Starting /dee2/code/volunteer_pipeline.sh SRR4237661 current disk space = 3050531188736 free memory = 1581647396 SRR4237661 SRAfilesize 32c3173421fe88dd3ede956cb6de4d12 SRR4237661.sra SRR4237661.sra file validated SRR4237661 is paired end SRR4237661 is conventional basespace SRR4237661 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237661_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.299 34.0 33.0 34.0 33.0 34.0 2 33.26 34.0 33.0 34.0 33.0 34.0 3 33.326 34.0 33.0 34.0 33.0 34.0 4 33.30425 34.0 33.0 34.0 33.0 34.0 5 33.25625 34.0 33.0 34.0 33.0 34.0 6 36.78625 38.0 37.0 38.0 35.0 38.0 7 36.61175 38.0 38.0 38.0 36.0 38.0 8 37.20025 38.0 38.0 38.0 36.0 38.0 9 37.291 38.0 38.0 38.0 37.0 38.0 10-14 37.44185 38.0 38.0 38.0 37.2 38.0 15-19 37.4623 38.0 38.0 38.0 37.4 38.0 20-24 37.4297 38.0 38.0 38.0 37.6 38.0 25-29 37.408 38.0 38.0 38.0 37.4 38.0 30-34 37.38125 38.0 38.0 38.0 37.2 38.0 35-39 37.05705 38.0 38.0 38.0 36.0 38.0 40-44 37.27655 38.0 38.0 38.0 37.0 38.0 45-49 37.268100000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.236200000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.12669999999999 38.0 38.0 38.0 36.2 38.0 60-64 37.1854 38.0 38.0 38.0 36.8 38.0 65-69 36.25515 38.0 36.4 38.0 32.0 38.0 70-74 36.5893 38.0 37.4 38.0 34.0 38.0 75-79 37.032050000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.8625 38.0 38.0 38.0 35.6 38.0 85-89 36.11785 38.0 37.0 38.0 31.6 38.0 90-94 36.547999999999995 38.0 37.6 38.0 33.6 38.0 95-99 36.73805000000001 38.0 38.0 38.0 35.4 38.0 100-104 36.77915 38.0 38.0 38.0 35.2 38.0 105-109 36.34335 38.0 37.6 38.0 33.2 38.0 110-114 36.547000000000004 38.0 38.0 38.0 34.0 38.0 115-119 35.7382 38.0 36.6 38.0 28.8 38.0 120-124 36.29965 38.0 38.0 38.0 33.6 38.0 125-129 36.345600000000005 38.0 38.0 38.0 34.0 38.0 130-134 36.1011 38.0 38.0 38.0 33.4 38.0 135-139 35.908699999999996 38.0 37.6 38.0 33.0 38.0 140-144 35.87904999999999 38.0 37.6 38.0 33.0 38.0 145-149 35.436899999999994 38.0 36.2 38.0 32.6 38.0 150 30.36075 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 3.0 15 0.0 16 2.0 17 1.0 18 2.0 19 1.0 20 3.0 21 4.0 22 4.0 23 5.0 24 11.0 25 12.0 26 9.0 27 17.0 28 23.0 29 31.0 30 40.0 31 53.0 32 70.0 33 82.0 34 127.0 35 190.0 36 512.0 37 2795.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.0 11.899999999999999 8.799999999999999 41.3 2 22.930732683170792 15.853963490872719 35.20880220055014 26.006501625406354 3 19.925 18.8 25.3 35.975 4 22.8 28.499999999999996 23.325000000000003 25.374999999999996 5 21.725 33.725 24.099999999999998 20.45 6 17.8 36.35 24.85 21.0 7 14.129327902240327 26.70570264765784 41.573319755600814 17.59164969450102 8 17.724999999999998 24.975 31.974999999999998 25.324999999999996 9 16.45 24.349999999999998 34.0 25.2 10-14 19.994999999999997 30.39 26.479999999999997 23.135 15-19 18.96 29.415000000000003 27.11 24.515 20-24 19.845 29.2 27.62 23.335 25-29 19.675 29.685 27.025 23.615 30-34 19.0 29.4 27.415 24.185000000000002 35-39 19.62 29.849999999999998 26.765 23.765 40-44 19.79 28.999999999999996 27.48 23.73 45-49 19.525000000000002 29.375 27.05 24.05 50-54 19.82 28.59 27.589999999999996 24.0 55-59 19.826982698269827 29.237923792379238 27.097709770977097 