Starting /dee2/code/volunteer_pipeline.sh SRR4237663 current disk space = 3050685550592 free memory = 1035442024 SRR4237663 SRAfilesize d7e8451a33c9469a889b7d7e05ac1370 SRR4237663.sra SRR4237663.sra file validated SRR4237663 is paired end SRR4237663 is conventional basespace SRR4237663 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237663_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.056 34.0 33.0 34.0 32.0 34.0 2 33.143 34.0 33.0 34.0 32.0 34.0 3 33.201 34.0 33.0 34.0 32.0 34.0 4 33.1885 34.0 33.0 34.0 32.0 34.0 5 33.13575 34.0 33.0 34.0 32.0 34.0 6 35.012 38.0 37.0 38.0 31.0 38.0 7 36.69075 38.0 37.0 38.0 33.0 38.0 8 36.905 38.0 38.0 38.0 34.0 38.0 9 37.16075 38.0 38.0 38.0 36.0 38.0 10-14 37.30095 38.0 38.0 38.0 37.0 38.0 15-19 37.16375 38.0 38.0 38.0 36.4 38.0 20-24 37.24035 38.0 38.0 38.0 36.6 38.0 25-29 37.16224999999999 38.0 38.0 38.0 36.6 38.0 30-34 35.5068 37.8 34.8 38.0 28.6 38.0 35-39 36.61845 38.0 37.4 38.0 34.0 38.0 40-44 37.15235 38.0 38.0 38.0 36.2 38.0 45-49 36.1884 38.0 37.0 38.0 31.2 38.0 50-54 37.06835 38.0 38.0 38.0 36.0 38.0 55-59 36.95440000000001 38.0 38.0 38.0 36.0 38.0 60-64 36.987750000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.9325 38.0 38.0 38.0 35.8 38.0 70-74 36.693599999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.91735 38.0 38.0 38.0 35.8 38.0 80-84 36.84739999999999 38.0 38.0 38.0 35.4 38.0 85-89 35.57275 37.6 35.6 38.0 31.0 38.0 90-94 35.835950000000004 37.8 36.4 38.0 31.2 38.0 95-99 35.64399999999999 38.0 36.2 38.0 29.4 38.0 100-104 36.37095 38.0 37.8 38.0 33.8 38.0 105-109 35.85375 38.0 37.0 38.0 30.2 38.0 110-114 34.977 38.0 34.8 38.0 27.0 38.0 115-119 36.2186 38.0 37.8 38.0 33.6 38.0 120-124 34.266650000000006 37.6 32.8 38.0 26.2 38.0 125-129 36.0058 38.0 37.4 38.0 32.8 38.0 130-134 35.96685 38.0 37.4 38.0 33.0 38.0 135-139 35.82455 38.0 37.2 38.0 33.0 38.0 140-144 35.47805 38.0 36.2 38.0 31.4 38.0 145-149 34.10385 38.0 35.2 38.0 24.0 38.0 150 29.23525 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 0.0 18 1.0 19 2.0 20 8.0 21 6.0 22 3.0 23 3.0 24 13.0 25 13.0 26 18.0 27 34.0 28 31.0 29 52.0 30 61.0 31 67.0 32 90.0 33 121.0 34 198.0 35 275.0 36 787.0 37 2214.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.82352941176471 11.088861076345431 9.486858573216521 40.60075093867334 2 22.375 15.15 36.75 25.724999999999998 3 21.175 18.85 25.074999999999996 34.9 4 23.75 29.299999999999997 21.175 25.775 5 23.325000000000003 32.1 24.4 20.175 6 18.91607471717969 35.25388055774796 25.25651144435675 20.5735332807156 7 13.750000000000002 26.3 41.0 18.95 8 16.950000000000003 26.125 31.574999999999996 25.35 9 17.025000000000002 22.95 34.825 25.2 10-14 18.845 30.245 27.235 23.674999999999997 15-19 19.875 28.64 28.02 23.465 20-24 19.5 29.065 28.005000000000003 23.43 25-29 19.900000000000002 29.425 27.224999999999998 23.45 30-34 19.255 29.544999999999998 27.389999999999997 23.810000000000002 35-39 19.830000000000002 28.955 27.73 23.485 40-44 20.064999999999998 28.835 27.58 23.52 45-49 19.665 29.645 26.895000000000003 23.794999999999998 50-54 20.32 29.065 27.41 23.205000000000002 55-59 20.585 28.53 27.38 23.505000000000003 60-64 20.18 28.199999999999996 27.68 23.94 65-69 20.025000000000002 28.51 27.88 23.585 70-74 19.82 29.054999999999996 27.71 23.415 75-79 19.875 28.71 27.99 23.425 80-84 19.759999999999998 29.165000000000003 27.095000000000002 23.98 85-89 19.85 28.705000000000002 27.325 24.12 90-94 21.015 28.325 26.91 23.75 95-99 19.945 28.98 27.389999999999997 23.685000000000002 