8 38.0 31.8 38.0 150 30.03775 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 3.0 4 7.0 5 2.0 6 3.0 7 3.0 8 1.0 9 2.0 10 2.0 11 3.0 12 4.0 13 2.0 14 2.0 15 4.0 16 2.0 17 8.0 18 5.0 19 10.0 20 3.0 21 8.0 22 13.0 23 13.0 24 26.0 25 15.0 26 17.0 27 25.0 28 26.0 29 29.0 30 40.0 31 41.0 32 37.0 33 70.0 34 102.0 35 167.0 36 333.0 37 2965.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.9 20.549999999999997 13.325000000000001 25.224999999999998 2 27.85 26.724999999999998 29.799999999999997 15.625 3 21.6 29.4 30.375000000000004 18.625 4 24.95 34.55 22.400000000000002 18.099999999999998 5 24.4 36.725 21.925 16.950000000000003 6 19.6 38.800000000000004 24.099999999999998 17.5 7 19.400000000000002 20.424999999999997 41.775 18.4 8 21.85 24.675 28.625 24.85 9 22.900000000000002 23.125 30.975 23.0 10-14 24.125 27.93 26.435 21.51 15-19 23.165 27.985 27.889999999999997 20.96 20-24 23.244999999999997 28.065 28.27 20.419999999999998 25-29 23.47 28.08 28.065 20.385 30-34 23.18 27.985 28.544999999999998 20.29 35-39 23.485 27.73 28.360000000000003 20.424999999999997 40-44 23.395 27.994999999999997 27.97 20.64 45-49 23.45 27.744999999999997 27.944999999999997 20.86 50-54 23.044999999999998 27.71 28.310000000000002 20.935000000000002 55-59 23.849999999999998 27.445000000000004 28.144999999999996 20.560000000000002 60-64 23.285 27.965 28.360000000000003 20.39 65-69 23.005 28.125 28.515 20.355 70-74 22.88 28.105000000000004 27.950000000000003 21.065 75-79 23.785 27.165 28.225 20.825 80-84 23.53 27.66 28.64 20.169999999999998 85-89 23.49 27.560000000000002 28.535 20.415 90-94 23.175 27.43 28.77 20.625 95-99 23.115 27.46 28.93 20.495 100-104 23.974999999999998 27.405 28.4 20.22 105-109 23.61 27.33 28.449999999999996 20.61 110-114 23.54 28.18 27.950000000000003 20.330000000000002 115-119 23.93 27.73 27.93 20.41 120-124 23.51 27.73 28.73 20.03 125-129 24.115000000000002 28.165000000000003 27.515 20.205000000000002 130-134 24.325 27.994999999999997 27.495000000000005 20.185 135-139 24.035 27.935 28.115000000000002 19.915 140-144 24.560000000000002 27.85 27.944999999999997 19.645000000000003 145-149 24.765 28.199999999999996 27.32 19.715 150 25.025 28.1 27.3 19.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 3.0 23 3.5 24 3.0 25 2.0 26 3.0 27 7.5 28 8.5 29 11.0 30 15.5 31 20.5 32 29.5 33 39.5 34 43.5 35 56.5 36 72.5 37 96.5 38 129.5 39 161.0 40 200.0 41 226.0 42 249.0 43 277.5 44 287.0 45 287.5 46 291.5 47 274.0 48 230.5 49 198.5 50 174.5 51 147.0 52 120.5 53 91.0 54 73.0 55 50.5 56 28.5 57 20.0 58 15.0 59 11.5 60 8.5 61 7.5 62 4.5 63 3.0 64 3.0 65 3.0 66 2.5 67 1.0 68 0.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5375 0.0 0.0 0.0 0.0 110-111 0.7749999999999999 0.0 0.0 0.0 0.0 112-113 0.8999999999999999 0.0 0.0 0.0 0.0 114-115 1.1124999999999998 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.625 0.0 0.0 0.0 0.0 122-123 1.9125 0.0 0.0 0.0 0.0 124-125 2.2750000000000004 0.0 0.0 0.0 0.0 126-127 2.575 0.0 0.0 0.0 0.0 128-129 2.8625 0.0 0.0 0.0 0.0 130-131 3.1875 0.0 0.0 0.0 0.0 132-133 3.4125 0.0 0.0 0.0 0.0 134-135 3.6625 0.0 0.0 0.0 0.0 136-137 3.875 0.0 0.0 0.0 0.0 138 4.