Starting /dee2/code/volunteer_pipeline.sh SRR4237664 current disk space = 3050526973952 free memory = 1475290372 SRR4237664 SRAfilesize 7f6f82fccb544c0a91a85fe75eb1739d SRR4237664.sra SRR4237664.sra file validated SRR4237664 is paired end SRR4237664 is conventional basespace SRR4237664 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237664_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.12225 34.0 33.0 34.0 32.0 34.0 2 33.1945 34.0 33.0 34.0 32.0 34.0 3 33.262 34.0 33.0 34.0 32.0 34.0 4 33.1995 34.0 33.0 34.0 32.0 34.0 5 33.13725 34.0 33.0 34.0 32.0 34.0 6 35.4715 38.0 37.0 38.0 33.0 38.0 7 36.86825 38.0 38.0 38.0 34.0 38.0 8 37.09025 38.0 38.0 38.0 35.0 38.0 9 37.21675 38.0 38.0 38.0 36.0 38.0 10-14 37.34045 38.0 38.0 38.0 37.0 38.0 15-19 37.223349999999996 38.0 38.0 38.0 36.6 38.0 20-24 37.198699999999995 38.0 38.0 38.0 36.6 38.0 25-29 37.213849999999994 38.0 38.0 38.0 37.0 38.0 30-34 35.68835 38.0 35.6 38.0 28.4 38.0 35-39 36.65345 38.0 37.4 38.0 34.0 38.0 40-44 37.18655 38.0 38.0 38.0 36.8 38.0 45-49 36.30975 38.0 37.0 38.0 31.2 38.0 50-54 37.11665 38.0 38.0 38.0 36.0 38.0 55-59 37.04645000000001 38.0 38.0 38.0 36.0 38.0 60-64 37.04260000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.957800000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.763149999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.9181 38.0 38.0 38.0 35.8 38.0 80-84 36.8006 38.0 38.0 38.0 35.2 38.0 85-89 35.54875 37.8 35.8 38.0 30.6 38.0 90-94 35.79515 37.8 36.0 38.0 31.2 38.0 95-99 35.66775 38.0 36.2 38.0 29.6 38.0 100-104 36.4193 38.0 37.8 38.0 33.8 38.0 105-109 35.862 38.0 37.2 38.0 30.2 38.0 110-114 35.04605 38.0 35.0 38.0 27.2 38.0 115-119 36.2451 38.0 38.0 38.0 33.8 38.0 120-124 34.529250000000005 37.8 33.4 38.0 27.0 38.0 125-129 36.01125 38.0 37.6 38.0 33.2 38.0 130-134 35.956149999999994 38.0 37.8 38.0 33.0 38.0 135-139 35.851600000000005 38.0 37.6 38.0 33.0 38.0 140-144 35.45765 38.0 36.2 38.0 31.4 38.0 145-149 34.097049999999996 38.0 35.2 38.0 24.0 38.0 150 29.358 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.0 18 7.0 19 4.0 20 3.0 21 6.0 22 7.0 23 4.0 24 5.0 25 14.0 26 21.0 27 21.0 28 29.0 29 32.0 30 69.0 31 64.0 32 81.0 33 139.0 34 166.0 35 296.0 36 752.0 37 2273.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.05354015511634 12.259194395796849 8.581436077057793 41.10582937202902 2 22.175 15.825 36.55 25.45 3 19.725 18.95 26.424999999999997 34.9 4 23.225 29.225 22.525000000000002 25.025 5 22.275 34.65 23.05 20.025000000000002 6 17.746113989637305 37.33160621761658 24.689119170984455 20.23316062176166 7 13.8 28.575 39.925 17.7 8 15.8 26.125 32.125 25.95 9 16.275000000000002 24.775 35.05 23.9 10-14 19.305 31.330000000000002 27.139999999999997 22.225 15-19 19.595000000000002 29.985 27.495000000000005 22.925 20-24 19.580000000000002 29.17 27.284999999999997 23.965 25-29 19.72 29.79 27.689999999999998 22.8 30-34 19.759999999999998 30.17 26.939999999999998 23.13 35-39 19.634999999999998 29.865000000000002 27.205000000000002 23.294999999999998 40-44 19.59 30.09 27.27 23.05 45-49 19.73 30.025000000000002 