Starting /dee2/code/volunteer_pipeline.sh SRR4237662 current disk space = 3050523553792 free memory = 1579625604 SRR4237662 SRAfilesize 0c7444f05459c503ea7ea0962d2bbbe7 SRR4237662.sra SRR4237662.sra file validated SRR4237662 is paired end SRR4237662 is conventional basespace SRR4237662 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237662_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.12775 34.0 33.0 34.0 32.0 34.0 2 33.19875 34.0 33.0 34.0 32.0 34.0 3 33.2775 34.0 33.0 34.0 32.0 34.0 4 33.248 34.0 33.0 34.0 33.0 34.0 5 33.27775 34.0 33.0 34.0 33.0 34.0 6 36.0735 38.0 37.0 38.0 34.0 38.0 7 36.9395 38.0 38.0 38.0 35.0 38.0 8 37.1305 38.0 38.0 38.0 36.0 38.0 9 37.30625 38.0 38.0 38.0 37.0 38.0 10-14 37.37455 38.0 38.0 38.0 37.0 38.0 15-19 37.289449999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.339549999999996 38.0 38.0 38.0 36.8 38.0 25-29 37.19519999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.24165 38.0 38.0 38.0 36.8 38.0 35-39 37.2171 38.0 38.0 38.0 36.8 38.0 40-44 37.17525 38.0 38.0 38.0 36.6 38.0 45-49 37.08185 38.0 38.0 38.0 36.2 38.0 50-54 36.230599999999995 38.0 37.2 38.0 30.6 38.0 55-59 37.04545 38.0 38.0 38.0 36.0 38.0 60-64 36.834500000000006 38.0 38.0 38.0 35.4 38.0 65-69 36.64155 38.0 38.0 38.0 34.8 38.0 70-74 36.815749999999994 38.0 38.0 38.0 35.2 38.0 75-79 36.8497 38.0 38.0 38.0 35.6 38.0 80-84 36.7723 38.0 38.0 38.0 35.0 38.0 85-89 36.6885 38.0 38.0 38.0 34.6 38.0 90-94 36.677800000000005 38.0 38.0 38.0 34.6 38.0 95-99 36.6639 38.0 38.0 38.0 34.4 38.0 100-104 36.62015 38.0 38.0 38.0 34.2 38.0 105-109 35.7235 38.0 36.8 38.0 29.2 38.0 110-114 36.108250000000005 38.0 37.4 38.0 33.2 38.0 115-119 36.14125 38.0 37.6 38.0 33.2 38.0 120-124 36.083800000000004 38.0 37.6 38.0 33.2 38.0 125-129 36.097750000000005 38.0 37.8 38.0 33.8 38.0 130-134 35.78060000000001 38.0 36.8 38.0 32.6 38.0 135-139 35.672700000000006 38.0 36.4 38.0 31.8 38.0 140-144 35.5755 38.0 36.2 38.0 32.2 38.0 145-149 35.081399999999995 38.0 36.0 38.0 30.4 38.0 150 30.35 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 2.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 2.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 3.0 22 6.0 23 10.0 24 15.0 25 6.0 26 25.0 27 30.0 28 20.0 29 42.0 30 30.0 31 60.0 32 82.0 33 104.0 34 121.0 35 231.0 36 496.0 37 2708.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.203406813627254 11.948897795591181 7.965931863727454 40.88176352705411 2 22.0 15.950000000000001 35.449999999999996 26.6 3 20.875 18.7 25.374999999999996 35.05 4 24.65 29.075 22.775000000000002 23.5 5 21.7 33.925 23.7 20.674999999999997 6 17.146496815286625 36.38216560509554 23.97452229299363 22.4968152866242 7 13.450000000000001 26.1 41.775 18.675 8 18.2 24.9 31.15 25.75 9 17.0 24.425 34.2 24.375 10-14 19.814999999999998 30.154999999999998 26.900000000000002 23.13 15-19 19.695 28.52 28.155 23.630000000000003 20-24 19.805 29.07 27.595 23.53 25-29 19.735 28.754999999999995 27.805000000000003 23.705000000000002 30-34 19.445 