Starting /dee2/code/volunteer_pipeline.sh SRR5423306 current disk space = 3050651308032 free memory = 1581801816 SRR5423306 SRAfilesize a476bb340b0681c56c86f316f83230aa SRR5423306.sra SRR5423306.sra file validated SRR5423306 is single end SRR5423306 is conventional basespace SRR5423306 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423306_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.813 31.0 31.0 34.0 30.0 34.0 2 31.86825 33.0 31.0 34.0 30.0 34.0 3 31.92475 34.0 31.0 34.0 30.0 34.0 4 35.5015 37.0 35.0 37.0 33.0 37.0 5 35.64375 37.0 35.0 37.0 33.0 37.0 6 35.5935 37.0 35.0 37.0 33.0 37.0 7 35.5675 37.0 35.0 37.0 33.0 37.0 8 35.5385 37.0 35.0 37.0 33.0 37.0 9 37.314 39.0 37.0 39.0 34.0 39.0 10 37.13725 39.0 37.0 39.0 33.0 39.0 11 37.1295 39.0 37.0 39.0 33.0 39.0 12 37.25325 39.0 37.0 39.0 34.0 39.0 13 37.13525 39.0 37.0 39.0 33.0 39.0 14 38.2625 40.0 38.0 41.0 33.0 41.0 15 38.25 40.0 37.0 41.0 33.0 41.0 16 38.3375 40.0 38.0 41.0 34.0 41.0 17 38.29775 40.0 38.0 41.0 33.0 41.0 18 38.1395 40.0 37.0 41.0 33.0 41.0 19 38.376 40.0 38.0 41.0 34.0 41.0 20 38.338 40.0 38.0 41.0 34.0 41.0 21 38.24225 40.0 38.0 41.0 33.0 41.0 22 38.211 40.0 37.0 41.0 33.0 41.0 23 38.1225 40.0 37.0 41.0 33.0 41.0 24 38.1985 40.0 38.0 41.0 33.0 41.0 25 38.14925 40.0 37.0 41.0 33.0 41.0 26 37.967 40.0 37.0 41.0 33.0 41.0 27 37.9075 40.0 37.0 41.0 33.0 41.0 28 37.86275 40.0 37.0 41.0 32.0 41.0 29 37.798 40.0 37.0 41.0 33.0 41.0 30 37.74225 40.0 37.0 41.0 33.0 41.0 31 37.80525 40.0 37.0 41.0 33.0 41.0 32 37.775 40.0 37.0 41.0 33.0 41.0 33 37.69925 40.0 37.0 41.0 32.0 41.0 34 37.6535 40.0 37.0 41.0 32.0 41.0 35 37.794 40.0 37.0 41.0 32.0 41.0 36 37.668 40.0 37.0 41.0 32.0 41.0 37 37.582 40.0 37.0 41.0 32.0 41.0 38 37.45825 40.0 36.0 41.0 32.0 41.0 39 37.451 39.0 37.0 41.0 31.0 41.0 40 37.25775 39.0 36.0 41.0 31.0 41.0 41 37.253 39.0 36.0 41.0 31.0 41.0 42 37.0735 39.0 36.0 41.0 31.0 41.0 43 37.141 39.0 36.0 41.0 31.0 41.0 44 36.99975 39.0 36.0 41.0 31.0 41.0 45 36.94125 39.0 36.0 41.0 30.0 41.0 46 36.77925 39.0 35.0 41.0 30.0 41.0 47 36.64425 39.0 35.0 40.0 30.0 41.0 48 36.64475 39.0 35.0 40.0 30.0 41.0 49 36.762 39.0 35.0 40.0 30.0 41.0 50 36.47575 39.0 35.0 40.0 30.0 41.0 51 36.51675 39.0 35.0 40.0 30.0 41.0 52 35.2105 38.0 33.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2310 1 0.0 2310 2 0.0 2310 3 0.0 2310 4 0.0 2310 5 0.0 2310 6 0.0 2310 7 0.0 2310 8 0.0 2310 9 0.0 2310 10 0.0 2310 11 0.0 2310 12 0.0 2310 13 0.0 2310 14 0.0 2310 15 0.0 2310 16 0.0 2310 17 0.0 2310 18 0.0 2310 19 0.0 2310 20 0.0 2310 21 0.0 2310 22 0.0 2310 23 0.0 2310 24 0.0 2310 25 0.0 2310 26 0.0 2310 27 0.0 2310 28 0.0 2310 29 0.0 2310 30 0.0 2310 31 0.0 2310 32 0.0 2310 33 0.0 2310 34 0.0 2310 35 0.0 2310 36 0.0 2310 37 0.0 2310 38 0.0 2310 39 0.0 2310 40 0.0 2310 41 0.0 2310 42 0.0 2310 43 0.0 2310 44 0.0 2310 45 0.0 2310 46 0.0 2310 47 0.0 2310 48 0.0 2310 49 0.0 2310 50 0.0 2310 51 0.0 2310 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 2.0 22 1.0 23 8.0 24 9.0 25 7.0 26 20.0 27 30.0 28 39.0 29 50.0 30 70.0 31 95.0 32 125.0 33 164.0 34 195.0 35 265.0 36 334.0 37 483.0 38 779.0 39 1320.