26.97 23.275000000000002 50-54 19.42 29.79 27.175 23.615 55-59 19.335 30.11 27.150000000000002 23.405 60-64 20.0 29.59 26.85 23.56 65-69 19.46 30.225 26.945000000000004 23.369999999999997 70-74 19.675 29.37 27.365000000000002 23.59 75-79 19.885 29.555 26.840000000000003 23.72 80-84 20.03 29.38 27.139999999999997 23.45 85-89 19.705000000000002 29.854999999999997 27.045 23.395 90-94 19.57 29.705 26.740000000000002 23.985 95-99 19.675 28.93 27.76 23.635 100-104 19.895 29.48 26.779999999999998 23.845 105-109 20.27 29.630000000000003 26.435 23.665 110-114 20.025000000000002 29.14 27.22 23.615 115-119 20.705000000000002 29.865000000000002 26.115 23.315 120-124 20.905 29.485 26.200000000000003 23.41 125-129 20.93 29.28 26.055 23.735 130-134 20.815 30.15 25.405 23.630000000000003 135-139 20.555 29.725 25.645 24.075 140-144 20.65 29.609999999999996 25.624999999999996 24.115000000000002 145-149 20.996049802490123 29.396469823491174 25.54127706385319 24.066203310165506 150 20.280070017504375 30.43260815203801 25.6064016004001 23.680920230057513 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 1.5 21 2.0 22 1.5 23 3.0 24 4.0 25 2.5 26 5.5 27 12.0 28 15.0 29 21.0 30 35.5 31 39.5 32 39.5 33 58.5 34 87.5 35 98.5 36 108.0 37 122.5 38 134.5 39 173.5 40 203.5 41 218.5 42 238.5 43 233.0 44 241.0 45 256.0 46 263.5 47 244.5 48 195.5 49 166.0 50 164.5 51 146.5 52 105.0 53 90.0 54 70.5 55 50.5 56 41.5 57 29.5 58 19.5 59 14.5 60 11.5 61 6.5 62 4.5 63 6.0 64 4.5 65 2.0 66 1.0 67 0.5 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 3.5000000000000004 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.6625000000000001 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.9875 0.0 0.0 0.0 0.0 94-95 1.3 0.0 0.0 0.0 0.0 96-97 1.4625 0.0 0.0 0.0 0.0 98-99 1.7625000000000002 0.0 0.0 0.0 0.0 100-101 2.175 0.0 0.0 0.0 0.0 102-103 2.525 0.0 0.0 0.0 0.0 104-105 2.9749999999999996 0.0 0.0 0.0 0.0 106-107 3.3 0.0 0.0 0.0 0.0 108-109 3.8125 0.0 0.0 0.0 0.0 110-111 4.3125 0.0 0.0 0.0 0.0 112-113 4.7875 0.0 0.0 0.0 0.0 114-115 5.275 0.0 0.0 0.0 0.0 116-117 5.9 0.0 0.0 0.0 0.0 118-119 6.6625 0.0 0.0 0.0 0.0 120-121 7.2625 0.0 0.0 0.0 0.0 122-123 8.2 0.0 0.0 0.0 0.0 124-125 9.05 0.0 0.0 0.0 0.0 126-127 9.912500000000001 0.0 0.0 0.0 0.0 128-129 10.9125 0.0 0.0 0.0 0.0 130-131 11.6 0.0 0.0 0.0 0.0 132-133 12.337499999999999 0.0 0.0 0.0 0.0 134-135 13.212499999999999 0.0 0.0 0.0 0.0 136-137 14.337499999999999 0.0 0.0 0.0 0.0 138 15.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTTCC 10 0.0062404233 149.37663 5 TTTCCAC 10 0.0070063258 143.775 7 ATACCAA 10 0.0070063258 143.775 8 >>END_MODULE SRR4237664 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237664_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.496 33.0 32.0 34.0 25.0 34.0 2 32.4335 33.0 33.0 34.0 31.0 34.0 3 32.54625 33.0 33.0 34.0 31.0 34.0 4 32.575 33.0 33.0 34.0 32.0 34.0 5 32.69325 33.0 33.0 34.0 32.0 34.0 6 33.9715 38.0 34.0 38.0 16.0 38.0 7 36.2365 38.0 37.0 38.0 31.0 38.0 8 36.57875 38.0 38.0 38.0 34.0 38.0 9 36.47275 38.0 38.0 38.0 34.0 38.0 10-14 36.8565 38.0 38.0 38.0 