29.255 27.415 23.885 35-39 19.49 29.165000000000003 27.529999999999998 23.815 40-44 20.674999999999997 29.439999999999998 26.955000000000002 22.93 45-49 20.49 28.355000000000004 27.595 23.56 50-54 19.91 28.555000000000003 28.050000000000004 23.485 55-59 20.53 29.165000000000003 27.265 23.04 60-64 20.04 28.305000000000003 27.544999999999998 24.11 65-69 20.31 28.34 27.255000000000003 24.095 70-74 19.93 28.499999999999996 27.63 23.94 75-79 19.625 28.105000000000004 28.29 23.98 80-84 20.52 28.865000000000002 26.810000000000002 23.805 85-89 20.515 28.725 27.189999999999998 23.57 90-94 20.305 28.64 27.455000000000002 23.599999999999998 95-99 20.044999999999998 28.585 27.544999999999998 23.825 100-104 20.8 29.07 26.740000000000002 23.39 105-109 20.8 28.59 26.889999999999997 23.72 110-114 20.674999999999997 29.060000000000002 26.71 23.555 115-119 20.4 29.330000000000002 26.740000000000002 23.53 120-124 20.125 28.28 27.525 24.07 125-129 20.28 27.965 26.865 24.89 130-134 20.485 28.754999999999995 26.745 24.015 135-139 20.95 27.884999999999998 26.674999999999997 24.490000000000002 140-144 20.794999999999998 28.095 27.26 23.849999999999998 145-149 20.674999999999997 28.415000000000003 26.479999999999997 24.43 150 20.775 27.450000000000003 27.1 24.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 3.0 25 3.5 26 6.5 27 9.5 28 9.0 29 13.0 30 24.5 31 31.0 32 32.0 33 36.5 34 53.5 35 72.5 36 81.5 37 107.0 38 140.0 39 169.0 40 208.0 41 230.0 42 245.0 43 263.5 44 264.0 45 255.5 46 237.0 47 222.5 48 220.0 49 209.5 50 186.0 51 148.5 52 118.5 53 90.0 54 71.5 55 56.0 56 38.5 57 36.0 58 28.5 59 20.0 60 13.0 61 8.5 62 7.0 63 6.5 64 3.5 65 1.5 66 2.5 67 2.5 68 2.5 69 2.5 70 2.0 71 1.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 1.875 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.2625000000000002 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.675 0.0 0.0 0.0 0.0 114-115 1.925 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.4875 0.0 0.0 0.0 0.0 120-121 2.8375 0.0 0.0 0.0 0.0 122-123 3.425 0.0 0.0 0.0 0.0 124-125 3.75 0.0 0.0 0.0 0.0 126-127 4.075 0.0 0.0 0.0 0.0 128-129 4.3125 0.0 0.0 0.0 0.0 130-131 4.6375 0.0 0.0 0.0 0.0 132-133 5.0 0.0 0.0 0.0 0.0 134-135 5.300000000000001 0.0 0.0 0.0 0.0 136-137 5.8125 0.0 0.0 0.0 0.0 138 6.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237662 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237662_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.56125 33.0 33.0 34.0 32.0 34.0 2 32.65425 33.0 33.0 34.0 32.0 34.0 3 31.9345 33.0 33.0 34.0 28.0 34.0 4 32.5065 33.0 33.0 34.0 32.0 34.0 5 32.65325 33.0 33.0 34.0 32.0 34.0 6 36.805 38.0 38.0 38.0 35.0 38.0 7 36.556 38.0 38.0 38.0 34.0 38.0 8 36.82225 38.0 38.0 38.0 36.0 38.0 9 36.70275 38.0 38.0 38.0 35.0 38.0 10-14 36.73365 38.0 38.0 38.0 35.4 38.0 15-19 36.8414 38.0 38.0 38.0 36.0 38.0 20-24 36.203450000000004 38.0 37.6 38.0 32.4 38.0 25-29 36.25405 38.0 37.8 38.0 33.4 38.0 30-34 