Starting /dee2/code/volunteer_pipeline.sh SRR5423303 current disk space = 3050780127232 free memory = 1519461680 SRR5423303 SRAfilesize 327f5fe062a50d907d4c6d80080ccd29 SRR5423303.sra SRR5423303.sra file validated SRR5423303 is single end SRR5423303 is conventional basespace SRR5423303 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423303_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.33575 33.0 31.0 34.0 2.0 34.0 2 30.375 34.0 31.0 34.0 16.0 34.0 3 31.95225 34.0 31.0 34.0 28.0 34.0 4 35.80975 37.0 35.0 37.0 35.0 37.0 5 35.96675 37.0 35.0 37.0 35.0 37.0 6 35.944 37.0 35.0 37.0 35.0 37.0 7 35.98225 37.0 35.0 37.0 35.0 37.0 8 35.968 37.0 35.0 37.0 35.0 37.0 9 37.7995 39.0 38.0 39.0 35.0 39.0 10 37.70825 39.0 38.0 39.0 35.0 39.0 11 37.82625 39.0 38.0 39.0 35.0 39.0 12 37.779 39.0 38.0 39.0 35.0 39.0 13 37.64925 39.0 37.0 39.0 35.0 39.0 14 39.1525 40.0 39.0 41.0 36.0 41.0 15 39.03225 40.0 38.0 41.0 36.0 41.0 16 38.9555 40.0 38.0 41.0 35.0 41.0 17 38.9405 40.0 38.0 41.0 35.0 41.0 18 39.02525 40.0 38.0 41.0 36.0 41.0 19 38.8905 40.0 38.0 41.0 35.0 41.0 20 38.8315 40.0 38.0 41.0 35.0 41.0 21 38.8025 40.0 38.0 41.0 34.0 41.0 22 38.79125 40.0 38.0 41.0 35.0 41.0 23 38.6835 40.0 38.0 41.0 34.0 41.0 24 38.58625 40.0 38.0 41.0 34.0 41.0 25 38.63825 40.0 38.0 41.0 34.0 41.0 26 38.53825 40.0 38.0 41.0 34.0 41.0 27 38.50625 40.0 38.0 41.0 34.0 41.0 28 38.22025 40.0 38.0 41.0 34.0 41.0 29 38.23375 40.0 38.0 41.0 33.0 41.0 30 38.11575 40.0 38.0 41.0 33.0 41.0 31 38.089 40.0 38.0 41.0 33.0 41.0 32 37.8325 40.0 38.0 41.0 32.0 41.0 33 37.7715 40.0 38.0 41.0 33.0 41.0 34 37.68725 40.0 37.0 41.0 31.0 41.0 35 37.6765 40.0 38.0 41.0 32.0 41.0 36 37.4765 40.0 37.0 41.0 31.0 41.0 37 37.4645 40.0 37.0 41.0 31.0 41.0 38 37.29675 40.0 37.0 41.0 31.0 41.0 39 37.24325 40.0 37.0 41.0 30.0 41.0 40 37.232 40.0 37.0 41.0 30.0 41.0 41 37.16325 40.0 37.0 41.0 30.0 41.0 42 36.94575 40.0 37.0 41.0 30.0 41.0 43 36.93975 40.0 36.0 41.0 30.0 41.0 44 36.81375 40.0 36.0 41.0 30.0 41.0 45 36.53625 40.0 36.0 41.0 28.0 41.0 46 36.48875 40.0 36.0 41.0 29.0 41.0 47 36.26475 39.0 35.0 41.0 28.0 41.0 48 36.25375 39.0 35.0 41.0 28.0 41.0 49 36.245 39.0 35.0 41.0 28.0 41.0 50 36.172 39.0 35.0 41.0 27.0 41.0 51 36.00475 39.0 35.0 41.0 26.0 41.0 52 33.7345 37.0 32.0 40.0 20.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 0.0 15 0.0 16 1.0 17 0.0 18 2.0 19 2.0 20 2.0 21 7.0 22 9.0 23 6.0 24 22.0 25 19.0 26 27.0 27 19.0 28 37.0 29 57.0 30 66.0 31 72.0 32 114.0 33 128.0 34 146.0 35 209.0 36 319.0 37 481.0 38 826.0 39 1423.0 40 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.961038961038966 11.053391053391055 6.262626262626263 43.722943722943725 2 22.825 13.475000000000001 35.875 27.825 3 21.575 18.35 25.124999999999996 34.949999999999996 4 25.624999999999996 25.8 22.075 26.5 5 24.099999999999998 30.125 23.799999999999997 21.975 6 19.375 32.925 25.424999999999997 22.275 7 15.5 23.425 41.975 19.1 8 18.075 21.175 31.025000000000002 29.725 9 19.275000000000002 20.1 34.225 26.400000000000002 10 18.375 36.575 24.95 20.1 11 24.474999999999998 27.125 21.925 26.474999999999998 12 23.65 22.375 25.224999999999998 28.749999999999996 13 20.275000000000002 27.85 27.075 24.8 14 20.825 26.474999999999998 27.425 25.275 15 21.675 25.775 28.199999999999996 24.349999999999998 16 20.9 25.474999999999998 27.175 26.450000000000003 17 21.275 25.674999999999997 26.8 26.25 18 22.75 