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.58489622405602 12.07801950487622 5.20130032508127 43.135783945986496 2 23.25 14.025000000000002 35.475 27.250000000000004 3 22.125 17.4 23.9 36.575 4 25.074999999999996 25.874999999999996 21.349999999999998 27.700000000000003 5 24.7 29.25 24.525 21.525 6 19.825 32.725 24.625 22.825 7 14.725 22.85 43.05 19.375 8 17.974999999999998 20.674999999999997 32.425 28.925 9 19.425 19.375 33.074999999999996 28.125 10 18.025 37.25 25.275 19.45 11 23.9 26.900000000000002 21.349999999999998 27.85 12 23.025000000000002 23.875 25.7 27.400000000000002 13 22.075 25.074999999999996 28.299999999999997 24.55 14 21.099999999999998 26.424999999999997 26.85 25.624999999999996 15 20.75 25.825 25.650000000000002 27.775 16 20.724999999999998 26.6 26.625 26.05 17 20.625 26.724999999999998 28.299999999999997 24.349999999999998 18 20.8 26.1 26.025 27.075 19 21.875 27.3 24.175 26.650000000000002 20 21.475 26.8 26.224999999999998 25.5 21 21.375 24.45 27.625 26.55 22 20.9 28.275 25.825 25.0 23 21.65 27.1 25.525 25.724999999999998 24 21.85 25.474999999999998 26.0 26.674999999999997 25 22.3 25.4 25.35 26.950000000000003 26 22.3 26.075 25.7 25.924999999999997 27 23.3 25.525 25.074999999999996 26.1 28 22.475 26.35 25.624999999999996 25.55 29 21.825 25.724999999999998 26.474999999999998 25.974999999999998 30 20.875 24.875 27.700000000000003 26.55 31 21.75 25.974999999999998 26.825 25.45 32 21.875 25.275 27.075 25.775 33 22.275 24.95 26.474999999999998 26.3 34 21.875 25.8 27.250000000000004 25.074999999999996 35 20.349999999999998 26.825 26.400000000000002 26.424999999999997 36 21.875 25.124999999999996 25.124999999999996 27.875 37 21.725 25.174999999999997 26.025 27.075 38 22.650000000000002 24.8 24.6 27.950000000000003 39 21.880470117529384 24.656164041010253 26.25656414103526 27.206801700425103 40 21.710855427713856 26.613306653326664 26.8384192096048 24.83741870935468 41 23.3 24.5 26.55 25.650000000000002 42 22.55 24.175 24.45 28.825 43 22.20555138784696 26.60665166291573 24.381095273818453 26.806701675418854 44 21.975 26.224999999999998 26.400000000000002 25.4 45 22.155538884721178 25.256314078519633 25.456364091022753 27.131782945736433 46 23.25581395348837 25.55638909727432 25.10627656914228 26.081520380095025 47 22.9057264316079 26.531632908227053 23.78094523630908 26.78169542385596 48 24.425 24.95 24.95 25.674999999999997 49 20.42042042042042 26.126126126126124 25.900900900900904 27.55255255255255 50 22.15 26.325 26.200000000000003 25.324999999999996 51 22.0360180090045 25.56278139069535 25.287643821910955 27.113556778389196 52 22.85 26.0 24.975 26.174999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 2.0 3 2.0 4 2.0 5 1.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 2.0 19 4.0 20 4.5 21 5.0 22 5.5 23 6.0 24 8.5 25 11.0 26 16.5 27 22.0 28 25.5 29 29.0 30 43.5 31 58.0 32 60.5 33 63.0 34 83.5 35 104.0 36 125.5 37 147.0 38 164.5 39 200.5 40 219.0 41 242.0 42 265.0 43 276.5 44 288.0 45 305.5 46 323.0 47 326.0 48 329.0 49 331.0 50 333.0 51 313.0 52 293.0 53 292.0 54 291.0 55 269.0 56 247.0 57 239.0 58 231.0 59 189.0 60 147.0 61 138.0 62 129.0 63 110.5 64 80.0 65 68.0 66 51.5 67 35.0 68 28.5 69 22.0 70 18.0 71 14.0 72 14.5 73 15.0 74 11.0 75 7.0 76 7.5 77 8.0 78 5.0 79 2.