23.837383738373838 60-64 19.675 28.965000000000003 27.139999999999997 24.22 65-69 19.61 28.485 27.93 23.974999999999998 70-74 19.759999999999998 28.29 27.96 23.990000000000002 75-79 19.93 28.375 27.825 23.87 80-84 19.805 28.585 27.884999999999998 23.724999999999998 85-89 20.155 28.735 27.235 23.875 90-94 19.994999999999997 28.395 27.36 24.25 95-99 20.36 28.02 27.689999999999998 23.93 100-104 20.855 28.860000000000003 26.91 23.375 105-109 20.419999999999998 28.455000000000002 27.794999999999998 23.330000000000002 110-114 19.825 28.389999999999997 27.644999999999996 24.14 115-119 20.244999999999997 29.28 26.565 23.91 120-124 20.03 28.775000000000002 26.985 24.21 125-129 20.78 27.700000000000003 27.275 24.245 130-134 20.94209420942094 28.082808280828083 27.342734273427343 23.632363236323634 135-139 20.645 27.889999999999997 27.29 24.175 140-144 21.155288822205552 28.507126781695426 26.626656664166042 23.710927731932983 145-149 20.94 29.005 26.575 23.48 150 19.687026754164563 28.344270570418978 26.62796567390207 25.340737001514384 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 1.5 25 3.0 26 4.5 27 6.5 28 10.0 29 11.5 30 16.5 31 24.0 32 33.0 33 44.0 34 52.0 35 66.5 36 84.0 37 109.0 38 122.5 39 153.5 40 197.0 41 229.0 42 259.0 43 271.0 44 288.0 45 289.0 46 256.5 47 241.0 48 225.0 49 203.0 50 180.0 51 138.5 52 120.0 53 102.0 54 72.0 55 51.5 56 37.0 57 23.0 58 18.5 59 18.0 60 10.5 61 5.5 62 4.5 63 3.5 64 2.0 65 2.0 66 2.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 1.7999999999999998 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.01 135-139 0.0 140-144 0.025 145-149 0.0 150 0.95 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.075 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.3875 0.0 0.0 0.0 0.0 118-119 1.6875 0.0 0.0 0.0 0.0 120-121 1.9375 0.0 0.0 0.0 0.0 122-123 2.1875 0.0 0.0 0.0 0.0 124-125 2.4625000000000004 0.0 0.0 0.0 0.0 126-127 2.7249999999999996 0.0 0.0 0.0 0.0 128-129 2.9124999999999996 0.0 0.0 0.0 0.0 130-131 3.175 0.0 0.0 0.0 0.0 132-133 3.5125 0.0 0.0 0.0 0.0 134-135 3.9499999999999997 0.0 0.0 0.0 0.0 136-137 4.425 0.0 0.0 0.0 0.0 138 4.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237661 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237661_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.18175 33.0 33.0 34.0 30.0 34.0 2 32.6525 33.0 33.0 34.0 32.0 34.0 3 32.67375 33.0 33.0 34.0 32.0 34.0 4 30.895 33.0 32.0 34.0 15.0 34.0 5 32.1805 33.0 33.0 34.0 30.0 34.0 6 36.62675 38.0 38.0 38.0 34.0 38.0 7 36.82275 38.0 38.0 38.0 36.0 38.0 8 36.92425 38.0 38.0 38.0 36.0 38.0 9 36.843 38.0 38.0 38.0 36.0 38.0 10-14 36.81845 38.0 38.0 38.0 35.8 38.0 15-19 36.8511 38.0 38.0 38.0 36.0 38.0 20-24 36.83075 38.0 38.0 38.0 35.8 38.0 25-29 36.8005 38.0 38.0 38.0 35.8 38.0 30-34 36.83025 38.0 38.0 38.0 36.0 38.0 35-39 36.7664 38.0 38.0 38.0 36.0 38.0 40-44 36.75745 38.0 38.0 38.0 35.8 38.0 45-49 36.68605 38.0 38.0 38.0 35.6 38.0 50-54 36.368649999999995 38.0 38.0 38.0 33.6 38.0 55-59 36.5726 38.0 38.0 38.0 35.2 38.0 60-64 36.578500000000005 38.0 38.0 38.0 35.0 38.0 65-69 36.256600000000006 38.0 37.8 38.0 33.4 38.0 70-74 36.451299999999996 38.0 38.0 38.0 34.2 38.0 75-79 36.52565 38.0 38.0 