100-104 20.505000000000003 28.645 27.43 23.419999999999998 105-109 20.605 28.194999999999997 27.389999999999997 23.810000000000002 110-114 20.4 28.665000000000003 27.134999999999998 23.799999999999997 115-119 20.075000000000003 28.935 27.71 23.28 120-124 20.075000000000003 28.93 27.175 23.82 125-129 20.745 28.694999999999997 27.1 23.46 130-134 20.555 28.599999999999998 27.3 23.544999999999998 135-139 20.95 28.9 26.540000000000003 23.61 140-144 19.98 28.134999999999998 27.555000000000003 24.33 145-149 20.44 28.715000000000003 26.584999999999997 24.26 150 21.255313828457115 27.981995498874717 25.756439109777446 25.006251562890725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.5 25 4.0 26 5.0 27 4.0 28 12.0 29 17.5 30 19.5 31 30.5 32 34.0 33 40.0 34 52.5 35 70.0 36 90.0 37 105.5 38 130.5 39 155.5 40 201.5 41 239.0 42 239.0 43 251.5 44 272.0 45 290.0 46 282.0 47 264.0 48 244.0 49 205.0 50 170.5 51 129.5 52 99.5 53 79.0 54 63.5 55 50.5 56 36.0 57 29.5 58 21.0 59 14.5 60 11.0 61 8.5 62 6.0 63 5.0 64 4.5 65 3.5 66 2.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 4.9750000000000005 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.7875000000000001 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 1.075 0.0 0.0 0.0 0.0 118-119 1.2375 0.0 0.0 0.0 0.0 120-121 1.475 0.0 0.0 0.0 0.0 122-123 1.7125 0.0 0.0 0.0 0.0 124-125 1.925 0.0 0.0 0.0 0.0 126-127 2.1375 0.0 0.0 0.0 0.0 128-129 2.2750000000000004 0.0 0.0 0.0 0.0 130-131 2.5125 0.0 0.0 0.0 0.0 132-133 2.7750000000000004 0.0 0.0 0.0 0.0 134-135 3.125 0.0 0.0 0.0 0.0 136-137 3.55 0.0 0.0 0.0 0.0 138 3.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCTT 10 0.0070063258 143.775 9 >>END_MODULE SRR4237663 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237663_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3405 33.0 32.0 34.0 25.0 34.0 2 32.2305 33.0 33.0 34.0 28.0 34.0 3 32.41325 33.0 33.0 34.0 31.0 34.0 4 32.35725 33.0 33.0 34.0 31.0 34.0 5 32.51875 33.0 33.0 34.0 31.0 34.0 6 33.55075 38.0 34.0 38.0 16.0 38.0 7 35.89175 38.0 37.0 38.0 30.0 38.0 8 36.30425 38.0 38.0 38.0 33.0 38.0 9 36.2415 38.0 38.0 38.0 33.0 38.0 10-14 36.597 38.0 38.0 38.0 34.4 38.0 15-19 36.6493 38.0 38.0 38.0 35.0 38.0 20-24 36.631550000000004 38.0 38.0 38.0 34.8 38.0 25-29 36.5741 38.0 38.0 38.0 34.8 38.0 30-34 36.468999999999994 38.0 38.0 38.0 34.4 38.0 35-39 36.51295 38.0 38.0 38.0 34.2 38.0 40-44 36.45399999999999 38.0 38.0 38.0 34.0 38.0 45-49 36.43425 38.0 38.0 38.0 34.2 38.0 50-54 36.42815 38.0 38.0 38.0 34.2 38.0 55-59 36.40025000000001 38.0 38.0 38.0 34.0 38.0 60-64 35.82000000000001 38.0 37.2 38.0 29.2 38.0 65-69 36.3639 38.0 38.0 38.0 34.0 38.0 70-74 36.3582 38.0 38.0 38.0 34.0 38.0 75-79 36.267700000000005 38.0 38.0 38.0 34.0 38.0 80-84 35.475049999999996 38.0 37.2 38.0 27.6 38.0 85-89 36.09925 38.0 37.8 38.0 33.0 38.0 90-94 35.948899999999995 38.0 37.8 38.0 32.6 38.0 95-99 35.824200000000005 38.0 37.4 38.0 31.6 38.0 100-104 35.89785 38.0 38.0 38.0 32.8 38.0 105-109 35.761799999999994 38.0 38.0 38.0 31.4 38.0 110-114 35.5654 38.0 37.4 38.0 30.4 38.0 115-119 35.3224 38.0 37.0 38.0 29.0 38.0 120-124 33.68125 37.6 32.8 38.0 23.6 38.0 125-129 35.063849999999995 38.0 36.6 38.0 28.2 38.0 130-134 34.98905 38.0 36.2 38.0 28.0 38.0 135-139 34.829699999999995 38.0 36.0 38.0 27.6 38.0 140-144 34.6622 38.0 36.0 38.0 27.0 38.0 145-149 34.005100000000006 38.0 35.8 38.0 23.4 38.0 150 27.38175 33.