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2135456 spots for SRR4237659.sra Written 2135456 spots for SRR4237659.sra Read 2135456 spots for SRR4237659.sra Written 2135456 spots for SRR4237659.sra Read 2135456 spots for SRR4237659.sra Written 2135456 spots for SRR4237659.sra Read 2135456 spots for SRR4237659.sra Written 2135456 spots for SRR4237659.sra Read 2135456 spots for SRR4237659.sra Written 2135456 spots for SRR4237659.sra Read 2135456 spots for SRR4237659.sra Written 2135456 spots for SRR4237659.sra Read 2135456 spots for SRR4237659.sra Written 2135456 spots for SRR4237659.sra Read 2135456 spots for SRR4237659.sra Written 2135456 spots for SRR4237659.sra Read 2135456 spots for SRR4237659.sra Written 2135456 spots for SRR4237659.sra Read 2135456 spots for SRR4237659.sra Written 2135456 spots for SRR4237659.sra Read 2135456 spots for SRR4237659.sra Written 2135456 spots for SRR4237659.sra Read 2135471 spots for SRR4237659.sra Written 2135471 spots for SRR4237659.sra Read 2135456 spots for SRR4237659.sra Written 2135456 spots for SRR4237659.sra Read 2135456 spots for SRR4237659.sra Written 2135456 spots for SRR4237659.sra Read 2135456 spots for SRR4237659.sra Written 2135456 spots for SRR4237659.sra Read 2135456 spots for SRR4237659.sra Written 2135456 spots for SRR4237659.sra Read 2135456 spots for SRR4237659.sra Written 2135456 spots for SRR4237659.sra Read 2135456 spots for SRR4237659.sra Written 2135456 spots for SRR4237659.sra Read 2135456 spots for SRR4237659.sra Written 2135456 spots for SRR4237659.sra Read 2135456 spots for SRR4237659.sra Written 2135456 spots for SRR4237659.sra SRR ids: ['SRR4237659.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qawxmocw SRR4237659.sra spots: 42709135 blocks: [[1, 2135456], [2135457, 4270912], [4270913, 6406368], [6406369, 8541824], [8541825, 10677280], [10677281, 12812736], [12812737, 14948192], [14948193, 17083648], [17083649, 19219104], [19219105, 21354560], [21354561, 23490016], [23490017, 25625472], [25625473, 27760928], [27760929, 29896384], [29896385, 32031840], [32031841, 34167296], [34167297, 36302752], [36302753, 38438208], [38438209, 40573664], [40573665, 42709135]] SRR4237659 file size 14367607 SRR4237659 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237659 SRR4237659_1.fastq SRR4237659_2.fastq Input file: SRR4237659_1.fastq Paired file: SRR4237659_2.fastq trimmed: SRR4237659-trimmed-pair1.fastq, SRR4237659-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:02:07 2025 >> started Wed Feb 12 22:02:55 2025 >> done (48.266s) 42709135 read pairs processed; of these: 96712 ( 0.23%) short read pairs filtered out after trimming by size control 28055 ( 0.07%) empty read pairs filtered out after trimming by size control 42584368 (99.71%) read pairs available; of these: 11653806 (27.37%) trimmed read pairs available after processing 30930562 (72.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 8 0.00% 21 8 0.00% 22 9 0.00% 23 7 0.00% 24 9 0.00% 25 7 0.00% 26 13 0.00% 27 7 0.00% 28 15 0.00% 29 11 0.00% 30 20 0.00% 31 15 0.00% 32 13 0.00% 33 19 0.00% 34 15 0.00% 35 20 0.00% 36 19 0.00% 37 24 0.00% 38 27 0.00% 39 18 0.00% 40 44 0.00% 41 34 0.00% 42 56 0.00% 43 60 0.00% 44 62 0.00% 45 48 0.00% 46 54 0.00% 47 73 0.00% 48 81 0.00% 49 77 0.00% 50 103 0.00% 51 115 0.00% 52 139 0.00% 53 130 0.00% 54 153 0.00% 55 153 0.00% 56 184 0.00% 57 188 0.00% 58 228 0.00% 59 236 0.00% 60 305 0.00% 61 331 0.00% 62 385 0.00% 63 422 0.00% 64 476 0.00% 65 560 0.00% 66 610 0.00% 67 845 0.00% 68 1551 0.00% 69 4329 0.01% 70 2580 0.01% 71 1360 0.00% 72 1380 0.00% 73 1457 0.00% 74 1575 0.00% 75 1844 0.00% 76 2026 0.00% 77 2121 0.00% 78 2421 0.01% 79 2733 0.01% 80 3077 0.01% 81 3582 0.01% 82 4240 0.01% 83 5223 0.01% 84 14759 0.03% 85 11242 0.03% 86 11273 0.03% 87 12794 0.03% 88 14186 0.03% 89 11336 0.03% 90 12384 0.03% 91 13149 0.03% 92 16989 0.04% 93 15956 0.04% 94 19210 0.05% 95 18357 0.04% 96 18835 