Starting /dee2/code/volunteer_pipeline.sh SRR4237660 current disk space = 3050733137920 free memory = 1488096952 SRR4237660 SRAfilesize b179c40e46102710e067e27a314a7089 SRR4237660.sra SRR4237660.sra file validated SRR4237660 is paired end SRR4237660 is conventional basespace SRR4237660 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237660_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.32075 34.0 33.0 34.0 33.0 34.0 2 33.39475 34.0 33.0 34.0 33.0 34.0 3 33.4135 34.0 33.0 34.0 33.0 34.0 4 33.405 34.0 33.0 34.0 33.0 34.0 5 33.3855 34.0 33.0 34.0 33.0 34.0 6 36.304 38.0 37.0 38.0 34.0 38.0 7 37.227 38.0 38.0 38.0 36.0 38.0 8 37.31075 38.0 38.0 38.0 37.0 38.0 9 37.4445 38.0 38.0 38.0 37.0 38.0 10-14 37.495 38.0 38.0 38.0 37.6 38.0 15-19 37.49235 38.0 38.0 38.0 38.0 38.0 20-24 36.57965 38.0 37.8 38.0 33.2 38.0 25-29 37.39965 38.0 38.0 38.0 37.0 38.0 30-34 37.411950000000004 38.0 38.0 38.0 37.2 38.0 35-39 37.3976 38.0 38.0 38.0 37.0 38.0 40-44 37.334649999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.3112 38.0 38.0 38.0 37.0 38.0 50-54 37.07695 38.0 38.0 38.0 36.4 38.0 55-59 37.0455 38.0 38.0 38.0 36.0 38.0 60-64 37.117599999999996 38.0 38.0 38.0 36.2 38.0 65-69 37.1181 38.0 38.0 38.0 36.0 38.0 70-74 36.37194999999999 38.0 37.2 38.0 33.0 38.0 75-79 36.9919 38.0 38.0 38.0 36.0 38.0 80-84 36.76475 38.0 37.8 38.0 34.6 38.0 85-89 36.829100000000004 38.0 38.0 38.0 35.6 38.0 90-94 36.8269 38.0 38.0 38.0 35.6 38.0 95-99 36.8648 38.0 38.0 38.0 36.0 38.0 100-104 36.758649999999996 38.0 38.0 38.0 35.2 38.0 105-109 36.6923 38.0 38.0 38.0 35.0 38.0 110-114 35.9504 38.0 37.2 38.0 31.2 38.0 115-119 36.52575 38.0 38.0 38.0 34.4 38.0 120-124 35.723800000000004 38.0 36.8 38.0 30.4 38.0 125-129 36.2967 38.0 38.0 38.0 34.0 38.0 130-134 35.8767 38.0 37.2 38.0 32.2 38.0 135-139 34.62885 38.0 34.8 38.0 26.4 38.0 140-144 35.6146 38.0 37.0 38.0 31.8 38.0 145-149 35.4404 38.0 36.8 38.0 32.8 38.0 150 30.74725 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 2.0 17 2.0 18 1.0 19 6.0 20 2.0 21 4.0 22 5.0 23 6.0 24 7.0 25 11.0 26 18.0 27 13.0 28 21.0 29 23.0 30 34.0 31 47.0 32 54.0 33 95.0 34 130.0 35 209.0 36 571.0 37 2732.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.21482223335003 11.016524787180773 8.462694041061592 37.30595893840761 2 24.05 15.049999999999999 34.575 26.325 3 20.3 20.625 26.125 32.95 4 22.3 29.375 23.150000000000002 25.174999999999997 5 22.975 35.55 22.5 18.975 6 18.73411286222674 35.53634977122522 24.300965937976613 21.428571428571427 7 13.775 26.650000000000002 41.625 17.95 8 17.075000000000003 25.174999999999997 32.225 25.525 9 17.025000000000002 25.224999999999998 33.775 23.974999999999998 10-14 19.855 30.06 27.18 22.905 15-19 19.66 29.45 27.534999999999997 23.355 20-24 19.63 29.654999999999998 27.195000000000004 23.52 25-29 19.695 29.79 27.065 23.45 30-34 19.63 29.659999999999997 27.46 23.25 35-39 20.07 28.83 26.935 24.165 40-44 20.395 29.13 27.22 23.255 45-49 20.41 28.575 27.794999999999998 23.22 50-54 20.200000000000003 29.17 26.965 23.665 55-59 19.580000000000002 29.01 27.325 24.085 60-64 19.53 29.015 27.33 24.125 65-69 20.575 28.305000000000003 27.105 