35.6 38.0 15-19 36.951800000000006 38.0 38.0 38.0 36.0 38.0 20-24 36.9306 38.0 38.0 38.0 36.0 38.0 25-29 36.875899999999994 38.0 38.0 38.0 36.0 38.0 30-34 36.7367 38.0 38.0 38.0 35.2 38.0 35-39 36.830999999999996 38.0 38.0 38.0 35.8 38.0 40-44 36.76475 38.0 38.0 38.0 35.8 38.0 45-49 36.761250000000004 38.0 38.0 38.0 35.6 38.0 50-54 36.68015 38.0 38.0 38.0 35.2 38.0 55-59 36.7265 38.0 38.0 38.0 35.4 38.0 60-64 36.21235 38.0 37.6 38.0 32.2 38.0 65-69 36.6423 38.0 38.0 38.0 35.0 38.0 70-74 36.58454999999999 38.0 38.0 38.0 35.0 38.0 75-79 36.5673 38.0 38.0 38.0 34.8 38.0 80-84 35.7527 38.0 37.4 38.0 30.6 38.0 85-89 36.22205 38.0 37.8 38.0 33.4 38.0 90-94 36.14735 38.0 37.8 38.0 32.6 38.0 95-99 36.0378 38.0 37.6 38.0 32.6 38.0 100-104 36.133849999999995 38.0 38.0 38.0 33.8 38.0 105-109 36.0974 38.0 38.0 38.0 33.6 38.0 110-114 35.9598 38.0 37.8 38.0 32.6 38.0 115-119 35.69825 38.0 37.2 38.0 31.2 38.0 120-124 33.9981 37.8 33.4 38.0 24.6 38.0 125-129 35.37375 38.0 37.0 38.0 30.6 38.0 130-134 35.30255 38.0 36.6 38.0 30.2 38.0 135-139 35.09505 38.0 36.0 38.0 30.0 38.0 140-144 34.7869 38.0 36.0 38.0 28.2 38.0 145-149 34.2159 38.0 36.0 38.0 26.4 38.0 150 27.896 33.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 2.0 5 1.0 6 3.0 7 3.0 8 0.0 9 0.0 10 1.0 11 4.0 12 0.0 13 3.0 14 2.0 15 3.0 16 4.0 17 4.0 18 2.0 19 7.0 20 10.0 21 10.0 22 11.0 23 12.0 24 22.0 25 18.0 26 32.0 27 23.0 28 35.0 29 41.0 30 45.0 31 71.0 32 100.0 33 115.0 34 137.0 35 229.0 36 464.0 37 2579.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.525 21.4 12.975 28.1 2 28.299999999999997 24.725 32.45 14.524999999999999 3 20.849999999999998 27.900000000000002 31.25 20.0 4 24.975 33.925 23.25 17.849999999999998 5 25.224999999999998 36.525 22.5 15.75 6 20.474999999999998 38.925 25.0 15.6 7 20.875 20.1 40.25 18.775 8 22.35 23.400000000000002 30.7 23.549999999999997 9 22.75 24.474999999999998 31.125000000000004 21.65 10-14 23.865 28.110000000000003 27.389999999999997 20.635 15-19 23.755000000000003 27.900000000000002 28.410000000000004 19.935 20-24 23.44 28.08 28.205000000000002 20.275000000000002 25-29 23.255 28.165000000000003 28.32 20.26 30-34 23.51 27.389999999999997 29.015 20.085 35-39 23.405 27.615000000000002 28.7 20.28 40-44 23.565 27.705000000000002 28.12 20.61 45-49 23.115 27.105 29.270000000000003 20.51 50-54 23.294999999999998 27.255000000000003 29.195 20.255000000000003 55-59 23.575 27.589999999999996 28.645 20.19 60-64 23.02 27.21 29.535 20.235 65-69 23.335 27.894999999999996 29.104999999999997 19.665 70-74 24.005000000000003 27.365000000000002 28.7 19.93 75-79 23.544999999999998 27.224999999999998 29.044999999999998 20.185 80-84 24.09 27.155 28.904999999999998 19.85 85-89 24.01 28.035 28.105000000000004 19.85 90-94 23.425 27.415 29.654999999999998 19.505 95-99 23.705000000000002 27.694999999999997 28.67 19.93 100-104 23.76 27.474999999999998 29.054999999999996 19.71 105-109 24.099999999999998 27.33 28.689999999999998 19.88 110-114 24.04 27.525 28.87 19.564999999999998 115-119 24.515 27.755000000000003 28.144999999999996 19.585 120-124 25.019999999999996 27.37 28.000000000000004 19.61 125-129 25.629999999999995 27.689999999999998 27.35 19.33 130-134 25.845000000000002 27.584999999999997 27.655 18.915000000000003 135-139 26.064999999999998 27.675 27.55 18.709999999999997 140-144 26.66 27.575 27.205000000000002 18.56 145-149 26.305 27.54 27.04 19.115 150 25.874999999999996 27.650000000000002 27.025 19.