36.811099999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.806650000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.7053 38.0 38.0 38.0 35.8 38.0 45-49 36.40815 38.0 38.0 38.0 34.8 38.0 50-54 35.57485 38.0 36.0 38.0 30.0 38.0 55-59 36.421499999999995 38.0 37.8 38.0 34.4 38.0 60-64 36.54915 38.0 38.0 38.0 35.4 38.0 65-69 36.1225 38.0 37.8 38.0 32.6 38.0 70-74 35.95815 38.0 37.2 38.0 31.2 38.0 75-79 36.17110000000001 38.0 37.6 38.0 33.4 38.0 80-84 36.45865 38.0 38.0 38.0 35.0 38.0 85-89 36.30575 38.0 38.0 38.0 34.2 38.0 90-94 36.2757 38.0 38.0 38.0 34.0 38.0 95-99 36.25925 38.0 38.0 38.0 34.0 38.0 100-104 36.186449999999994 38.0 38.0 38.0 34.0 38.0 105-109 36.12905 38.0 38.0 38.0 34.0 38.0 110-114 35.95985 38.0 38.0 38.0 33.4 38.0 115-119 34.7204 38.0 35.2 38.0 27.4 38.0 120-124 34.68495 38.0 35.6 38.0 26.0 38.0 125-129 35.41205 38.0 37.2 38.0 31.0 38.0 130-134 35.26475000000001 38.0 37.4 38.0 30.0 38.0 135-139 34.7203 38.0 36.2 38.0 27.4 38.0 140-144 34.69855 38.0 35.8 38.0 28.2 38.0 145-149 34.16195 38.0 36.0 38.0 25.8 38.0 150 28.94825 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 8.0 4 2.0 5 1.0 6 1.0 7 4.0 8 4.0 9 1.0 10 2.0 11 4.0 12 1.0 13 8.0 14 2.0 15 3.0 16 3.0 17 4.0 18 8.0 19 6.0 20 7.0 21 7.0 22 11.0 23 11.0 24 18.0 25 21.0 26 25.0 27 21.0 28 36.0 29 45.0 30 47.0 31 53.0 32 70.0 33 110.0 34 142.0 35 214.0 36 510.0 37 2579.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.150000000000006 20.275000000000002 12.75 26.825 2 27.200000000000003 25.724999999999998 32.45 14.625 3 21.85 28.050000000000004 30.375000000000004 19.725 4 23.849999999999998 35.699999999999996 22.025 18.425 5 23.474999999999998 38.0 22.75 15.775 6 18.725 38.574999999999996 24.925 17.775 7 20.200000000000003 20.275000000000002 39.625 19.900000000000002 8 21.525 25.95 29.2 23.325000000000003 9 22.1 24.8 29.625 23.474999999999998 10-14 23.735 28.67 26.305 21.29 15-19 23.505000000000003 27.950000000000003 27.665 20.880000000000003 20-24 23.135 28.88 26.97 21.015 25-29 23.175 28.205000000000002 27.834999999999997 20.785 30-34 22.86 27.779999999999998 28.425 20.935000000000002 35-39 23.26 27.625 28.275 20.84 40-44 23.87 27.950000000000003 28.21 19.97 45-49 23.494999999999997 27.834999999999997 27.665 21.005 50-54 23.799999999999997 27.375 27.900000000000002 20.925 55-59 24.005000000000003 27.79 27.93 20.275000000000002 60-64 24.235 27.305 27.915 20.544999999999998 65-69 24.104999999999997 27.529999999999998 28.1 20.265 70-74 24.305 27.57 27.625 20.5 75-79 23.76 27.169999999999998 28.605000000000004 20.465 80-84 23.565 27.26 28.46 20.715 85-89 23.94 27.295 28.08 20.685000000000002 90-94 23.665 27.405 28.34 20.59 95-99 24.15 27.650000000000002 28.000000000000004 20.200000000000003 100-104 24.16 27.634999999999998 28.12 20.085 105-109 24.34 27.33 27.905 20.424999999999997 110-114 24.015 27.49 27.925 20.57 115-119 24.51 27.095000000000002 28.095 20.3 120-124 23.71 27.76 28.33 20.200000000000003 125-129 24.93 27.060000000000002 28.15 19.86 130-134 24.845 27.71 27.33 20.115 135-139 23.995 27.74 27.560000000000002 20.705000000000002 140-144 25.2 27.689999999999998 27.095000000000002 20.015 145-149 25.135 27.79 27.51 19.564999999999998 150 25.124999999999996 27.950000000000003 27.500000000000004 19.