24.015 70-74 20.119999999999997 28.915000000000003 27.279999999999998 23.685000000000002 75-79 20.01 28.860000000000003 27.345000000000002 23.785 80-84 20.294999999999998 28.634999999999998 27.49 23.580000000000002 85-89 20.215 29.020000000000003 27.279999999999998 23.485 90-94 20.244999999999997 29.125 27.315 23.315 95-99 20.19 29.445 27.060000000000002 23.305 100-104 20.1 29.060000000000002 27.389999999999997 23.45 105-109 20.07 28.685 27.525 23.72 110-114 20.815 28.810000000000002 26.979999999999997 23.395 115-119 20.630000000000003 28.88 27.255000000000003 23.235 120-124 19.985 28.610000000000003 27.3 24.104999999999997 125-129 20.97 28.125 26.979999999999997 23.925 130-134 20.91 28.189999999999998 26.565 24.335 135-139 20.435 28.73 26.889999999999997 23.945 140-144 21.305 27.92 27.084999999999997 23.69 145-149 20.945 29.48 26.169999999999998 23.405 150 20.19038076152305 29.183366733466933 25.526052104208418 25.100200400801604 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 1.5 23 1.5 24 1.5 25 3.0 26 5.5 27 10.0 28 13.0 29 16.5 30 22.0 31 30.0 32 37.5 33 40.0 34 54.5 35 72.0 36 85.0 37 117.5 38 143.5 39 155.0 40 178.5 41 216.5 42 255.0 43 261.5 44 269.5 45 277.0 46 257.0 47 233.5 48 237.0 49 214.5 50 164.0 51 139.0 52 104.0 53 86.0 54 80.5 55 53.0 56 38.0 57 32.5 58 21.5 59 16.0 60 9.5 61 4.0 62 5.5 63 9.0 64 7.0 65 4.5 66 4.0 67 2.5 68 0.5 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 1.6500000000000001 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0125 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.037500000000000006 0.0 0.0 0.025 0.0 70-71 0.05 0.0 0.0 0.025 0.0 72-73 0.05 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.075 0.0 0.0 0.025 0.0 84-85 0.075 0.0 0.0 0.025 0.0 86-87 0.1 0.0 0.0 0.025 0.0 88-89 0.1375 0.0 0.0 0.025 0.0 90-91 0.1875 0.0 0.0 0.025 0.0 92-93 0.2375 0.0 0.0 0.025 0.0 94-95 0.2625 0.0 0.0 0.025 0.0 96-97 0.32499999999999996 0.0 0.0 0.025 0.0 98-99 0.4125 0.0 0.0 0.025 0.0 100-101 0.5375000000000001 0.0 0.0 0.025 0.0 102-103 0.575 0.0 0.0 0.025 0.0 104-105 0.6625000000000001 0.0 0.0 0.025 0.0 106-107 0.7375 0.0 0.0 0.025 0.0 108-109 0.8375 0.0 0.0 0.025 0.0 110-111 1.0125 0.0 0.0 0.025 0.0 112-113 1.2999999999999998 0.0 0.0 0.025 0.0 114-115 1.575 0.0 0.0 0.025 0.0 116-117 1.725 0.0 0.0 0.025 0.0 118-119 1.95 0.0 0.0 0.025 0.0 120-121 2.1125 0.0 0.0 0.025 0.0 122-123 2.2750000000000004 0.0 0.0 0.025 0.0 124-125 2.5375 0.0 0.0 0.025 0.0 126-127 2.7750000000000004 0.0 0.0 0.025 0.0 128-129 3.175 0.0 0.0 0.025 0.0 130-131 3.55 0.0 0.0 0.025 0.0 132-133 3.8625 0.0 0.0 0.025 0.0 134-135 4.2625 0.0 0.0 0.025 0.0 136-137 4.7875 0.0 0.0 0.025 0.0 138 5.1 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTGCA 10 0.006973645 144.0 3 >>END_MODULE SRR4237660 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237660_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90425 33.0 33.0 34.0 32.0 34.0 2 32.8415 34.0 33.0 34.0 32.0 34.0 3 33.049 34.0 33.0 34.0 32.0 34.0 4 32.9025 34.0 33.0 34.0 32.0 34.0 5 32.97475 34.0 33.0 34.0 32.0 34.0 6 35.1045 38.0 37.0 38.0 26.0 38.0 7 36.731 38.0 38.0 38.0 35.0 38.0 8 36.83325 38.0 38.0 38.0 