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.025 40 0.05 41 0.0 42 0.0 43 0.025 44 0.0 45 0.025 46 0.025 47 0.025 48 0.0 49 0.1 50 0.0 51 0.05 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.875 #Duplication Level Percentage of deduplicated Percentage of total 1 96.70619235836627 91.75 2 2.292490118577075 4.35 3 0.42160737812911725 1.2 4 0.2898550724637681 1.0999999999999999 5 0.15810276679841898 0.75 6 0.07905138339920949 0.44999999999999996 7 0.026350461133069828 0.17500000000000002 8 0.0 0.0 9 0.026350461133069828 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCTATGGTCGGTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGAT 9 0.22499999999999998 No Hit CCCACTTTTTGGTCTTAAGAATGCTGGTTTTAAGAATGAGTGATTGCCCTTC 7 0.17500000000000002 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 6 0.15 No Hit GTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAGTTCCT 6 0.15 No Hit GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCG 6 0.15 No Hit CTCGTATTTTCCCCTCTGCCTCGGGTTGTCTCGCGATACCTTCTACAGCTTG 5 0.125 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 5 0.125 No Hit GTGGAGACGATGGGGTCGGTCCATGGATTTTCCTTCCTTTTTCCGCATTTCG 5 0.125 No Hit GTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGC 5 0.125 No Hit CCGCATTTCGCTAAAGGGTTGAAGGAGGATAGTGCATCAAGCTGTTCGCAAG 5 0.125 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 171677 spots for SRR5423306.sra Written 171677 spots for SRR5423306.sra Read 171677 spots for SRR5423306.sra Written 171677 spots for SRR5423306.sra Read 171677 spots for SRR5423306.sra Written 171677 spots for SRR5423306.sra Read 171677 spots for SRR5423306.sra Written 171677 spots for SRR5423306.sra Read 171677 spots for SRR5423306.sra Written 171677 spots for SRR5423306.sra Read 171677 spots for SRR5423306.sra Written 171677 spots for SRR5423306.sra Read 171677 spots for SRR5423306.sra Written 171677 spots for SRR5423306.sra Read 171677 spots for SRR5423306.sra Written 171677 spots for SRR5423306.sra Read 171677 spots for SRR5423306.sra Written 171677 spots for SRR5423306.sra Read 171677 spots for SRR5423306.sra Written 171677 spots for SRR5423306.sra Read 171677 spots for SRR5423306.sra Written 171677 spots for SRR5423306.sra Read 171677 spots for SRR5423306.sra Written 171677 spots for SRR5423306.sra Read 171677 spots for SRR5423306.sra Written 171677 spots for SRR5423306.sra Read 171677 spots for SRR5423306.sra Written 171677 spots for SRR5423306.sra Read 171677 spots for SRR5423306.sra Written 171677 spots for SRR5423306.sra Read 171677 spots for SRR5423306.sra Written 171677 spots for SRR5423306.sra Read 171677 spots for SRR5423306.sra Written 171677 spots for SRR5423306.sra Read 171677 spots for SRR5423306.sra Written 171677 spots for SRR5423306.sra Read 171685 spots for SRR5423306.sra Written 171685 spots for SRR5423306.sra Read 171677 spots for SRR5423306.sra Written 171677 spots for SRR5423306.sra SRR ids: ['SRR5423306.