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 2.5 25 3.5 26 3.5 27 5.0 28 6.5 29 8.0 30 12.0 31 18.0 32 25.0 33 38.5 34 53.5 35 62.0 36 75.0 37 104.5 38 125.0 39 149.5 40 198.5 41 241.5 42 267.0 43 271.0 44 256.5 45 259.0 46 265.5 47 253.5 48 237.5 49 215.5 50 190.5 51 147.5 52 113.5 53 98.0 54 78.0 55 60.5 56 38.5 57 25.5 58 22.5 59 17.5 60 12.0 61 8.5 62 6.0 63 4.5 64 5.0 65 3.5 66 3.0 67 2.5 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.425 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.8625 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.3625 0.0 0.0 0.0 0.0 120-121 2.675 0.0 0.0 0.0 0.0 122-123 3.2125000000000004 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.8 0.0 0.0 0.0 0.0 128-129 4.075 0.0 0.0 0.0 0.0 130-131 4.4125 0.0 0.0 0.0 0.0 132-133 4.762499999999999 0.0 0.0 0.0 0.0 134-135 5.0375 0.0 0.0 0.0 0.0 136-137 5.512499999999999 0.0 0.0 0.0 0.0 138 5.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2413209 spots for SRR4237662.sra Written 2413209 spots for SRR4237662.sra Read 2413209 spots for SRR4237662.sra Written 2413209 spots for SRR4237662.sra Read 2413209 spots for SRR4237662.sra Written 2413209 spots for SRR4237662.sra Read 2413209 spots for SRR4237662.sra Written 2413209 spots for SRR4237662.sra Read 2413209 spots for SRR4237662.sra Written 2413209 spots for SRR4237662.sra Read 2413223 spots for SRR4237662.sra Written 2413223 spots for SRR4237662.sra Read 2413209 spots for SRR4237662.sra Written 2413209 spots for SRR4237662.sra Read 2413209 spots for SRR4237662.sra Written 2413209 spots for SRR4237662.sra Read 2413209 spots for SRR4237662.sra Written 2413209 spots for SRR4237662.sra Read 2413209 spots for SRR4237662.sra Written 2413209 spots for SRR4237662.sra Read 2413209 spots for SRR4237662.sra Written 2413209 spots for SRR4237662.sra Read 2413209 spots for SRR4237662.sra Written 2413209 spots for SRR4237662.sra Read 2413209 spots for SRR4237662.sra Written 2413209 spots for SRR4237662.sra Read 2413209 spots for SRR4237662.sra Written 2413209 spots for SRR4237662.sra Read 2413209 spots for SRR4237662.sra Written 2413209 spots for SRR4237662.sra Read 2413209 spots for SRR4237662.sra Written 2413209 spots for SRR4237662.sra Read 2413209 spots for SRR4237662.sra Written 2413209 spots for SRR4237662.sra Read 2413209 spots for SRR4237662.sra Written 2413209 spots for SRR4237662.sra Read 2413209 spots for SRR4237662.sra Written 2413209 spots for SRR4237662.sra Read 2413209 spots for SRR4237662.sra Written 2413209 spots for SRR4237662.sra SRR ids: ['SRR4237662.