38.0 35.0 38.0 80-84 36.3889 38.0 38.0 38.0 34.4 38.0 85-89 36.40984999999999 38.0 38.0 38.0 34.0 38.0 90-94 36.403549999999996 38.0 38.0 38.0 34.2 38.0 95-99 36.2885 38.0 38.0 38.0 34.0 38.0 100-104 36.15235 38.0 38.0 38.0 33.8 38.0 105-109 36.195299999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.119150000000005 38.0 38.0 38.0 33.6 38.0 115-119 36.02425 38.0 38.0 38.0 33.6 38.0 120-124 35.81564999999999 38.0 38.0 38.0 32.8 38.0 125-129 35.61215 38.0 38.0 38.0 31.2 38.0 130-134 35.43455 38.0 37.2 38.0 30.4 38.0 135-139 35.33944999999999 38.0 37.0 38.0 31.0 38.0 140-144 34.9725 38.0 36.0 38.0 29.8 38.0 145-149 34.4667 38.0 36.0 38.0 28.0 38.0 150 28.7375 35.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 5.0 5 4.0 6 2.0 7 2.0 8 0.0 9 2.0 10 0.0 11 0.0 12 3.0 13 2.0 14 4.0 15 0.0 16 2.0 17 4.0 18 2.0 19 11.0 20 13.0 21 9.0 22 15.0 23 13.0 24 19.0 25 17.0 26 28.0 27 23.0 28 29.0 29 54.0 30 41.0 31 62.0 32 67.0 33 106.0 34 124.0 35 156.0 36 355.0 37 2821.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.09919839679359 20.215430861723448 13.426853707414828 29.258517034068138 2 26.275 26.200000000000003 32.425 15.1 3 20.150000000000002 28.275 32.125 19.45 4 25.45 33.5 23.400000000000002 17.65 5 25.55 36.449999999999996 21.725 16.275000000000002 6 18.35 40.975 23.674999999999997 17.0 7 19.7 20.175 41.525 18.6 8 22.475 24.275 28.599999999999998 24.65 9 21.575 25.025 31.15 22.25 10-14 23.265 29.110000000000003 26.505000000000003 21.12 15-19 23.106155307765388 27.49137456872844 27.961398069903492 21.44107205360268 20-24 23.402340234023402 28.112811281128113 27.502750275027505 20.982098209820983 25-29 23.44617230861543 27.74638731936597 27.751387569378466 21.05605280264013 30-34 22.99844976746512 27.81417212581887 27.974196129419415 21.213181977296593 35-39 23.410852713178297 27.47686921730433 28.042010502625658 21.070267566891722 40-44 23.69329265242835 27.659680888310913 27.794728154854198 20.852298304406542 45-49 23.615903975993998 27.27181795448862 28.46211552888222 20.650162540635158 50-54 23.14430151659242 27.94434155863657 28.284698933880577 20.626657990890436 55-59 24.037018509254626 27.43871935967984 28.049024512256125 20.475237618809405 60-64 23.970786854084338 27.53238957530889 28.247711470161573 20.2491121004452 65-69 24.293502725954085 27.469614365027763 28.284899714900213 19.951983194117943 70-74 23.60680340170085 27.94897448724362 28.07903951975988 20.365182591295646 75-79 23.371033930537482 27.985186668001198 28.060254228805924 20.58352517265539 80-84 23.38701610483145 28.018405521656497 28.05841752525758 20.536160848254475 85-89 24.18967587034814 27.876150460184075 27.696078431372552 20.238095238095237 90-94 23.22545145315392 27.84252913811215 28.372767745485465 20.559251663248464 95-99 23.415536991646242 27.2822770246611 28.857986093742184 20.44419988995048 100-104 24.12844495573451 27.459610863802332 27.949782423848347 20.462161756614815 105-109 24.330948927017158 27.43234455504977 28.082637186734033 20.15406933119904 110-114 23.852660027025674 27.315950152645012 28.061658575646863 20.76973124468245 115-119 24.42843563960178 27.770273650507782 27.650207614187806 20.15108309570264 120-124 24.69722750475428 