Starting /dee2/code/volunteer_pipeline.sh SRR5423305 current disk space = 3050655367168 free memory = 1579836984 SRR5423305 SRAfilesize 34b2e8a90e242260c5540446fa5e904b SRR5423305.sra SRR5423305.sra file validated SRR5423305 is single end SRR5423305 is conventional basespace SRR5423305 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423305_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3685 34.0 31.0 34.0 30.0 34.0 2 32.49875 34.0 31.0 34.0 30.0 34.0 3 32.60775 34.0 31.0 34.0 31.0 34.0 4 35.92175 37.0 35.0 37.0 35.0 37.0 5 36.02925 37.0 35.0 37.0 35.0 37.0 6 35.9625 37.0 35.0 37.0 35.0 37.0 7 35.954 37.0 35.0 37.0 35.0 37.0 8 35.96725 37.0 35.0 37.0 35.0 37.0 9 37.73675 39.0 37.0 39.0 35.0 39.0 10 37.62775 39.0 37.0 39.0 35.0 39.0 11 37.75225 39.0 37.0 39.0 35.0 39.0 12 37.63225 39.0 37.0 39.0 35.0 39.0 13 37.6345 39.0 37.0 39.0 35.0 39.0 14 39.051 40.0 38.0 41.0 36.0 41.0 15 39.01775 40.0 38.0 41.0 36.0 41.0 16 38.93775 40.0 38.0 41.0 35.0 41.0 17 38.94025 40.0 38.0 41.0 35.0 41.0 18 38.70075 40.0 38.0 41.0 34.0 41.0 19 38.839 40.0 38.0 41.0 35.0 41.0 20 38.877 40.0 38.0 41.0 35.0 41.0 21 38.8865 40.0 38.0 41.0 35.0 41.0 22 38.7715 40.0 38.0 41.0 35.0 41.0 23 38.6715 40.0 38.0 41.0 34.0 41.0 24 38.62725 40.0 38.0 41.0 34.0 41.0 25 38.53625 40.0 38.0 41.0 34.0 41.0 26 38.494 40.0 38.0 41.0 34.0 41.0 27 38.39025 40.0 38.0 41.0 34.0 41.0 28 38.392 40.0 38.0 41.0 34.0 41.0 29 38.314 40.0 38.0 41.0 34.0 41.0 30 38.2515 40.0 38.0 41.0 33.0 41.0 31 38.20925 40.0 38.0 41.0 34.0 41.0 32 37.977 40.0 38.0 41.0 33.0 41.0 33 37.809 40.0 38.0 41.0 32.0 41.0 34 37.886 40.0 38.0 41.0 33.0 41.0 35 37.8385 40.0 38.0 41.0 33.0 41.0 36 37.8265 40.0 38.0 41.0 33.0 41.0 37 37.60925 40.0 37.0 41.0 32.0 41.0 38 37.4855 40.0 37.0 41.0 32.0 41.0 39 37.33975 40.0 37.0 41.0 31.0 41.0 40 37.1925 40.0 37.0 41.0 30.0 41.0 41 37.1265 40.0 37.0 41.0 30.0 41.0 42 37.03575 40.0 37.0 41.0 30.0 41.0 43 36.7635 40.0 36.0 41.0 29.0 41.0 44 36.845 40.0 36.0 41.0 30.0 41.0 45 36.802 39.0 36.0 41.0 30.0 41.0 46 36.73825 40.0 36.0 41.0 30.0 41.0 47 36.5595 39.0 35.0 41.0 29.0 41.0 48 36.29475 39.0 35.0 40.0 28.0 41.0 49 36.27925 39.0 35.0 41.0 28.0 41.0 50 36.111 39.0 35.0 40.0 28.0 41.0 51 35.848 39.0 35.0 40.0 27.0 41.0 52 33.82125 37.0 32.0 40.0 22.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2301 1 0.0 2301 2 0.0 2301 3 0.0 2301 4 0.0 2301 5 0.0 2301 6 0.0 2301 7 0.0 2301 8 0.0 2301 9 0.0 2301 10 0.0 2301 11 0.0 2301 12 0.0 2301 13 0.0 2301 14 0.0 2301 15 0.0 2301 16 0.0 2301 17 0.0 2301 18 0.0 2301 19 0.0 2301 20 0.0 2301 21 0.0 2301 22 0.0 2301 23 0.0 2301 24 0.0 2301 25 0.0 2301 26 0.0 2301 27 0.0 2301 28 0.0 2301 29 0.0 2301 30 0.0 2301 31 0.0 2301 32 0.0 2301 33 0.0 2301 34 0.0 2301 35 0.0 2301 36 0.0 2301 37 0.0 2301 38 0.0 2301 39 0.0 2301 40 0.0 2301 41 0.0 2301 42 0.0 2301 43 0.0 2301 44 0.0 2301 45 0.0 2301 46 0.0 2301 47 0.0 2301 48 0.0 2301 49 0.0 2301 50 0.0 2301 51 0.0 2301 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 5.0 22 8.0 23 13.0 24 15.0 25 11.0 26 15.0 27 30.0 28 40.0 29 44.0 30 61.0 31 80.0 32 103.0 33 107.0 34 143.0 35 224.0 36 326.0 37 405.0 38 792.0 39 1573.