25.575 25.025 26.650000000000002 19 22.125 25.374999999999996 25.55 26.950000000000003 20 21.625 26.85 26.200000000000003 25.324999999999996 21 22.025 26.525 25.7 25.75 22 21.85 26.05 25.5 26.6 23 23.025000000000002 26.75 25.05 25.174999999999997 24 22.375 27.325 25.874999999999996 24.425 25 22.775000000000002 25.575 25.75 25.900000000000002 26 22.825 25.75 26.650000000000002 24.775 27 22.075 25.6 25.75 26.575 28 21.95 26.174999999999997 27.075 24.8 29 22.900000000000002 25.95 25.75 25.4 30 21.7 24.525 27.200000000000003 26.575 31 22.3 26.025 26.400000000000002 25.275 32 20.9 25.525 27.6 25.974999999999998 33 21.725 25.4 25.074999999999996 27.800000000000004 34 21.175 26.25 26.900000000000002 25.674999999999997 35 22.025 25.1 25.25 27.625 36 21.675 25.924999999999997 25.575 26.825 37 20.7 26.025 26.525 26.75 38 22.125 25.624999999999996 25.0 27.250000000000004 39 22.675 25.275 25.900000000000002 26.150000000000002 40 22.025 26.75 25.35 25.874999999999996 41 22.975 26.625 25.074999999999996 25.324999999999996 42 21.725 25.2 26.950000000000003 26.125 43 21.825 26.125 26.3 25.75 44 22.625 24.425 26.1 26.85 45 22.95 24.7 26.224999999999998 26.125 46 22.25 26.075 25.2 26.474999999999998 47 22.175 25.8 25.55 26.474999999999998 48 23.075000000000003 26.05 26.775 24.099999999999998 49 23.775 24.825 25.1 26.3 50 22.225 25.724999999999998 25.2 26.85 51 21.349999999999998 26.5 24.025 28.125 52 22.675 25.575 25.525 26.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 2.0 17 4.0 18 3.5 19 3.0 20 4.0 21 5.0 22 6.0 23 7.0 24 10.5 25 14.0 26 18.0 27 22.0 28 26.0 29 30.0 30 36.5 31 43.0 32 62.0 33 81.0 34 99.0 35 117.0 36 135.5 37 154.0 38 164.0 39 193.5 40 213.0 41 248.5 42 284.0 43 293.0 44 302.0 45 322.5 46 343.0 47 342.5 48 342.0 49 339.5 50 337.0 51 320.5 52 304.0 53 292.5 54 281.0 55 263.5 56 246.0 57 216.0 58 186.0 59 162.0 60 138.0 61 122.0 62 106.0 63 101.0 64 76.0 65 56.0 66 48.5 67 41.0 68 32.5 69 24.0 70 15.5 71 7.0 72 7.0 73 7.0 74 6.0 75 5.0 76 7.5 77 10.0 78 8.0 79 6.0 80 4.5 81 3.0 82 2.5 83 2.0 84 1.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 1.0 94 2.0 95 1.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 13.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.65 #Duplication Level Percentage of deduplicated Percentage of total 1 97.04652378463146 92.825 2 1.9602718243596446 3.75 3 0.6534239414532148 1.875 4 0.20909566126502874 0.8 5 0.052273915316257184 0.25 6 0.026136957658128592 0.15 7 0.052273915316257184 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACTGCCCAACCT 7 0.17500000000000002 No Hit GCCGAACCTAAACCTGTGCTCGAGAGATAGCTGTCCATACACTGATAAGGGA 7 0.17500000000000002 No Hit GTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAGTTCCT 6 0.15 No Hit GCCAACTTGATCCTCTTCCCCAGGGATCCCAGATGAGGGAACCCTAGGAGAG 5 0.125 No Hit GTGAAGATACGTTGTTAGGTGCTCCATTTTATTTTCCCATTGAGGCCGAACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra Read 200000 spots for SRR5423303.sra Written 200000 spots for SRR5423303.sra SRR ids: ['SRR5423303.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x8rv4o78 SRR5423303.