Starting /dee2/code/volunteer_pipeline.sh SRR5423307 current disk space = 3050614542336 free memory = 1575599976 SRR5423307 SRAfilesize 3dbae4207589aa75d5ad247d89b0eff2 SRR5423307.sra SRR5423307.sra file validated SRR5423307 is single end SRR5423307 is conventional basespace SRR5423307 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423307_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.901 34.0 31.0 34.0 2.0 34.0 2 30.73 34.0 31.0 34.0 16.0 34.0 3 32.1085 34.0 31.0 34.0 28.0 34.0 4 35.85225 37.0 35.0 37.0 35.0 37.0 5 35.9505 37.0 35.0 37.0 35.0 37.0 6 36.02375 37.0 35.0 37.0 35.0 37.0 7 36.0885 37.0 35.0 37.0 35.0 37.0 8 36.07075 37.0 35.0 37.0 35.0 37.0 9 37.7605 39.0 38.0 39.0 35.0 39.0 10 37.532 39.0 37.0 39.0 35.0 39.0 11 37.7385 39.0 37.0 39.0 35.0 39.0 12 37.7295 39.0 37.0 39.0 35.0 39.0 13 37.659 39.0 38.0 39.0 35.0 39.0 14 39.0445 40.0 39.0 41.0 36.0 41.0 15 39.00375 40.0 38.0 41.0 36.0 41.0 16 39.09925 40.0 39.0 41.0 36.0 41.0 17 39.03975 40.0 38.0 41.0 36.0 41.0 18 38.958 40.0 38.0 41.0 36.0 41.0 19 39.01025 40.0 39.0 41.0 36.0 41.0 20 38.925 40.0 39.0 41.0 36.0 41.0 21 38.7765 40.0 38.0 41.0 34.0 41.0 22 38.8025 40.0 38.0 41.0 35.0 41.0 23 38.7505 40.0 38.0 41.0 35.0 41.0 24 38.66875 40.0 38.0 41.0 34.0 41.0 25 38.6235 40.0 38.0 41.0 34.0 41.0 26 38.55275 40.0 38.0 41.0 34.0 41.0 27 38.49325 40.0 38.0 41.0 34.0 41.0 28 38.3455 40.0 38.0 41.0 34.0 41.0 29 38.49275 40.0 38.0 41.0 34.0 41.0 30 38.33675 40.0 38.0 41.0 34.0 41.0 31 38.084 40.0 38.0 41.0 33.0 41.0 32 38.07625 40.0 38.0 41.0 33.0 41.0 33 38.064 40.0 38.0 41.0 33.0 41.0 34 38.046 40.0 38.0 41.0 33.0 41.0 35 37.91375 40.0 38.0 41.0 33.0 41.0 36 37.89825 40.0 38.0 41.0 33.0 41.0 37 37.73575 40.0 37.0 41.0 32.0 41.0 38 37.61825 40.0 37.0 41.0 32.0 41.0 39 37.61175 40.0 37.0 41.0 32.0 41.0 40 37.4445 40.0 37.0 41.0 31.0 41.0 41 37.53825 40.0 37.0 41.0 31.0 41.0 42 37.291 40.0 37.0 41.0 31.0 41.0 43 36.9665 40.0 37.0 41.0 30.0 41.0 44 37.178 40.0 37.0 41.0 31.0 41.0 45 37.03 40.0 36.0 41.0 30.0 41.0 46 36.70325 40.0 36.0 41.0 30.0 41.0 47 36.67 40.0 36.0 41.0 30.0 41.0 48 36.48725 39.0 36.0 41.0 29.0 41.0 49 36.38275 39.0 35.0 41.0 28.0 41.0 50 36.36675 39.0 35.0 41.0 28.0 41.0 51 36.36225 39.0 35.0 41.0 28.0 41.0 52 34.27975 38.0 33.0 40.0 23.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 3.0 22 9.0 23 12.0 24 11.0 25 22.0 26 19.0 27 27.0 28 40.0 29 49.0 30 63.0 31 76.0 32 86.0 33 121.0 34 142.0 35 201.0 36 265.0 37 497.0 38 863.0 39 1488.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.15268694910435 10.37816320727893 5.629798123400626 44.839351720216094 2 22.775000000000002 13.575000000000001 34.975 28.675 3 21.475 17.45 24.75 36.325 4 25.05 24.55 21.675 28.725 5 24.875 29.95 24.0 21.175 6 20.1 32.300000000000004 24.8 22.8 7 15.1 22.55 42.4 19.950000000000003 8 17.625 21.5 30.9 29.975 9 18.275 21.45 33.2 27.075 10 18.875 36.225 25.474999999999998 19.425 11 24.5 27.025 22.275 26.200000000000003 12 21.875 22.575 26.3 29.25 13 19.825 27.35 26.674999999999997 26.150000000000002 14 20.825 27.075 26.875 25.224999999999998 15 21.375 25.5 27.150000000000002 25.974999999999998 16 20.7 26.625 26.450000000000003 26.224999999999998 17 22.375 24.25 27.500000000000004 25.874999999999996 18 21.25 25.924999999999997 25.825 27.0 19 21.125 26.325 26.55 26.0 20 22.325 25.45 25.75 26.474999999999998 21 21.3 27.05 25.275 26.375 22 21.224999999999998 27.575 24.875 26.325 23 21.525 26.775 26.375 25.324999999999996 24 23.3 24.275 25.724999999999998 26.700000000000003 25 22.8 26.35 25.55 25.3 26 22.625 26.025 25.85 25.5 27 20.9 26.200000000000003 26.325 26.575 28 22.675 24.75 26.35 26.224999999999998 29 22.975 26.825 25.4 24.8 30 22.775000000000002 25.0 26.724999999999998 25.5 31 21.9 26.224999999999998 25.474999999999998 26.400000000000002 32 22.25 26.5 26.174999999999997 25.074999999999996 33 21.725 24.975 26.875 26.424999999999997 34 21.875 25.3 26.575 26.25 35 22.325 24.625 25.35 27.700000000000003 36 21.175 25.1 25.825 27.900000000000002 37 21.725 26.125 25.8 26.35 38 23.525 25.974999999999998 24.95 25.55 39 21.9 25.4 26.25 26.450000000000003 40 22.575 26.0 25.5 25.924999999999997 41 22.625 26.0 26.075 25.3 42 22.1 25.35 26.275 26.275 43 21.7 25.474999999999998 26.525 26.3 44 21.65 26.025 25.775 26.55 45 22.425 23.825 25.874999999999996 27.875 46 22.7 26.174999999999997 24.45 26.674999999999997 47 23.45 25.15 24.3 27.1 48 22.15 25.874999999999996 26.700000000000003 25.275 49 22.075 24.525 25.074999999999996 28.325 50 23.95 25.1 25.275 25.674999999999997 51 22.675 25.324999999999996 25.4 26.6 52 23.625 25.224999999999998 25.650000000000002 25.