36.0 38.0 9 37.00275 38.0 38.0 38.0 36.0 38.0 10-14 36.6877 38.0 37.8 38.0 34.6 38.0 15-19 37.02205 38.0 38.0 38.0 36.6 38.0 20-24 37.0883 38.0 38.0 38.0 37.0 38.0 25-29 36.62565 38.0 37.8 38.0 34.6 38.0 30-34 36.1025 38.0 36.8 38.0 31.0 38.0 35-39 37.0296 38.0 38.0 38.0 37.0 38.0 40-44 37.029849999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.0462 38.0 38.0 38.0 36.8 38.0 50-54 37.02505 38.0 38.0 38.0 36.8 38.0 55-59 37.00255 38.0 38.0 38.0 37.0 38.0 60-64 36.9538 38.0 38.0 38.0 36.2 38.0 65-69 36.9221 38.0 38.0 38.0 36.0 38.0 70-74 36.850699999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.48435 38.0 37.8 38.0 34.2 38.0 80-84 36.6471 38.0 38.0 38.0 35.4 38.0 85-89 36.68955 38.0 38.0 38.0 35.8 38.0 90-94 36.688649999999996 38.0 38.0 38.0 36.0 38.0 95-99 36.612199999999994 38.0 38.0 38.0 35.6 38.0 100-104 36.41905 38.0 38.0 38.0 34.6 38.0 105-109 36.428700000000006 38.0 38.0 38.0 34.6 38.0 110-114 36.4153 38.0 38.0 38.0 34.8 38.0 115-119 36.25435 38.0 38.0 38.0 34.0 38.0 120-124 36.01285 38.0 38.0 38.0 33.6 38.0 125-129 36.0147 38.0 38.0 38.0 33.8 38.0 130-134 35.84275 38.0 38.0 38.0 33.4 38.0 135-139 35.70265 38.0 38.0 38.0 33.2 38.0 140-144 35.612049999999996 38.0 38.0 38.0 32.6 38.0 145-149 35.24594999999999 38.0 38.0 38.0 32.2 38.0 150 29.446 35.0 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 4.0 5 2.0 6 1.0 7 1.0 8 2.0 9 2.0 10 0.0 11 2.0 12 3.0 13 5.0 14 1.0 15 2.0 16 5.0 17 3.0 18 3.0 19 2.0 20 3.0 21 7.0 22 9.0 23 5.0 24 11.0 25 11.0 26 23.0 27 21.0 28 23.0 29 25.0 30 41.0 31 45.0 32 54.0 33 64.0 34 111.0 35 191.0 36 402.0 37 2906.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.825 20.25 12.35 25.575 2 28.349999999999998 26.924999999999997 30.775000000000002 13.950000000000001 3 21.05 29.049999999999997 30.9 19.0 4 23.799999999999997 35.725 23.425 17.05 5 26.55 35.825 21.7 15.925 6 19.675 39.300000000000004 22.55 18.475 7 20.075000000000003 20.25 40.300000000000004 19.375 8 21.375 24.925 28.799999999999997 24.9 9 22.7 23.724999999999998 28.65 24.925 10-14 23.745 28.67 25.629999999999995 21.955 15-19 23.385 27.54 28.305000000000003 20.77 20-24 22.955000000000002 28.285 27.779999999999998 20.979999999999997 25-29 23.405 27.435 28.48 20.68 30-34 22.770000000000003 28.02 27.825 21.385 35-39 23.395 27.034999999999997 28.615000000000002 20.955 40-44 23.400000000000002 27.634999999999998 27.715 21.25 45-49 23.415 27.694999999999997 28.244999999999997 20.645 50-54 23.185 28.165000000000003 27.725 20.925 55-59 22.93 27.589999999999996 28.4 21.08 60-64 23.405 27.189999999999998 28.660000000000004 20.745 65-69 23.577357735773578 27.83278327832783 27.96779677967797 20.622062206220622 70-74 23.955000000000002 27.245 28.044999999999998 20.755000000000003 75-79 23.544999999999998 27.339999999999996 28.549999999999997 20.565 80-84 23.205000000000002 27.439999999999998 28.73 20.625 85-89 23.465 27.55 28.634999999999998 20.349999999999998 90-94 23.982398239823983 27.817781778177817 28.01780178017802 20.18201820182018 95-99 23.26732673267327 28.102810281028102 27.87778777877788 20.75207520752075 100-104 24.217421742174217 27.61776177617762 27.892789278927893 