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423303 file size 703931 SRR5423303 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423303 SRR5423303_1.fastq Input file: SRR5423303_1.fastq trimmed: SRR5423303-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 21:20:53 2025 >> started Wed Feb 12 21:20:55 2025 >> done (1.955s) 4000000 reads processed; of these: 108 ( 0.00%) short reads filtered out after trimming by size control 52 ( 0.00%) empty reads filtered out after trimming by size control 3999840 (100.00%) reads available; of these: 137034 ( 3.43%) trimmed reads available after processing 3862806 (96.57%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 7 0.00% 20 4 0.00% 21 1 0.00% 22 1 0.00% 23 5 0.00% 24 7 0.00% 25 11 0.00% 26 14 0.00% 27 11 0.00% 28 19 0.00% 29 19 0.00% 30 36 0.00% 31 24 0.00% 32 54 0.00% 33 59 0.00% 34 56 0.00% 35 84 0.00% 36 91 0.00% 37 117 0.00% 38 140 0.00% 39 193 0.00% 40 239 0.01% 41 317 0.01% 42 408 0.01% 43 512 0.01% 44 840 0.02% 45 1212 0.03% 46 1391 0.03% 47 2036 0.05% 48 3305 0.08% 49 6704 0.17% 50 17620 0.44% 51 101487 2.54% 52 3862806 96.57% 3999840 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=26 prefix-density=0.26 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=19.06 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=1.4 sequence=CCTCTTCCCCATTACTTAGAAAAAGTGAGCCACCGGTTCAGGTACAAGATACTATCATTACCGCCTGGACAATTAGACATCCAACCCGTAATCGCAACGACCCAATTGCAAGAGCGGAGCTCTACCAACTGAGCTATATCCCCCCGAGCCAAGTGGAGCATGTATGAAGGAGTCAGATGCTTCTTCTATTCTTTTCTTTTCTTTGGCGCAGCTGGGCCATCCTGGACTTGAACCAGAGACCTCGCCCGTGAAGTAAATCATCGCACCTACGGTCCAACCAATTGGGAGAGAATCAATAGATTCCTTTTCGGGAGCGATTCATCCTTCCCGAACGCAGCATACAACTCTCCGGTGTACTGCGCTCTCCAAGTGTGCTTGTTCCCCCCTTCTTCCTTACCATGGCAAGTCTTTTTGAAATAACTCCGATGAGAAGAAAAA Started job on | Feb 12 21:21:10 Started mapping on | Feb 12 21:21:10 Finished on | Feb 12 21:21:15 Mapping speed, Million of reads per hour | 2879.88 Number of input reads | 3999840 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3306117 Uniquely mapped reads % | 82.66% Average mapped length | 51.75 Number of splices: Total | 318794 Number of splices: Annotated (sjdb) | 314222 Number of splices: GT/AG | 311534 Number of splices: GC/AG | 5683 Number of splices: AT/AC | 509 Number of splices: Non-canonical | 1068 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 2.46 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 463726 % of reads mapped to multiple loci | 11.59% Number of reads mapped to too many loci | 120162 % of reads mapped to too many loci | 3.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.73% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 229997 229997 229997 N_multimapping 463726 463726 463726 N_noFeature 614553 3235275 673447 N_ambiguous 25041 181 12925 UnstrandedReadsAssigned:2666523 PositiveStrandReadsAssigned:70661 NegativeStrandReadsAssigned:2619745 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423303 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423303-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,840 reads, 2,971,458 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,024 rounds 52401 SRR5423303.ke.tsv 34699 SRR5423303.se.tsv 87100 total ==> SRR5423303.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 94 16.9546 Potri.005G024800.1.v4.1 1035 936 2.00271 0.740588 Potri.004G059700.1.v4.1 961 862 1 0.401538 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 48 5.84178 Potri.016G087400.1.v4.1 270 171 25 50.6032 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 36 14.1919 ==> SRR5423303.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 35 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423303 completed mapping pipeline successfully