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 3.0 5 3.0 6 1.0 7 3.0 8 0.0 9 2.0 10 2.0 11 3.0 12 4.0 13 0.0 14 1.0 15 3.0 16 8.0 17 8.0 18 9.0 19 9.0 20 10.0 21 8.0 22 15.0 23 22.0 24 19.0 25 36.0 26 32.0 27 29.0 28 56.0 29 50.0 30 63.0 31 63.0 32 75.0 33 120.0 34 126.0 35 227.0 36 523.0 37 2460.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.05 18.224999999999998 15.299999999999999 28.425 2 26.924999999999997 24.6 33.575 14.899999999999999 3 20.825 30.349999999999998 29.175 19.650000000000002 4 24.275 34.475 23.075000000000003 18.175 5 25.575 36.25 21.825 16.35 6 19.675 38.975 24.3 17.05 7 20.349999999999998 20.3 40.300000000000004 19.05 8 22.25 25.3 27.775 24.675 9 22.2 24.625 30.825000000000003 22.35 10-14 23.25 28.999999999999996 27.045 20.705000000000002 15-19 23.195 28.005000000000003 27.99 20.810000000000002 20-24 22.689999999999998 27.6 28.685 21.025 25-29 23.61 28.025 27.750000000000004 20.615 30-34 23.49 28.060000000000002 28.365000000000002 20.085 35-39 23.24 27.88 28.125 20.755000000000003 40-44 23.125 27.765 28.43 20.68 45-49 22.985 27.62 28.63 20.765 50-54 23.375 27.55 28.285 20.79 55-59 23.62 27.505000000000003 28.575 20.3 60-64 23.61 28.095 28.17 20.125 65-69 23.474999999999998 27.715 28.139999999999997 20.669999999999998 70-74 23.645 28.294999999999998 27.894999999999996 20.165 75-79 23.715 28.03 28.255000000000003 20.0 80-84 23.435 28.535 27.589999999999996 20.44 85-89 23.765 27.589999999999996 28.165000000000003 20.48 90-94 23.419999999999998 27.605 28.799999999999997 20.175 95-99 23.585 27.825 28.095 20.495 100-104 23.615 27.925 28.42 20.04 105-109 23.93 27.689999999999998 28.395 19.985 110-114 23.705000000000002 27.495000000000005 28.62 20.18 115-119 23.64 27.700000000000003 28.110000000000003 20.549999999999997 120-124 23.64 28.01 28.175 20.175 125-129 24.945 27.544999999999998 27.74 19.77 130-134 24.345 27.495000000000005 28.105000000000004 20.055 135-139 24.72 27.445000000000004 27.884999999999998 19.950000000000003 140-144 24.205 28.32 27.465 20.01 145-149 24.490000000000002 28.165000000000003 27.305 20.04 150 24.125 27.400000000000002 28.4 20.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 2.5 22 2.0 23 0.5 24 0.0 25 1.5 26 4.5 27 9.5 28 11.0 29 8.5 30 15.5 31 23.0 32 20.5 33 25.0 34 52.0 35 73.5 36 82.0 37 109.5 38 136.5 39 171.5 40 203.5 41 227.5 42 259.5 43 291.5 44 283.0 45 266.5 46 277.5 47 269.5 48 244.0 49 192.0 50 147.5 51 132.0 52 114.0 53 94.5 54 65.0 55 39.5 56 36.0 57 31.5 58 26.0 59 16.0 60 6.5 61 4.5 62 4.5 63 3.5 64 4.0 65 3.0 66 1.0 67 0.5 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.725 0.0 0.0 0.0 0.0 112-113 0.8374999999999999 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.2 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.675 0.0 0.0 0.0 0.0 122-123 1.9125 0.0 0.0 0.0 0.0 124-125 2.125 0.0 0.0 0.0 0.0 126-127 2.3375000000000004 0.0 0.0 0.0 0.0 128-129 2.4625 0.0 0.0 0.0 0.0 130-131 2.6875 0.0 0.0 0.0 0.0 132-133 2.975 0.0 0.0 0.0 0.0 134-135 3.35 0.0 0.0 0.0 0.0 136-137 3.775 0.0 0.0 0.0 0.0 138 4.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTAGG 20 0.006139246 28.8 135-139 >>END_MODULE Read 2914164 spots for SRR4237663.sra Written 2914164 spots for SRR4237663.sra Read 2914164 spots for SRR4237663.sra Written 2914164 spots for SRR4237663.sra Read 2914164 spots for SRR4237663.sra Written 2914164 spots for SRR4237663.sra Read 2914166 spots for SRR4237663.sra Written 2914166 spots for SRR4237663.sra Read 2914164 spots for SRR4237663.sra Written 2914164 spots for SRR4237663.sra Read 2914164 spots for SRR4237663.sra Written 2914164 spots for