27.564808327494745 27.63987588829947 20.098088279451506 125-129 24.141899329530673 27.684379065345745 27.84449114380066 20.329230461322926 130-134 25.058770569699394 28.189866453258638 27.259540839293756 19.491822137748212 135-139 24.57974784870923 27.791675005003004 28.10186111667 19.52671602961777 140-144 24.896161737476856 28.018815993594554 27.44833108141921 19.636691187509385 145-149 25.42042042042042 28.048048048048045 26.876876876876878 19.654654654654653 150 23.829787234042556 26.558197747183982 29.586983729662077 20.02503128911139 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 0.0 23 1.5 24 3.0 25 3.5 26 4.5 27 5.5 28 6.5 29 6.5 30 9.5 31 14.5 32 22.0 33 39.5 34 44.5 35 44.5 36 76.0 37 108.0 38 141.0 39 178.0 40 201.0 41 217.0 42 262.5 43 296.5 44 298.5 45 292.5 46 252.5 47 235.0 48 229.0 49 211.0 50 179.5 51 139.5 52 117.0 53 96.5 54 71.5 55 51.5 56 38.5 57 29.0 58 22.0 59 14.5 60 7.5 61 4.5 62 6.0 63 5.0 64 1.5 65 1.0 66 2.5 67 1.5 68 1.5 69 1.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.01 25-29 0.005 30-34 0.015 35-39 0.025 40-44 0.034999999999999996 45-49 0.025 50-54 0.105 55-59 0.05 60-64 0.045 65-69 0.034999999999999996 70-74 0.05 75-79 0.09 80-84 0.03 85-89 0.04 90-94 0.045 95-99 0.045 100-104 0.034999999999999996 105-109 0.045 110-114 0.095 115-119 0.055 120-124 0.09 125-129 0.06999999999999999 130-134 0.034999999999999996 135-139 0.06 140-144 0.08499999999999999 145-149 0.1 150 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.48750000000000004 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.1375 0.0 0.0 0.0 0.0 114-115 1.2375 0.0 0.0 0.0 0.0 116-117 1.475 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 2.0375 0.0 0.0 0.0 0.0 122-123 2.2875 0.0 0.0 0.0 0.0 124-125 2.5625 0.0 0.0 0.0 0.0 126-127 2.8375 0.0 0.0 0.0 0.0 128-129 3.0374999999999996 0.0 0.0 0.0 0.0 130-131 3.3 0.0 0.0 0.0 0.0 132-133 3.6125 0.0 0.0 0.0 0.0 134-135 4.05 0.0 0.0 0.0 0.0 136-137 4.5 0.0 0.0 0.0 0.0 138 4.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCTGG 10 0.006973645 144.0 9 >>END_MODULE Read 2220155 spots for SRR4237661.sra Written 2220155 spots for SRR4237661.sra Read 2220155 spots for SRR4237661.sra Written 2220155 spots for SRR4237661.sra Read 2220155 spots for SRR4237661.sra Written 2220155 spots for SRR4237661.sra Read 2220155 spots for SRR4237661.sra Written 2220155 spots for SRR4237661.sra Read 2220155 spots for SRR4237661.sra Written 2220155 spots for SRR4237661.sra Read 2220155 spots for SRR4237661.sra Written 2220155 spots for SRR4237661.sra Read 2220155 spots for SRR4237661.sra Written 2220155 spots for SRR4237661.sra Read 2220155 spots for SRR4237661.sra Written 2220155 spots for SRR4237661.sra Read 2220155 spots for SRR4237661.sra Written 2220155 spots for SRR4237661.sra Read 2220155 spots for SRR4237661.sra Written 2220155 spots for SRR4237661.sra Read 2220155 spots for SRR4237661.sra Written 2220155 spots for SRR4237661.sra Read 2220155 spots for SRR4237661.sra Written 2220155 spots for SRR4237661.sra Read 2220155 spots for SRR4237661.sra Written 2220155 spots for SRR4237661.sra Read 2220171 spots for SRR4237661.sra Written 2220171 spots for SRR4237661.sra Read 2220155 spots