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.5 25 4.5 26 5.0 27 6.0 28 10.5 29 18.5 30 22.5 31 24.0 32 35.0 33 50.0 34 59.0 35 70.5 36 101.5 37 128.5 38 139.0 39 156.5 40 184.0 41 218.0 42 240.5 43 274.5 44 293.5 45 276.0 46 265.5 47 243.0 48 228.0 49 205.0 50 166.5 51 134.0 52 108.5 53 93.5 54 70.0 55 45.5 56 34.5 57 25.5 58 18.0 59 12.5 60 4.0 61 2.0 62 3.0 63 5.0 64 4.0 65 3.5 66 2.5 67 0.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.38749999999999996 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 1.025 0.0 0.0 0.0 0.0 94-95 1.3625 0.0 0.0 0.0 0.0 96-97 1.5375 0.0 0.0 0.0 0.0 98-99 1.8 0.0 0.0 0.0 0.0 100-101 2.225 0.0 0.0 0.0 0.0 102-103 2.625 0.0 0.0 0.0 0.0 104-105 3.0875 0.0 0.0 0.0 0.0 106-107 3.4375 0.0 0.0 0.0 0.0 108-109 4.0 0.0 0.0 0.0 0.0 110-111 4.475 0.0 0.0 0.0 0.0 112-113 5.0 0.0 0.0 0.0 0.0 114-115 5.487500000000001 0.0 0.0 0.0 0.0 116-117 6.2 0.0 0.0 0.0 0.0 118-119 6.975 0.0 0.0 0.0 0.0 120-121 7.5875 0.0 0.0 0.0 0.0 122-123 8.55 0.0 0.0 0.0 0.0 124-125 9.4125 0.0 0.0 0.0 0.0 126-127 10.2625 0.0 0.0 0.0 0.0 128-129 11.2375 0.0 0.0 0.0 0.0 130-131 11.925 0.0 0.0 0.0 0.0 132-133 12.6375 0.0 0.0 0.0 0.0 134-135 13.525 0.0 0.0 0.0 0.0 136-137 14.7 0.0 0.0 0.0 0.0 138 15.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2609749 spots for SRR4237664.sra Written 2609749 spots for SRR4237664.sra Read 2609749 spots for SRR4237664.sra Written 2609749 spots for SRR4237664.sra Read 2609749 spots for SRR4237664.sra Written 2609749 spots for SRR4237664.sra Read 2609751 spots for SRR4237664.sra Written 2609751 spots for SRR4237664.sra Read 2609749 spots for SRR4237664.sra Written 2609749 spots for SRR4237664.sra Read 2609749 spots for SRR4237664.sra Written 2609749 spots for SRR4237664.sra Read 2609749 spots for SRR4237664.sra Written 2609749 spots for SRR4237664.sra Read 2609749 spots for SRR4237664.sra Written 2609749 spots for SRR4237664.sra Read 2609749 spots for SRR4237664.sra Written 2609749 spots for SRR4237664.sra Read 2609749 spots for SRR4237664.sra Written 2609749 spots for SRR4237664.sra Read 2609749 spots for SRR4237664.sra Written 2609749 spots for SRR4237664.sra Read 2609749 spots for SRR4237664.sra Written 2609749 spots for SRR4237664.sra Read 2609749 spots for SRR4237664.sra Written 2609749 spots for SRR4237664.sra Read 2609749 spots for SRR4237664.sra Written 2609749 spots for SRR4237664.sra Read 2609749 spots for SRR4237664.sra Written 2609749 spots for SRR4237664.sra Read 2609749 spots for SRR4237664.sra Written 2609749 spots for SRR4237664.sra Read 2609749 spots for SRR4237664.sra Written 2609749 spots for SRR4237664.sra Read 2609749 spots for SRR4237664.sra Written 2609749 spots for SRR4237664.sra Read 2609749 spots for SRR4237664.sra Written 2609749 spots for SRR4237664.sra Read 2609749 spots for SRR4237664.sra Written 2609749 spots for SRR4237664.sra SRR ids: ['SRR4237664.