Starting /dee2/code/volunteer_pipeline.sh SRR5423304 current disk space = 3050663116800 free memory = 1579895628 SRR5423304 SRAfilesize 9028eff453d370be80ca8e41eaa52698 SRR5423304.sra SRR5423304.sra file validated SRR5423304 is single end SRR5423304 is conventional basespace SRR5423304 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423304_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.10875 33.0 31.0 34.0 30.0 34.0 2 32.15925 34.0 31.0 34.0 30.0 34.0 3 32.29475 34.0 31.0 34.0 30.0 34.0 4 35.69075 37.0 35.0 37.0 33.0 37.0 5 35.669 37.0 35.0 37.0 33.0 37.0 6 35.73025 37.0 35.0 37.0 33.0 37.0 7 35.75125 37.0 35.0 37.0 35.0 37.0 8 35.734 37.0 35.0 37.0 35.0 37.0 9 37.4085 39.0 37.0 39.0 34.0 39.0 10 37.33175 39.0 37.0 39.0 34.0 39.0 11 37.49875 39.0 37.0 39.0 35.0 39.0 12 37.407 39.0 37.0 39.0 34.0 39.0 13 37.44675 39.0 37.0 39.0 35.0 39.0 14 38.699 40.0 38.0 41.0 34.0 41.0 15 38.61925 40.0 38.0 41.0 34.0 41.0 16 38.643 40.0 38.0 41.0 34.0 41.0 17 38.48775 40.0 38.0 41.0 34.0 41.0 18 38.62725 40.0 38.0 41.0 34.0 41.0 19 38.6895 40.0 38.0 41.0 34.0 41.0 20 38.47475 40.0 38.0 41.0 34.0 41.0 21 38.2705 40.0 38.0 41.0 34.0 41.0 22 38.31325 40.0 38.0 41.0 34.0 41.0 23 38.3135 40.0 38.0 41.0 34.0 41.0 24 38.4525 40.0 38.0 41.0 34.0 41.0 25 38.49125 40.0 38.0 41.0 34.0 41.0 26 38.22425 40.0 38.0 41.0 33.0 41.0 27 38.325 40.0 38.0 41.0 34.0 41.0 28 38.35775 40.0 38.0 41.0 34.0 41.0 29 37.80275 40.0 37.0 41.0 32.0 41.0 30 38.165 40.0 38.0 41.0 34.0 41.0 31 38.0575 40.0 38.0 41.0 33.0 41.0 32 38.015 40.0 37.0 41.0 33.0 41.0 33 37.9185 40.0 37.0 41.0 33.0 41.0 34 37.919 40.0 37.0 41.0 33.0 41.0 35 37.83275 40.0 37.0 41.0 33.0 41.0 36 37.64975 40.0 37.0 41.0 32.0 41.0 37 37.73125 40.0 37.0 41.0 32.0 41.0 38 37.697 40.0 37.0 41.0 33.0 41.0 39 37.65075 40.0 37.0 41.0 31.0 41.0 40 37.251 40.0 36.0 41.0 31.0 41.0 41 37.2155 40.0 36.0 41.0 31.0 41.0 42 37.37025 40.0 37.0 41.0 31.0 41.0 43 37.4955 40.0 37.0 41.0 31.0 41.0 44 36.99575 39.0 36.0 41.0 30.0 41.0 45 37.092 39.0 36.0 41.0 31.0 41.0 46 37.1505 39.0 36.0 41.0 31.0 41.0 47 36.7375 39.0 35.0 41.0 30.0 41.0 48 36.852 39.0 35.0 41.0 30.0 41.0 49 36.87375 39.0 35.0 41.0 31.0 41.0 50 36.5995 39.0 35.0 41.0 29.0 41.0 51 36.455 39.0 35.0 41.0 29.0 41.0 52 35.34 38.0 34.0 40.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2210 1 0.0 2210 2 0.0 2210 3 0.0 2210 4 0.0 2210 5 0.0 2210 6 0.0 2210 7 0.0 2210 8 0.0 2210 9 0.0 2210 10 0.0 2210 11 0.0 2210 12 0.0 2210 13 0.0 2210 14 0.0 2210 15 0.0 2210 16 0.0 2210 17 0.0 2210 18 0.0 2210 19 0.0 2210 20 0.0 2210 21 0.0 2210 22 0.0 2210 23 0.0 2210 24 0.0 2210 25 0.0 2210 26 0.0 2210 27 0.0 2210 28 0.0 2210 29 0.0 2210 30 0.0 2210 31 0.0 2210 32 0.0 2210 33 0.0 2210 34 0.0 2210 35 0.0 2210 36 0.0 2210 37 0.0 2210 38 0.0 2210 39 0.0 2210 40 0.0 2210 41 0.0 2210 42 0.0 2210 43 0.0 2210 44 0.0 2210 45 0.0 2210 46 0.0 2210 47 0.0 2210 48 0.0 2210 49 0.0 2210 50 0.0 2210 51 0.0 2210 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 2.0 19 0.0 20 5.0 21 0.0 22 3.0 23 3.0 24 8.0 25 13.0 26 19.0 27 29.0 28 38.0 29 34.0 30 68.0 31 87.0 32 109.0 33 144.0 34 168.0 35 236.0 36 313.0 37 467.0 38 724.0 39 1522.0 40 7.