for SRR4237661.sra Written 2220155 spots for SRR4237661.sra Read 2220155 spots for SRR4237661.sra Written 2220155 spots for SRR4237661.sra Read 2220155 spots for SRR4237661.sra Written 2220155 spots for SRR4237661.sra Read 2220155 spots for SRR4237661.sra Written 2220155 spots for SRR4237661.sra Read 2220155 spots for SRR4237661.sra Written 2220155 spots for SRR4237661.sra Read 2220155 spots for SRR4237661.sra Written 2220155 spots for SRR4237661.sra SRR ids: ['SRR4237661.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7ab5z72l SRR4237661.sra spots: 44403116 blocks: [[1, 2220155], [2220156, 4440310], [4440311, 6660465], [6660466, 8880620], [8880621, 11100775], [11100776, 13320930], [13320931, 15541085], [15541086, 17761240], [17761241, 19981395], [19981396, 22201550], [22201551, 24421705], [24421706, 26641860], [26641861, 28862015], [28862016, 31082170], [31082171, 33302325], [33302326, 35522480], [35522481, 37742635], [37742636, 39962790], [39962791, 42182945], [42182946, 44403116]] SRR4237661 file size 14938333 SRR4237661 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237661 SRR4237661_1.fastq SRR4237661_2.fastq Input file: SRR4237661_1.fastq Paired file: SRR4237661_2.fastq trimmed: SRR4237661-trimmed-pair1.fastq, SRR4237661-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:04:25 2025 >> started Wed Feb 12 22:05:14 2025 >> done (49.155s) 44403116 read pairs processed; of these: 59855 ( 0.13%) short read pairs filtered out after trimming by size control 27414 ( 0.06%) empty read pairs filtered out after trimming by size control 44315847 (99.80%) read pairs available; of these: 13418073 (30.28%) trimmed read pairs available after processing 30897774 (69.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 8 0.00% 21 4 0.00% 22 5 0.00% 23 9 0.00% 24 7 0.00% 25 7 0.00% 26 6 0.00% 27 10 0.00% 28 11 0.00% 29 8 0.00% 30 10 0.00% 31 10 0.00% 32 13 0.00% 33 15 0.00% 34 11 0.00% 35 17 0.00% 36 29 0.00% 37 31 0.00% 38 30 0.00% 39 22 0.00% 40 42 0.00% 41 45 0.00% 42 45 0.00% 43 60 0.00% 44 45 0.00% 45 52 0.00% 46 58 0.00% 47 77 0.00% 48 75 0.00% 49 74 0.00% 50 108 0.00% 51 105 0.00% 52 125 0.00% 53 136 0.00% 54 152 0.00% 55 152 0.00% 56 183 0.00% 57 207 0.00% 58 207 0.00% 59 250 0.00% 60 274 0.00% 61 318 0.00% 62 359 0.00% 63 407 0.00% 64 383 0.00% 65 477 0.00% 66 566 0.00% 67 745 0.00% 68 921 0.00% 69 1590 0.00% 70 1354 0.00% 71 1063 0.00% 72 1167 0.00% 73 1296 0.00% 74 1416 0.00% 75 1629 0.00% 76 1754 0.00% 77 1893 0.00% 78 2119 0.00% 79 2485 0.01% 80 2776 0.01% 81 3234 0.01% 82 3739 0.01% 83 4954 0.01% 84 17480 0.04% 85 17275 0.04% 86 8758 0.02% 87 9275 0.02% 88 10017 0.02% 89 13402 0.03% 90 13719 0.03% 91 13419 0.03% 92 23362 0.05% 93 13338 0.03% 94 16344 0.04% 95 16561 0.04% 96 16965 0.04% 97 17012 0.04% 98 18634 0.04% 99 19806 0.04% 100 21031 0.05% 101 21841 0.05% 102 23562 0.05% 103 25265 0.06% 104 26795 0.06% 105 29101 0.07% 106 31480 0.07% 107 33480 0.08% 108 35408 0.08% 109 36924 0.08% 110 38963 0.09% 111 40750 0.09% 112 43292 0.10% 113 45687 0.10% 114 48495 0.11% 115 51337 0.12% 116 54215 0.12% 117 57289 0.13% 118 60427 0.14% 119 64534 0.15% 120 64184 0.14% 121 67168 0.15% 122 70134 0.16% 123 73771 0.17% 124 