20.27202720272027 105-109 23.508227879757914 27.844745660981346 28.174861201420498 20.472165257840246 110-114 23.472347234723472 27.447744774477446 28.542854285428543 20.537053705370536 115-119 23.790947736934235 27.461865466366593 28.057014253563388 20.690172543135784 120-124 23.969793958791758 27.89057811562313 27.725545109021805 20.41408281656331 125-129 23.765 27.705000000000002 28.249999999999996 20.28 130-134 24.235 27.505000000000003 27.73 20.53 135-139 24.007400740074008 27.642764276427645 27.96279627962796 20.387038703870385 140-144 24.547454745474546 27.907790779077907 27.607760776077605 19.936993699369935 145-149 25.018760318174998 27.45510030516784 27.655210365701137 19.870929010956026 150 24.6 27.125 27.55 20.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 0.0 24 2.0 25 3.0 26 5.0 27 6.5 28 6.0 29 5.5 30 9.5 31 19.5 32 25.0 33 35.0 34 45.0 35 53.0 36 75.0 37 101.0 38 127.0 39 166.0 40 198.5 41 218.0 42 239.0 43 268.0 44 290.5 45 284.0 46 297.5 47 283.5 48 235.5 49 204.0 50 168.0 51 147.5 52 116.5 53 88.5 54 75.5 55 56.0 56 41.0 57 27.0 58 14.5 59 12.0 60 11.0 61 11.5 62 10.0 63 4.5 64 3.0 65 1.5 66 0.5 67 1.0 68 1.0 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.01 100-104 0.01 105-109 0.034999999999999996 110-114 0.01 115-119 0.025 120-124 0.02 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.01 145-149 0.055 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3766951280763436 0.75 3 0.0 0.0 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.3250000000000002 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.7625000000000002 0.0 0.0 0.0 0.0 118-119 1.9749999999999999 0.0 0.0 0.0 0.0 120-121 2.1500000000000004 0.0 0.0 0.0 0.0 122-123 2.325 0.0 0.0 0.0 0.0 124-125 2.5875 0.0 0.0 0.0 0.0 126-127 2.8125 0.0 0.0 0.0 0.0 128-129 3.2375 0.0 0.0 0.0 0.0 130-131 3.625 0.0 0.0 0.0 0.0 132-133 3.9375 0.0 0.0 0.0 0.0 134-135 4.35 0.0 0.0 0.0 0.0 136-137 4.8875 0.0 0.0 0.0 0.0 138 5.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1703131 spots for SRR4237660.sra Written 1703131 spots for SRR4237660.sra Read 1703131 spots for SRR4237660.sra Written 1703131 spots for SRR4237660.sra Read 1703131 spots for SRR4237660.sra Written 1703131 spots for SRR4237660.sra Read 1703131 spots for SRR4237660.sra Written 1703131 spots for SRR4237660.sra Read 1703131 spots for SRR4237660.sra Written 1703131 spots for SRR4237660.sra Read 1703131 spots for SRR4237660.sra Written 1703131 spots for SRR4237660.sra Read 1703131 spots for SRR4237660.sra Written 1703131 spots for SRR4237660.sra Read 1703131 spots for SRR4237660.sra Written 1703131 spots for SRR4237660.sra Read 1703131 spots for SRR4237660.sra Written 1703131 spots for SRR4237660.sra Read 1703131 spots for SRR4237660.sra Written 1703131 spots for SRR4237660.sra Read 1703131 spots for SRR4237660.sra Written 1703131 spots for SRR4237660.sra Read 1703131 spots for SRR4237660.sra Written 1703131 spots for SRR4237660.sra Read 1703131 spots for SRR4237660.sra Written 1703131 spots for SRR4237660.sra Read 1703131 spots for SRR4237660.sra Written 1703131 spots for SRR4237660.sra Read 1703131 spots for SRR4237660.sra Written 1703131 spots for SRR4237660.sra Read 1703131 spots for SRR4237660.sra Written 1703131 spots for SRR4237660.sra Read 1703133 spots for SRR4237660.sra Written 1703133 spots for SRR4237660.sra Read 1703131 spots for SRR4237660.sra Written 1703131 spots for SRR4237660.sra Read 1703131 spots for SRR4237660.sra Written 1703131 spots for SRR4237660.sra Read 1703131 spots for SRR4237660.sra Written 1703131 spots for SRR4237660.sra SRR ids: ['SRR4237660.