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.430861723446895 11.422845691382765 4.909819639278557 43.236472945891784 2 23.875 14.899999999999999 34.150000000000006 27.075 3 21.925 16.45 24.675 36.95 4 23.425 26.575 21.65 28.349999999999998 5 24.675 30.8 23.599999999999998 20.925 6 19.85 31.374999999999996 25.074999999999996 23.7 7 15.575 22.825 42.525 19.075 8 18.075 20.849999999999998 30.8 30.275000000000002 9 18.8 20.549999999999997 34.25 26.400000000000002 10 19.225 35.5 24.825 20.45 11 22.7 25.825 22.25 29.225 12 21.325 24.175 27.0 27.500000000000004 13 20.9 26.875 27.125 25.1 14 21.75 26.700000000000003 26.400000000000002 25.15 15 20.875 26.875 26.775 25.474999999999998 16 21.675 26.25 26.35 25.724999999999998 17 21.349999999999998 25.85 25.95 26.85 18 21.224999999999998 25.85 26.400000000000002 26.525 19 22.275 25.924999999999997 25.85 25.95 20 22.125 25.95 25.85 26.075 21 20.775 26.674999999999997 26.875 25.674999999999997 22 20.925 28.025 25.974999999999998 25.074999999999996 23 23.5 24.349999999999998 26.075 26.075 24 21.25 26.275 25.35 27.125 25 21.099999999999998 26.424999999999997 25.974999999999998 26.5 26 22.375 25.674999999999997 25.55 26.400000000000002 27 21.55 26.075 26.200000000000003 26.174999999999997 28 23.150000000000002 25.4 26.700000000000003 24.75 29 21.575 25.95 26.35 26.125 30 21.425 25.474999999999998 26.200000000000003 26.900000000000002 31 20.200000000000003 27.075 25.924999999999997 26.8 32 21.099999999999998 25.974999999999998 26.125 26.8 33 21.55 26.0 26.924999999999997 25.525 34 21.175 25.650000000000002 24.8 28.375 35 21.45 25.0 25.124999999999996 28.425 36 20.625 24.7 26.375 28.299999999999997 37 21.45 24.875 26.3 27.375 38 21.525 26.3 25.575 26.6 39 22.025 24.175 27.025 26.775 40 23.05 26.125 25.3 25.525 41 21.375 26.825 24.725 27.075 42 21.224999999999998 25.174999999999997 25.974999999999998 27.625 43 22.275 25.650000000000002 24.85 27.224999999999998 44 23.05 25.424999999999997 25.575 25.95 45 21.525 25.3 25.924999999999997 27.250000000000004 46 22.85 25.275 24.5 27.375 47 22.575 26.474999999999998 25.124999999999996 25.825 48 21.75 26.375 25.8 26.075 49 21.875 25.85 26.724999999999998 25.55 50 23.05 25.1 25.650000000000002 26.200000000000003 51 23.025000000000002 26.200000000000003 24.0 26.775 52 21.05 27.250000000000004 25.25 26.450000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 0.0 11 0.5 12 1.0 13 1.5 14 2.0 15 2.0 16 1.5 17 1.0 18 4.0 19 7.0 20 7.5 21 8.0 22 11.0 23 14.0 24 15.0 25 16.0 26 20.0 27 24.0 28 34.0 29 44.0 30 43.5 31 43.0 32 53.5 33 64.0 34 82.5 35 101.0 36 117.5 37 134.0 38 150.5 39 184.0 40 201.0 41 240.5 42 280.0 43 282.5 44 285.0 45 290.0 46 295.0 47 308.0 48 321.0 49 317.0 50 313.0 51 338.0 52 363.0 53 335.0 54 307.0 55 271.5 56 236.0 57 229.0 58 222.0 59 198.0 60 174.0 61 149.0 62 124.0 63 102.5 64 67.0 65 53.0 66 47.5 67 42.0 68 38.0 69 34.0 70 23.0 71 12.0 72 7.5 73 3.0 74 5.0 75 7.0 76 7.5 77 8.0 78 6.0 79 4.0 80 4.5 81 5.0 82 2.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.0 #Duplication Level Percentage of deduplicated Percentage of total 1 96.42105263157895 91.60000000000001 2 2.6052631578947367 4.95 3 0.6578947368421052 1.875 4 0.18421052631578946 0.7000000000000001 5 0.05263157894736842 0.25 6 0.0 0.0 7 0.02631578947368421 0.17500000000000002 8 0.02631578947368421 0.2 9 0.0 0.0 >10 0.02631578947368421 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 10 0.25 No Hit GCCCCATCTATCCTCCTGAGGAGAAGTTTGGTTTCAAACCCCGGTTCGAACA 8 0.2 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 7 0.17500000000000002 No Hit GTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAGTTCCT 5 0.125 No Hit CCCACTTTTTGGTCTTAAGAATGCTGGTTTTAAGAATGAGTGATTGCCCTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra Read 200000 spots for SRR5423304.sra Written 200000 spots for SRR5423304.sra SRR ids: ['SRR5423304.