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2_yjlxvz SRR4237662.sra spots: 48264194 blocks: [[1, 2413209], [2413210, 4826418], [4826419, 7239627], [7239628, 9652836], [9652837, 12066045], [12066046, 14479254], [14479255, 16892463], [16892464, 19305672], [19305673, 21718881], [21718882, 24132090], [24132091, 26545299], [26545300, 28958508], [28958509, 31371717], [31371718, 33784926], [33784927, 36198135], [36198136, 38611344], [38611345, 41024553], [41024554, 43437762], [43437763, 45850971], [45850972, 48264194]] SRR4237662 file size 16239185 SRR4237662 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237662 SRR4237662_1.fastq SRR4237662_2.fastq Input file: SRR4237662_1.fastq Paired file: SRR4237662_2.fastq trimmed: SRR4237662-trimmed-pair1.fastq, SRR4237662-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:05:59 2025 >> started Wed Feb 12 22:06:50 2025 >> done (51.144s) 48264194 read pairs processed; of these: 68445 ( 0.14%) short read pairs filtered out after trimming by size control 58317 ( 0.12%) empty read pairs filtered out after trimming by size control 48137432 (99.74%) read pairs available; of these: 16700631 (34.69%) trimmed read pairs available after processing 31436801 (65.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 15 0.00% 20 3 0.00% 21 9 0.00% 22 11 0.00% 23 10 0.00% 24 8 0.00% 25 17 0.00% 26 12 0.00% 27 10 0.00% 28 23 0.00% 29 12 0.00% 30 19 0.00% 31 23 0.00% 32 21 0.00% 33 30 0.00% 34 30 0.00% 35 25 0.00% 36 38 0.00% 37 51 0.00% 38 37 0.00% 39 51 0.00% 40 53 0.00% 41 60 0.00% 42 61 0.00% 43 55 0.00% 44 74 0.00% 45 88 0.00% 46 101 0.00% 47 112 0.00% 48 127 0.00% 49 132 0.00% 50 168 0.00% 51 200 0.00% 52 205 0.00% 53 234 0.00% 54 245 0.00% 55 308 0.00% 56 336 0.00% 57 392 0.00% 58 429 0.00% 59 454 0.00% 60 521 0.00% 61 616 0.00% 62 729 0.00% 63 814 0.00% 64 930 0.00% 65 1046 0.00% 66 1207 0.00% 67 1598 0.00% 68 1999 0.00% 69 3000 0.01% 70 2417 0.01% 71 2138 0.00% 72 2434 0.01% 73 2729 0.01% 74 3064 0.01% 75 3414 0.01% 76 3764 0.01% 77 4135 0.01% 78 4697 0.01% 79 5366 0.01% 80 5821 0.01% 81 6843 0.01% 82 7968 0.02% 83 10182 0.02% 84 30095 0.06% 85 14907 0.03% 86 14889 0.03% 87 16687 0.03% 88 17306 0.04% 89 19078 0.04% 90 21178 0.04% 91 25061 0.05% 92 26229 0.05% 93 25275 0.05% 94 29288 0.06% 95 30364 0.06% 96 33197 0.07% 97 35270 0.07% 98 36447 0.08% 99 37759 0.08% 100 40530 0.08% 101 42268 0.09% 102 45162 0.09% 103 48132 0.10% 104 51178 0.11% 105 54585 0.11% 106 57523 0.12% 107 59895 0.12% 108 63678 0.13% 109 66637 0.14% 110 68484 0.14% 111 71921 0.15% 112 74931 0.16% 113 77942 0.16% 114 81739 0.17% 115 87059 0.18% 116 89183 0.19% 117 92836 0.19% 118 95570 0.20% 119 99870 0.21% 120 101212 0.21% 121 105344 0.22% 122 108510 0.23% 123 113241 0.24% 124 116128 0.24% 125 120932 0.25% 126 125345 0.26% 127 129223 0.27% 128 133035 0.28% 129 137811 0.29% 130 143353 0.30% 131 146938 0.31% 132 151922 0.32% 133 158607 0.33% 134 164217 0.34% 135 171130 0.36% 136 179053 0.37% 137 188086 0.39% 138 198284 0.41% 139 209210 0.43% 140 223056 0.46% 141 240356 0.50% 142 260426 0.54% 143 288970 0.60% 144 331826 0.69% 145 394206 0.82% 146 497259 1.03% 147 701705 1.46% 148 1260680 2.62% 149 7736680 16.07% 150 31436801 65.31% 48137432 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=37 prefix-density=0.25 prefix-fanout=2.1 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=265.81 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=29.