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vgu_pfzj SRR5423306.sra spots: 3433548 blocks: [[1, 171677], [171678, 343354], [343355, 515031], [515032, 686708], [686709, 858385], [858386, 1030062], [1030063, 1201739], [1201740, 1373416], [1373417, 1545093], [1545094, 1716770], [1716771, 1888447], [1888448, 2060124], [2060125, 2231801], [2231802, 2403478], [2403479, 2575155], [2575156, 2746832], [2746833, 2918509], [2918510, 3090186], [3090187, 3261863], [3261864, 3433548]] SRR5423306 file size 604084 SRR5423306 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423306 SRR5423306_1.fastq Input file: SRR5423306_1.fastq trimmed: SRR5423306-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 21:37:23 2025 >> started Wed Feb 12 21:37:25 2025 >> done (2.211s) 3433548 reads processed; of these: 93 ( 0.00%) short reads filtered out after trimming by size control 52 ( 0.00%) empty reads filtered out after trimming by size control 3433403 (100.00%) reads available; of these: 77593 ( 2.26%) trimmed reads available after processing 3355810 (97.74%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 4 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 4 0.00% 26 4 0.00% 27 3 0.00% 28 3 0.00% 29 4 0.00% 30 6 0.00% 31 7 0.00% 32 6 0.00% 33 11 0.00% 34 18 0.00% 35 16 0.00% 36 26 0.00% 37 42 0.00% 38 26 0.00% 39 41 0.00% 40 51 0.00% 41 75 0.00% 42 91 0.00% 43 99 0.00% 44 165 0.00% 45 262 0.01% 46 394 0.01% 47 580 0.02% 48 1211 0.04% 49 2816 0.08% 50 8909 0.26% 51 62709 1.83% 52 3355810 97.74% 3433403 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.25 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=26.15 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.7 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGCCTTT Started job on | Feb 12 21:37:36 Started mapping on | Feb 12 21:37:36 Finished on | Feb 12 21:37:42 Mapping speed, Million of reads per hour | 2060.04 Number of input reads | 3433403 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 2837366 Uniquely mapped reads % | 82.64% Average mapped length | 51.77 Number of splices: Total | 272298 Number of splices: Annotated (sjdb) | 268654 Number of splices: GT/AG | 266023 Number of splices: GC/AG | 4960 Number of splices: AT/AC | 474 Number of splices: Non-canonical | 841 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.01% Deletion average length | 2.40 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 397009 % of reads mapped to multiple loci | 11.56% Number of reads mapped to too many loci | 108222 % of reads mapped to too many loci | 3.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.62% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 199028 199028 199028 N_multimapping 397009 397009 397009 N_noFeature 532383 2777327 582183 N_ambiguous 21696 175 11298 UnstrandedReadsAssigned:2283287 PositiveStrandReadsAssigned:59864 NegativeStrandReadsAssigned:2243885 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423306 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423306-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,433,403 reads, 2,529,287 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,037 rounds 52401 SRR5423306.ke.tsv 34699 SRR5423306.se.tsv 87100 total ==> SRR5423306.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 65 13.8096 Potri.005G024800.1.v4.1 1035 936 1 0.43558 Potri.004G059700.1.v4.1 961 862 2 0.945947 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 47.3379 6.78615 Potri.016G087400.1.v4.1 270 171 27 64.3742 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 24 11.1445 ==> SRR5423306.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 24 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423306 completed mapping pipeline successfully