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3zhin6l3 SRR5423304.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423304 file size 703983 SRR5423304 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423304 SRR5423304_1.fastq Input file: SRR5423304_1.fastq trimmed: SRR5423304-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 21:36:42 2025 >> started Wed Feb 12 21:36:44 2025 >> done (1.930s) 4000000 reads processed; of these: 109 ( 0.00%) short reads filtered out after trimming by size control 74 ( 0.00%) empty reads filtered out after trimming by size control 3999817 (100.00%) reads available; of these: 103210 ( 2.58%) trimmed reads available after processing 3896607 (97.42%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 3 0.00% 21 0 0.00% 22 2 0.00% 23 1 0.00% 24 6 0.00% 25 9 0.00% 26 2 0.00% 27 5 0.00% 28 4 0.00% 29 12 0.00% 30 8 0.00% 31 20 0.00% 32 19 0.00% 33 23 0.00% 34 34 0.00% 35 49 0.00% 36 55 0.00% 37 56 0.00% 38 76 0.00% 39 88 0.00% 40 122 0.00% 41 153 0.00% 42 189 0.00% 43 261 0.01% 44 403 0.01% 45 553 0.01% 46 748 0.02% 47 1226 0.03% 48 2104 0.05% 49 4699 0.12% 50 12693 0.32% 51 79574 1.99% 52 3896607 97.42% 3999817 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.25 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=23.11 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.6 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 21:36:57 Started mapping on | Feb 12 21:36:57 Finished on | Feb 12 21:37:03 Mapping speed, Million of reads per hour | 2399.89 Number of input reads | 3999817 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3305059 Uniquely mapped reads % | 82.63% Average mapped length | 51.76 Number of splices: Total | 318524 Number of splices: Annotated (sjdb) | 314181 Number of splices: GT/AG | 311183 Number of splices: GC/AG | 5823 Number of splices: AT/AC | 514 Number of splices: Non-canonical | 1004 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 463686 % of reads mapped to multiple loci | 11.59% Number of reads mapped to too many loci | 124033 % of reads mapped to too many loci | 3.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.66% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 231072 231072 231072 N_multimapping 463686 463686 463686 N_noFeature 616701 3235313 674632 N_ambiguous 25051 203 13050 UnstrandedReadsAssigned:2663307 PositiveStrandReadsAssigned:69543 NegativeStrandReadsAssigned:2617377 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423304 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423304-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,817 reads, 2,955,644 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,050 rounds 52401 SRR5423304.ke.tsv 34699 SRR5423304.se.tsv 87100 total ==> SRR5423304.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 91 16.518 Potri.005G024800.1.v4.1 1035 936 2 0.744295 Potri.004G059700.1.v4.1 961 862 1 0.404095 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 68.7659 8.42238 Potri.016G087400.1.v4.1 270 171 31 63.1476 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.208083 Potri.012G127500.1.v4.1 977 878 39 15.4725 ==> SRR5423304.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 47 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423304 completed mapping pipeline successfully