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.80995248812203 11.302825706426606 5.676419104776194 43.21080270067517 2 22.75 14.249999999999998 36.125 26.875 3 21.975 17.775 23.175 37.075 4 25.75 26.8 21.325 26.125 5 23.575 31.75 23.400000000000002 21.275 6 18.9 32.75 25.7 22.650000000000002 7 16.275000000000002 22.7 41.65 19.375 8 18.9 20.95 31.275 28.875 9 18.224999999999998 19.675 34.275 27.825 10 19.475 35.9 24.9 19.725 11 23.775 25.85 22.650000000000002 27.725 12 22.55 23.3 26.450000000000003 27.700000000000003 13 20.525 25.95 28.575 24.95 14 21.125 26.674999999999997 28.375 23.825 15 21.0 26.674999999999997 26.950000000000003 25.374999999999996 16 22.2 25.75 26.625 25.424999999999997 17 22.85 25.900000000000002 26.625 24.625 18 21.775 26.724999999999998 25.324999999999996 26.174999999999997 19 22.3 26.275 25.85 25.575 20 22.575 25.6 26.85 24.975 21 21.125 25.650000000000002 26.5 26.724999999999998 22 22.1 25.775 25.324999999999996 26.8 23 20.95 26.0 25.674999999999997 27.375 24 21.725 25.4 25.8 27.075 25 22.900000000000002 26.375 25.25 25.474999999999998 26 22.875 25.3 25.7 26.125 27 21.575 24.925 25.95 27.55 28 21.95 26.1 26.575 25.374999999999996 29 21.7 26.075 26.3 25.924999999999997 30 21.65 25.074999999999996 25.75 27.525 31 22.725 27.200000000000003 25.025 25.05 32 23.425 25.650000000000002 25.1 25.825 33 22.675 24.0 26.875 26.450000000000003 34 21.825 26.1 25.575 26.5 35 20.9 25.95 26.075 27.075 36 22.575 25.650000000000002 23.799999999999997 27.975 37 21.75 25.55 25.1 27.6 38 21.099999999999998 27.025 25.35 26.525 39 22.58064516129032 24.781195298824706 25.456364091022753 27.181795448862218 40 21.966474856142106 26.770077558168627 25.31898924193145 25.94445834375782 41 22.58064516129032 26.006501625406354 25.98149537384346 25.431357839459867 42 22.725 23.25 25.05 28.975 43 22.155538884721178 27.33183295823956 23.95598899724931 26.556639159789945 44 23.375 24.775 25.974999999999998 25.874999999999996 45 22.605651412853213 24.706176544136035 25.381345336334082 27.306826706676667 46 22.630657664416105 26.156539134783696 25.406351587896975 25.806451612903224 47 23.29246935201401 25.11883912934701 25.69427070302727 25.894420815611706 48 22.7 26.0 24.25 27.05 49 22.86715036277208 25.494120590442833 25.268951713785338 26.36977733299975 50 24.55 23.625 25.25 26.575 51 22.566925193895422 24.11808856642482 25.99449587190393 27.32049036777583 52 23.05 25.275 25.0 26.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 1.0 18 2.0 19 3.0 20 5.5 21 8.0 22 10.0 23 12.0 24 11.5 25 11.0 26 18.0 27 25.0 28 26.5 29 28.0 30 42.5 31 57.0 32 64.5 33 72.0 34 81.5 35 91.0 36 103.0 37 115.0 38 151.5 39 211.5 40 235.0 41 247.0 42 259.0 43 267.0 44 275.0 45 296.0 46 317.0 47 321.5 48 326.0 49 318.5 50 311.0 51 320.5 52 330.0 53 316.5 54 303.0 55 273.5 56 244.0 57 234.0 58 224.0 59 195.0 60 166.0 61 140.5 62 115.0 63 99.5 64 71.5 65 59.0 66 53.0 67 47.0 68 36.5 69 26.0 70 22.0 71 18.0 72 14.5 73 11.0 74 10.5 75 10.0 76 9.5 77 9.0 78 10.0 79 11.0 80 5.5 81 0.0 82 0.5 83 1.0 84 1.5 85 2.0 86 1.0 87 0.0 88 0.5 89 0.5 90 0.0 91 1.5 92 3.0 93 1.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.025 40 0.075 41 0.025 42 0.0 43 0.025 44 0.0 45 0.025 46 0.025 47 0.075 48 0.0 49 0.075 50 0.0 51 0.075 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.975 #Duplication Level Percentage of deduplicated Percentage of total 1 96.44643327191366 91.60000000000001 2 2.553303500921295 4.8500000000000005 3 0.5264543300868649 1.5 4 0.315872598052119 1.2 5 0.07896814951302975 0.375 6 0.052645433008686494 0.3 7 0.026322716504343247 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 7 0.17500000000000002 No Hit GCCAACTTGATCCTCTTCCCCAGGGATCCCAGATGAGGGAACCCTAGGAGAG 6 0.15 No Hit CCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACT 6 0.15 No Hit CCCACTTTTTGGTCTTAAGAATGCTGGTTTTAAGAATGAGTGATTGCCCTTC 5 0.125 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 5 0.125 No Hit CTCCAGCAACGGGCTCGATGTCGTAGCATCGTCCCTTATAACGATCAAGACT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra Read 200000 spots for SRR5423305.sra Written 200000 spots for SRR5423305.sra SRR ids: ['SRR5423305.