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pkapwf6e SRR4237660.sra spots: 34062622 blocks: [[1, 1703131], [1703132, 3406262], [3406263, 5109393], [5109394, 6812524], [6812525, 8515655], [8515656, 10218786], [10218787, 11921917], [11921918, 13625048], [13625049, 15328179], [15328180, 17031310], [17031311, 18734441], [18734442, 20437572], [20437573, 22140703], [22140704, 23843834], [23843835, 25546965], [25546966, 27250096], [27250097, 28953227], [28953228, 30656358], [30656359, 32359489], [32359490, 34062622]] SRR4237660 file size 11454475 SRR4237660 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237660 SRR4237660_1.fastq SRR4237660_2.fastq Input file: SRR4237660_1.fastq Paired file: SRR4237660_2.fastq trimmed: SRR4237660-trimmed-pair1.fastq, SRR4237660-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:39:52 2025 >> started Wed Feb 12 21:40:40 2025 >> done (47.784s) 34062622 read pairs processed; of these: 60469 ( 0.18%) short read pairs filtered out after trimming by size control 22575 ( 0.07%) empty read pairs filtered out after trimming by size control 33979578 (99.76%) read pairs available; of these: 10828252 (31.87%) trimmed read pairs available after processing 23151326 (68.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 7 0.00% 20 6 0.00% 21 1 0.00% 22 4 0.00% 23 10 0.00% 24 12 0.00% 25 8 0.00% 26 10 0.00% 27 11 0.00% 28 6 0.00% 29 9 0.00% 30 16 0.00% 31 10 0.00% 32 14 0.00% 33 15 0.00% 34 9 0.00% 35 24 0.00% 36 15 0.00% 37 22 0.00% 38 32 0.00% 39 30 0.00% 40 31 0.00% 41 42 0.00% 42 46 0.00% 43 41 0.00% 44 59 0.00% 45 43 0.00% 46 49 0.00% 47 67 0.00% 48 92 0.00% 49 65 0.00% 50 102 0.00% 51 115 0.00% 52 111 0.00% 53 129 0.00% 54 145 0.00% 55 162 0.00% 56 189 0.00% 57 205 0.00% 58 244 0.00% 59 275 0.00% 60 295 0.00% 61 368 0.00% 62 427 0.00% 63 433 0.00% 64 470 0.00% 65 603 0.00% 66 622 0.00% 67 708 0.00% 68 982 0.00% 69 2021 0.01% 70 1961 0.01% 71 1227 0.00% 72 1304 0.00% 73 1474 0.00% 74 1704 0.01% 75 1827 0.01% 76 2081 0.01% 77 2251 0.01% 78 2453 0.01% 79 2848 0.01% 80 3201 0.01% 81 3747 0.01% 82 4270 0.01% 83 5446 0.02% 84 13116 0.04% 85 16012 0.05% 86 9364 0.03% 87 9719 0.03% 88 10790 0.03% 89 11080 0.03% 90 12631 0.04% 91 12643 0.04% 92 13707 0.04% 93 15455 0.05% 94 15788 0.05% 95 16891 0.05% 96 17783 0.05% 97 18980 0.06% 98 21466 0.06% 99 21584 0.06% 100 23382 0.07% 101 24852 0.07% 102 26275 0.08% 103 27898 0.08% 104 29642 0.09% 105 31549 0.09% 106 33762 0.10% 107 36022 0.11% 108 38463 0.11% 109 39342 0.12% 110 40412 0.12% 111 42625 0.13% 112 44491 0.13% 113 47039 0.14% 114 48911 0.14% 115 51733 0.15% 116 53397 0.16% 117 56274 0.17% 118 60435 0.18% 119 58466 0.17% 120 61099 0.18% 121 63647 0.19% 122 