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cci3u5fj SRR4237664.sra spots: 52194982 blocks: [[1, 2609749], [2609750, 5219498], [5219499, 7829247], [7829248, 10438996], [10438997, 13048745], [13048746, 15658494], [15658495, 18268243], [18268244, 20877992], [20877993, 23487741], [23487742, 26097490], [26097491, 28707239], [28707240, 31316988], [31316989, 33926737], [33926738, 36536486], [36536487, 39146235], [39146236, 41755984], [41755985, 44365733], [44365734, 46975482], [46975483, 49585231], [49585232, 52194982]] SRR4237664 file size 17563523 SRR4237664 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237664 SRR4237664_1.fastq SRR4237664_2.fastq Input file: SRR4237664_1.fastq Paired file: SRR4237664_2.fastq trimmed: SRR4237664-trimmed-pair1.fastq, SRR4237664-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:15:55 2025 >> started Wed Feb 12 22:17:00 2025 >> done (64.440s) 52194982 read pairs processed; of these: 71662 ( 0.14%) short read pairs filtered out after trimming by size control 31116 ( 0.06%) empty read pairs filtered out after trimming by size control 52092204 (99.80%) read pairs available; of these: 23132754 (44.41%) trimmed read pairs available after processing 28959450 (55.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 20 0.00% 20 9 0.00% 21 10 0.00% 22 11 0.00% 23 15 0.00% 24 8 0.00% 25 18 0.00% 26 14 0.00% 27 17 0.00% 28 23 0.00% 29 25 0.00% 30 24 0.00% 31 27 0.00% 32 30 0.00% 33 39 0.00% 34 35 0.00% 35 54 0.00% 36 40 0.00% 37 58 0.00% 38 70 0.00% 39 86 0.00% 40 104 0.00% 41 103 0.00% 42 132 0.00% 43 138 0.00% 44 166 0.00% 45 164 0.00% 46 187 0.00% 47 226 0.00% 48 241 0.00% 49 280 0.00% 50 352 0.00% 51 416 0.00% 52 466 0.00% 53 545 0.00% 54 605 0.00% 55 657 0.00% 56 740 0.00% 57 891 0.00% 58 1020 0.00% 59 1162 0.00% 60 1373 0.00% 61 1611 0.00% 62 1773 0.00% 63 2082 0.00% 64 2310 0.00% 65 2664 0.01% 66 3002 0.01% 67 3497 0.01% 68 3844 0.01% 69 5799 0.01% 70 6396 0.01% 71 6251 0.01% 72 6797 0.01% 73 7485 0.01% 74 8777 0.02% 75 9712 0.02% 76 10942 0.02% 77 12109 0.02% 78 13598 0.03% 79 15419 0.03% 80 17078 0.03% 81 19774 0.04% 82 22402 0.04% 83 26068 0.05% 84 44488 0.09% 85 34333 0.07% 86 39274 0.08% 87 41876 0.08% 88 44689 0.09% 89 48323 0.09% 90 55104 0.11% 91 61854 0.12% 92 63070 0.12% 93 70918 0.14% 94 74236 0.14% 95 80866 0.16% 96 87546 0.17% 97 92870 0.18% 98 97700 0.19% 99 105455 0.20% 100 109758 0.21% 101 114997 0.22% 102 123484 0.24% 103 131147 0.25% 104 138526 0.27% 105 147217 0.28% 106 155684 0.30% 107 162556 0.31% 108 167251 0.32% 109 174311 0.33% 110 177475 0.34% 111 183807 0.35% 112 190391 0.37% 113 196529 0.38% 114 206140 0.40% 115 215039 0.41% 116 220881 0.42% 117 227685 0.44% 118 234872 0.45% 119 238523 0.46% 120 240874 0.46% 121 246178 0.47% 122 252003 0.48% 123 254955 0.49% 124 262146 0.50% 125 269728 0.52% 126 275472 0.53% 127 282007 0.54% 128 288293 0.55% 129 292969 0.56% 130 297658 0.57% 131 301800 0.58% 132 