76856 0.17% 125 79844 0.18% 126 84128 0.19% 127 89315 0.20% 128 93529 0.21% 129 96839 0.22% 130 101634 0.23% 131 104554 0.24% 132 108711 0.25% 133 114650 0.26% 134 120298 0.27% 135 127241 0.29% 136 135299 0.31% 137 142648 0.32% 138 152761 0.34% 139 161792 0.37% 140 173344 0.39% 141 188532 0.43% 142 209328 0.47% 143 230814 0.52% 144 264930 0.60% 145 317862 0.72% 146 403906 0.91% 147 565467 1.28% 148 1031475 2.33% 149 6892425 15.55% 150 30897774 69.72% 44315847 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=39 prefix-density=0.22 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.13 sequence-density-rank=6 fanout-score=91.37 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=17.8 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=40 prefix-density=0.20 prefix-fanout=2.2 sequence=AGTTCCAATGGCCACTGTTGAGGTTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=63.84 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=14.3 sequence=TCAAGGAAGCTTTCAG SRR4237661 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:06:04 Started mapping on | Feb 12 22:06:04 Finished on | Feb 12 22:10:28 Mapping speed, Million of reads per hour | 604.31 Number of input reads | 44315847 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 42389417 Uniquely mapped reads % | 95.65% Average mapped length | 294.55 Number of splices: Total | 38528309 Number of splices: Annotated (sjdb) | 37905246 Number of splices: GT/AG | 37950627 Number of splices: GC/AG | 451000 Number of splices: AT/AC | 33125 Number of splices: Non-canonical | 93557 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 862090 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 89058 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.15% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1096276 1096276 1096276 N_multimapping 862090 862090 862090 N_noFeature 1010512 41857720 1280705 N_ambiguous 436746 2491 173370 UnstrandedReadsAssigned:40942159 PositiveStrandReadsAssigned:529206 NegativeStrandReadsAssigned:40935342 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237661 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237661-trimmed-pair1.fastq SRR4237661-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,315,847 reads, 40,777,404 reads pseudoaligned [quant] estimated average fragment length: 242.299 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,217 rounds 52401 SRR4237661.ke.tsv 34699 SRR4237661.se.tsv 87100 total ==> SRR4237661.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.7 1013 14.1845 Potri.005G024800.1.v4.1 1035 793.701 76 2.38219 Potri.004G059700.1.v4.1 961 719.723 21 0.725893 Potri.007G009000.2.v4.1 1416 1174.7 0 0 Potri.003G141000.2.v4.1 2943 2701.7 592.114 5.45239 Potri.016G087400.1.v4.1 270 75.9517 4946 1620.08 Potri.015G069301.1.v4.1 564 326.506 0 0 Potri.010G195200.1.v4.1 1773 1531.7 262 4.25546 Potri.012G127500.1.v4.1 977 735.706 10790 364.868 ==> SRR4237661.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4903 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 547 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 29 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR4237661 completed mapping pipeline successfully