66070 0.19% 123 69893 0.21% 124 71566 0.21% 125 74647 0.22% 126 77600 0.23% 127 79462 0.23% 128 83134 0.24% 129 85948 0.25% 130 88501 0.26% 131 91483 0.27% 132 95540 0.28% 133 100076 0.29% 134 103138 0.30% 135 108954 0.32% 136 114513 0.34% 137 119350 0.35% 138 125926 0.37% 139 133036 0.39% 140 141629 0.42% 141 152158 0.45% 142 166658 0.49% 143 182973 0.54% 144 211432 0.62% 145 247485 0.73% 146 311632 0.92% 147 436966 1.29% 148 800663 2.36% 149 5265887 15.50% 150 23151326 68.13% 33979578 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=43 prefix-density=0.18 prefix-fanout=2.1 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=748.63 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=27.5 sequence=AAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.63 fanout-score-rank=29 prefix-density=0.22 prefix-fanout=2.8 sequence=GTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=93.01 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=18.4 sequence=TGCTGCTGAAATT SRR4237660 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:41:25 Started mapping on | Feb 12 21:41:26 Finished on | Feb 12 21:44:21 Mapping speed, Million of reads per hour | 699.01 Number of input reads | 33979578 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 32709135 Uniquely mapped reads % | 96.26% Average mapped length | 293.47 Number of splices: Total | 30296452 Number of splices: Annotated (sjdb) | 29799792 Number of splices: GT/AG | 29843699 Number of splices: GC/AG | 352982 Number of splices: AT/AC | 26910 Number of splices: Non-canonical | 72861 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 668937 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 56286 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.57% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 638927 638927 638927 N_multimapping 668937 668937 668937 N_noFeature 854415 32350230 1021988 N_ambiguous 326419 1876 133650 UnstrandedReadsAssigned:31528301 PositiveStrandReadsAssigned:357029 NegativeStrandReadsAssigned:31553497 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237660 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237660-trimmed-pair1.fastq SRR4237660-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,979,578 reads, 31,419,131 reads pseudoaligned [quant] estimated average fragment length: 238.216 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52401 SRR4237660.ke.tsv 34699 SRR4237660.se.tsv 87100 total ==> SRR4237660.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.78 738 13.0755 Potri.005G024800.1.v4.1 1035 797.784 105 4.15256 Potri.004G059700.1.v4.1 961 723.801 18 0.784631 Potri.007G009000.2.v4.1 1416 1178.78 0 0 Potri.003G141000.2.v4.1 2943 2705.78 534.122 6.22815 Potri.016G087400.1.v4.1 270 79.852 3633 1435.46 Potri.015G069301.1.v4.1 564 330.78 0 0 Potri.010G195200.1.v4.1 1773 1535.78 89.8493 1.84585 Potri.012G127500.1.v4.1 977 739.796 11027 470.281 ==> SRR4237660.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3008 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 400 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 7 SRR4237660 completed mapping pipeline successfully