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ry7lq_jp SRR5423305.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423305 file size 703913 SRR5423305 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423305 SRR5423305_1.fastq Input file: SRR5423305_1.fastq trimmed: SRR5423305-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 21:37:22 2025 >> started Wed Feb 12 21:37:24 2025 >> done (2.033s) 4000000 reads processed; of these: 139 ( 0.00%) short reads filtered out after trimming by size control 60 ( 0.00%) empty reads filtered out after trimming by size control 3999801 (100.00%) reads available; of these: 116834 ( 2.92%) trimmed reads available after processing 3882967 (97.08%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 2 0.00% 20 3 0.00% 21 2 0.00% 22 2 0.00% 23 5 0.00% 24 4 0.00% 25 9 0.00% 26 12 0.00% 27 6 0.00% 28 19 0.00% 29 16 0.00% 30 13 0.00% 31 22 0.00% 32 31 0.00% 33 36 0.00% 34 62 0.00% 35 67 0.00% 36 59 0.00% 37 101 0.00% 38 121 0.00% 39 159 0.00% 40 195 0.00% 41 264 0.01% 42 302 0.01% 43 355 0.01% 44 666 0.02% 45 952 0.02% 46 1101 0.03% 47 1646 0.04% 48 2777 0.07% 49 5754 0.14% 50 15279 0.38% 51 86785 2.17% 52 3882967 97.08% 3999801 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=28 prefix-density=0.26 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=23.26 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.8 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 21:37:37 Started mapping on | Feb 12 21:37:37 Finished on | Feb 12 21:37:43 Mapping speed, Million of reads per hour | 2399.88 Number of input reads | 3999801 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3307372 Uniquely mapped reads % | 82.69% Average mapped length | 51.76 Number of splices: Total | 317420 Number of splices: Annotated (sjdb) | 312959 Number of splices: GT/AG | 310183 Number of splices: GC/AG | 5718 Number of splices: AT/AC | 501 Number of splices: Non-canonical | 1018 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.47 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 461884 % of reads mapped to multiple loci | 11.55% Number of reads mapped to too many loci | 121921 % of reads mapped to too many loci | 3.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.70% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 230545 230545 230545 N_multimapping 461884 461884 461884 N_noFeature 617491 3235901 677086 N_ambiguous 25143 204 13082 UnstrandedReadsAssigned:2664738 PositiveStrandReadsAssigned:71267 NegativeStrandReadsAssigned:2617204 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423305 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423305-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,801 reads, 2,958,015 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52401 SRR5423305.ke.tsv 34699 SRR5423305.se.tsv 87100 total ==> SRR5423305.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 76 13.7906 Potri.005G024800.1.v4.1 1035 936 5 1.8601 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 60.372 7.39177 Potri.016G087400.1.v4.1 270 171 18 36.6538 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.208012 Potri.012G127500.1.v4.1 977 878 34 13.4843 ==> SRR5423305.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 36 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423305 completed mapping pipeline successfully