SRR4237663.sra Read 2914164 spots for SRR4237663.sra Written 2914164 spots for SRR4237663.sra Read 2914164 spots for SRR4237663.sra Written 2914164 spots for SRR4237663.sra Read 2914164 spots for SRR4237663.sra Written 2914164 spots for SRR4237663.sra Read 2914164 spots for SRR4237663.sra Written 2914164 spots for SRR4237663.sra Read 2914164 spots for SRR4237663.sra Written 2914164 spots for SRR4237663.sra Read 2914164 spots for SRR4237663.sra Written 2914164 spots for SRR4237663.sra Read 2914164 spots for SRR4237663.sra Written 2914164 spots for SRR4237663.sra Read 2914164 spots for SRR4237663.sra Written 2914164 spots for SRR4237663.sra Read 2914164 spots for SRR4237663.sra Written 2914164 spots for SRR4237663.sra Read 2914164 spots for SRR4237663.sra Written 2914164 spots for SRR4237663.sra Read 2914164 spots for SRR4237663.sra Written 2914164 spots for SRR4237663.sra Read 2914164 spots for SRR4237663.sra Written 2914164 spots for SRR4237663.sra Read 2914164 spots for SRR4237663.sra Written 2914164 spots for SRR4237663.sra Read 2914164 spots for SRR4237663.sra Written 2914164 spots for SRR4237663.sra SRR ids: ['SRR4237663.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iun8o5iy SRR4237663.sra spots: 58283282 blocks: [[1, 2914164], [2914165, 5828328], [5828329, 8742492], [8742493, 11656656], [11656657, 14570820], [14570821, 17484984], [17484985, 20399148], [20399149, 23313312], [23313313, 26227476], [26227477, 29141640], [29141641, 32055804], [32055805, 34969968], [34969969, 37884132], [37884133, 40798296], [40798297, 43712460], [43712461, 46626624], [46626625, 49540788], [49540789, 52454952], [52454953, 55369116], [55369117, 58283282]] SRR4237663 file size 19614756 SRR4237663 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237663 SRR4237663_1.fastq SRR4237663_2.fastq Input file: SRR4237663_1.fastq Paired file: SRR4237663_2.fastq trimmed: SRR4237663-trimmed-pair1.fastq, SRR4237663-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:47:52 2025 >> started Wed Feb 12 21:49:03 2025 >> done (70.724s) 58283282 read pairs processed; of these: 88469 ( 0.15%) short read pairs filtered out after trimming by size control 33753 ( 0.06%) empty read pairs filtered out after trimming by size control 58161060 (99.79%) read pairs available; of these: 18696650 (32.15%) trimmed read pairs available after processing 39464410 (67.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 5 0.00% 21 3 0.00% 22 7 0.00% 23 13 0.00% 24 7 0.00% 25 6 0.00% 26 16 0.00% 27 18 0.00% 28 15 0.00% 29 15 0.00% 30 21 0.00% 31 15 0.00% 32 19 0.00% 33 29 0.00% 34 23 0.00% 35 25 0.00% 36 42 0.00% 37 29 0.00% 38 41 0.00% 39 40 0.00% 40 48 0.00% 41 56 0.00% 42 63 0.00% 43 54 0.00% 44 77 0.00% 45 86 0.00% 46 71 0.00% 47 98 0.00% 48 98 0.00% 49 135 0.00% 50 144 0.00% 51 150 0.00% 52 162 0.00% 53 188 0.00% 54 203 0.00% 55 241 0.00% 56 282 0.00% 57 312 0.00% 58 324 0.00% 59 377 0.00% 60 390 0.00% 61 488 0.00% 62 447 0.00% 63 585 0.00% 64 620 0.00% 65 722 0.00% 66 846 0.00% 67 960 0.00% 68 1384 0.00% 69 4476 0.01% 70 4527 0.01% 71 2039 0.00% 72 1802 0.00% 73 1841 0.00% 74 2047 0.00% 75 2285 0.00% 76 2588 0.00% 77 2811 0.00% 78 3191 0.01% 79 3551 0.01% 80 4053 0.01% 81 4680 0.01% 82 5465 0.01% 83 7410 0.01% 84 29581 0.05% 85 11298 0.02% 86 14300 0.02% 87 14204 0.02% 88 13818 0.02% 89 14723 0.03% 90 19179 0.03% 91 23006 0.04% 92 17977 0.03% 93 22464 0.04% 94 19273 0.03% 95 21384 0.04% 96 23150 0.04% 97 23385 0.04% 98 24901 0.04% 99 28390 0.05% 100 27751 0.05% 101 29008 