0.04% 97 19758 0.05% 98 20325 0.05% 99 21869 0.05% 100 23639 0.06% 101 25079 0.06% 102 26725 0.06% 103 28366 0.07% 104 30246 0.07% 105 32309 0.08% 106 34310 0.08% 107 38554 0.09% 108 38735 0.09% 109 39594 0.09% 110 41509 0.10% 111 43947 0.10% 112 46016 0.11% 113 49014 0.12% 114 51909 0.12% 115 54279 0.13% 116 57214 0.13% 117 59598 0.14% 118 61965 0.15% 119 64263 0.15% 120 68999 0.16% 121 69529 0.16% 122 76252 0.18% 123 75273 0.18% 124 78656 0.18% 125 81252 0.19% 126 84725 0.20% 127 86817 0.20% 128 90660 0.21% 129 94516 0.22% 130 97896 0.23% 131 100974 0.24% 132 105438 0.25% 133 109874 0.26% 134 114145 0.27% 135 120279 0.28% 136 130692 0.31% 137 132885 0.31% 138 139519 0.33% 139 147828 0.35% 140 157130 0.37% 141 169832 0.40% 142 184578 0.43% 143 201241 0.47% 144 229037 0.54% 145 270068 0.63% 146 334072 0.78% 147 498566 1.17% 148 826137 1.94% 149 5629301 13.22% 150 30930562 72.63% 42584368 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=40 prefix-density=0.15 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=434.65 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=19.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=7.34 fanout-score-rank=16 prefix-density=0.25 prefix-fanout=4.7 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=274.69 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=30.6 sequence=AAGAAGAAGAAA SRR4237659 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:03:38 Started mapping on | Feb 12 22:03:38 Finished on | Feb 12 22:07:46 Mapping speed, Million of reads per hour | 618.16 Number of input reads | 42584368 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 40749999 Uniquely mapped reads % | 95.69% Average mapped length | 294.26 Number of splices: Total | 38487991 Number of splices: Annotated (sjdb) | 37805865 Number of splices: GT/AG | 37902644 Number of splices: GC/AG | 458361 Number of splices: AT/AC | 37067 Number of splices: Non-canonical | 89919 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 801361 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 52615 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.28% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1083608 1083608 1083608 N_multimapping 801361 801361 801361 N_noFeature 1165040 40233689 1423415 N_ambiguous 432107 2805 171976 UnstrandedReadsAssigned:39152852 PositiveStrandReadsAssigned:513505 NegativeStrandReadsAssigned:39154608 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR4237659 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237659-trimmed-pair1.fastq SRR4237659-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 42,584,368 reads, 38,925,358 reads pseudoaligned [quant] estimated average fragment length: 247.741 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,301 rounds 52401 SRR4237659.ke.tsv 34699 SRR4237659.se.tsv 87100 total ==> SRR4237659.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.26 849 12.2851 Potri.005G024800.1.v4.1 1035 788.259 177 5.75515 Potri.004G059700.1.v4.1 961 714.288 19 0.681762 Potri.007G009000.2.v4.1 1416 1169.26 0 0 Potri.003G141000.2.v4.1 2943 2696.26 790.114 7.5107 Potri.016G087400.1.v4.1 270 77.4332 4346 1438.52 Potri.015G069301.1.v4.1 564 323.052 0 0 Potri.010G195200.1.v4.1 1773 1526.26 108.717 1.82567 Potri.012G127500.1.v4.1 977 730.274 14837 520.73 ==> SRR4237659.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 3604 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 638 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR4237659 completed mapping pipeline successfully