305119 0.59% 133 311139 0.60% 134 314535 0.60% 135 322639 0.62% 136 331678 0.64% 137 342403 0.66% 138 352741 0.68% 139 363121 0.70% 140 375191 0.72% 141 389796 0.75% 142 409672 0.79% 143 431504 0.83% 144 471168 0.90% 145 525070 1.01% 146 618694 1.19% 147 805401 1.55% 148 1330805 2.55% 149 7089121 13.61% 150 28959450 55.59% 52092204 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=32 prefix-density=0.19 prefix-fanout=2.5 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=353.80 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=20.9 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=21.82 fanout-score-rank=6 prefix-density=0.38 prefix-fanout=8.6 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCACGGAGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=241.69 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=28.5 sequence=AAGAAGAAGAAA SRR4237664 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:17:48 Started mapping on | Feb 12 22:17:49 Finished on | Feb 12 22:23:59 Mapping speed, Million of reads per hour | 506.84 Number of input reads | 52092204 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 49489336 Uniquely mapped reads % | 95.00% Average mapped length | 285.35 Number of splices: Total | 39332183 Number of splices: Annotated (sjdb) | 38580688 Number of splices: GT/AG | 38709934 Number of splices: GC/AG | 467507 Number of splices: AT/AC | 41795 Number of splices: Non-canonical | 112947 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1022754 % of reads mapped to multiple loci | 1.96% Number of reads mapped to too many loci | 187130 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.61% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1620995 1620995 1620995 N_multimapping 1022754 1022754 1022754 N_noFeature 1593557 48707439 2012430 N_ambiguous 560990 3607 195302 UnstrandedReadsAssigned:47334789 PositiveStrandReadsAssigned:778290 NegativeStrandReadsAssigned:47281604 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=140 echo kmer=135 SRR4237664 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237664-trimmed-pair1.fastq SRR4237664-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 52,092,204 reads, 47,329,520 reads pseudoaligned [quant] estimated average fragment length: 197.93 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 SRR4237664.ke.tsv 34699 SRR4237664.se.tsv 87100 total ==> SRR4237664.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1821.07 946 11.1074 Potri.005G024800.1.v4.1 1035 838.07 182 4.64342 Potri.004G059700.1.v4.1 961 764.103 46 1.28722 Potri.007G009000.2.v4.1 1416 1219.07 0 0 Potri.003G141000.2.v4.1 2943 2746.07 671.1 5.22544 Potri.016G087400.1.v4.1 270 101.24 6790 1434.05 Potri.015G069301.1.v4.1 564 369.044 0 0 Potri.010G195200.1.v4.1 1773 1576.07 211.787 2.87323 Potri.012G127500.1.v4.1 977 780.084 21178 580.484 ==> SRR4237664.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6215 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 1010 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR4237664 completed mapping pipeline successfully