0.05% 102 30475 0.05% 103 32830 0.06% 104 35053 0.06% 105 36994 0.06% 106 39816 0.07% 107 43191 0.07% 108 44800 0.08% 109 47360 0.08% 110 48545 0.08% 111 51513 0.09% 112 53635 0.09% 113 56291 0.10% 114 59711 0.10% 115 63744 0.11% 116 67545 0.12% 117 70199 0.12% 118 74014 0.13% 119 79646 0.14% 120 79577 0.14% 121 83434 0.14% 122 88179 0.15% 123 90661 0.16% 124 95381 0.16% 125 100287 0.17% 126 105503 0.18% 127 111268 0.19% 128 116426 0.20% 129 123620 0.21% 130 129923 0.22% 131 135746 0.23% 132 141755 0.24% 133 150661 0.26% 134 157587 0.27% 135 168392 0.29% 136 180094 0.31% 137 192510 0.33% 138 207315 0.36% 139 224438 0.39% 140 242766 0.42% 141 266996 0.46% 142 298340 0.51% 143 336747 0.58% 144 398314 0.68% 145 481623 0.83% 146 624297 1.07% 147 887921 1.53% 148 1629416 2.80% 149 9471539 16.29% 150 39464410 67.85% 58161060 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=36 prefix-density=0.15 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=379.81 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=19.0 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=30 prefix-density=0.24 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=291.67 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=31.5 sequence=AAGAAGAAGAAA SRR4237663 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:49:53 Started mapping on | Feb 12 21:49:53 Finished on | Feb 12 21:56:01 Mapping speed, Million of reads per hour | 568.97 Number of input reads | 58161060 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 56035213 Uniquely mapped reads % | 96.34% Average mapped length | 294.50 Number of splices: Total | 52108763 Number of splices: Annotated (sjdb) | 51254363 Number of splices: GT/AG | 51333407 Number of splices: GC/AG | 614360 Number of splices: AT/AC | 48772 Number of splices: Non-canonical | 112224 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1115812 % of reads mapped to multiple loci | 1.92% Number of reads mapped to too many loci | 68678 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.59% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1075888 1075888 1075888 N_multimapping 1115812 1115812 1115812 N_noFeature 1465865 55415992 1805183 N_ambiguous 517343 3019 235342 UnstrandedReadsAssigned:54052005 PositiveStrandReadsAssigned:616202 NegativeStrandReadsAssigned:53994688 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237663 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237663-trimmed-pair1.fastq SRR4237663-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 58,161,060 reads, 53,573,781 reads pseudoaligned [quant] estimated average fragment length: 247.068 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52401 SRR4237663.ke.tsv 34699 SRR4237663.se.tsv 87100 total ==> SRR4237663.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.93 1503 16.4722 Potri.005G024800.1.v4.1 1035 788.932 141 3.47071 Potri.004G059700.1.v4.1 961 714.969 37 1.00497 Potri.007G009000.2.v4.1 1416 1169.93 0 0 Potri.003G141000.2.v4.1 2943 2696.93 822.179 5.92019 Potri.016G087400.1.v4.1 270 74.2986 6822.62 1783.24 Potri.015G069301.1.v4.1 564 322.564 0 0 Potri.010G195200.1.v4.1 1773 1526.93 105 1.33539 Potri.012G127500.1.v4.1 977 730.948 17923 476.172 ==> SRR4237663.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5729 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 845 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 38 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 7 SRR4237663 completed mapping pipeline successfully