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.42 fanout-score-rank=34 prefix-density=0.21 prefix-fanout=2.8 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=403.25 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=21.5 sequence=ACAAGAAGATCAACTGTCTCTCTGCCTGGTTTGTATTCCAAGAAATGGAGAAAGTCCAAAAGCTCTTTTGTGTGGCTCTATTGCTTGCAGTACTAGCCATAGCAAGCAATATTGCGAATGCCCAGAGTACCATATGCAAAATGCCTGTTGCTGGCCTAATGTCATGCAAGCCTTCTGTAACTCCTCCTAACCCTACCGCACCCTCGGCAGACTGCTGCTCGGCACTTTCGCATGCTGACATAAACTGCCTTTGCTCCTACAAAAATTCCAACCTGCTCCCTTCCCTTGGAATCGACCCAAAACTTGCCATGCAGCTCCCTGGCAAGTGCAAGCTTCCTCACCCTGCTAATTGCTAGACTACCGATCGTAATCGATCCAAGGGTTTTCCTCTACATATATGTATCATGTCATAAACGTC SRR4237662 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:07:32 Started mapping on | Feb 12 22:07:32 Finished on | Feb 12 22:11:38 Mapping speed, Million of reads per hour | 704.45 Number of input reads | 48137432 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 46315977 Uniquely mapped reads % | 96.22% Average mapped length | 292.52 Number of splices: Total | 41604935 Number of splices: Annotated (sjdb) | 40901681 Number of splices: GT/AG | 40964674 Number of splices: GC/AG | 499853 Number of splices: AT/AC | 37286 Number of splices: Non-canonical | 103122 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 927096 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 148884 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.49% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 945074 945074 945074 N_multimapping 927096 927096 927096 N_noFeature 1281122 45760656 1564590 N_ambiguous 468739 3466 194102 UnstrandedReadsAssigned:44566116 PositiveStrandReadsAssigned:551855 NegativeStrandReadsAssigned:44557285 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237662 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237662-trimmed-pair1.fastq SRR4237662-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 48,137,432 reads, 44,379,894 reads pseudoaligned [quant] estimated average fragment length: 234.326 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,264 rounds 52401 SRR4237662.ke.tsv 34699 SRR4237662.se.tsv 87100 total ==> SRR4237662.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.67 995 12.6286 Potri.005G024800.1.v4.1 1035 801.674 152 4.29473 Potri.004G059700.1.v4.1 961 727.701 36 1.12057 Potri.007G009000.2.v4.1 1416 1182.67 0 0 Potri.003G141000.2.v4.1 2943 2709.67 826.276 6.90714 Potri.016G087400.1.v4.1 270 82.2291 5328 1467.67 Potri.015G069301.1.v4.1 564 334.406 0 0 Potri.010G195200.1.v4.1 1773 1539.67 104 1.53001 Potri.012G127500.1.v4.1 977 743.69 26014 792.328 ==> SRR4237662.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3537 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 786 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR4237662 completed mapping pipeline successfully