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.5 12 3.0 13 1.5 14 1.0 15 2.0 16 1.0 17 0.0 18 0.5 19 1.0 20 2.5 21 4.0 22 7.5 23 11.0 24 14.0 25 17.0 26 21.0 27 25.0 28 31.0 29 37.0 30 47.0 31 57.0 32 64.0 33 71.0 34 87.5 35 104.0 36 120.0 37 136.0 38 156.0 39 190.5 40 205.0 41 239.5 42 274.0 43 270.0 44 266.0 45 299.5 46 333.0 47 341.0 48 349.0 49 329.0 50 309.0 51 327.5 52 346.0 53 314.0 54 282.0 55 266.0 56 250.0 57 217.5 58 185.0 59 172.5 60 160.0 61 143.5 62 127.0 63 111.5 64 81.5 65 67.0 66 55.0 67 43.0 68 33.5 69 24.0 70 20.0 71 16.0 72 11.5 73 7.0 74 5.5 75 4.0 76 4.5 77 5.0 78 4.0 79 3.0 80 2.5 81 2.0 82 1.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 12.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.55 #Duplication Level Percentage of deduplicated Percentage of total 1 97.30709476954945 93.95 2 2.1491455204557224 4.15 3 0.31071983428275507 0.8999999999999999 4 0.18125323666494045 0.7000000000000001 5 0.02589331952356292 0.125 6 0.0 0.0 7 0.02589331952356292 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 7 0.17500000000000002 No Hit CGCACCTACGGTCCAACCAATTGGGAGAGAATCAATAGATTCCTTTTCGGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra Read 200000 spots for SRR5423307.sra Written 200000 spots for SRR5423307.sra SRR ids: ['SRR5423307.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6a808o66 SRR5423307.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423307 file size 703951 SRR5423307 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423307 SRR5423307_1.fastq Input file: SRR5423307_1.fastq trimmed: SRR5423307-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 21:41:43 2025 >> started Wed Feb 12 21:41:44 2025 >> done (1.581s) 4000000 reads processed; of these: 126 ( 0.00%) short reads filtered out after trimming by size control 57 ( 0.00%) empty reads filtered out after trimming by size control 3999817 (100.00%) reads available; of these: 104169 ( 2.60%) trimmed reads available after processing 3895648 (97.40%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 4 0.00% 21 1 0.00% 22 2 0.00% 23 3 0.00% 24 9 0.00% 25 4 0.00% 26 9 0.00% 27 12 0.00% 28 14 0.00% 29 11 0.00% 30 20 0.00% 31 26 0.00% 32 36 0.00% 33 37 0.00% 34 59 0.00% 35 56 0.00% 36 73 0.00% 37 84 0.00% 38 105 0.00% 39 144 0.00% 40 178 0.00% 41 203 0.01% 42 290 0.01% 43 336 0.01% 44 593 0.01% 45 844 0.02% 46 1098 0.03% 47 1382 0.03% 48 2436 0.06% 49 5031 0.13% 50 13374 0.33% 51 77683 1.94% 52 3895648 97.40% 3999817 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=29 prefix-density=0.26 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAGCGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=24.10 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.9 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 21:41:55 Started mapping on | Feb 12 21:41:55 Finished on | Feb 12 21:42:00 Mapping speed, Million of reads per hour | 2879.87 Number of input reads | 3999817 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3305510 Uniquely mapped reads % | 82.64% Average mapped length | 51.77 Number of splices: Total | 317459 Number of splices: Annotated (sjdb) | 313062 Number of splices: GT/AG | 310063 Number of splices: GC/AG | 5847 Number of splices: AT/AC | 513 Number of splices: Non-canonical | 1036 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 2.46 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 462885 % of reads mapped to multiple loci | 11.57% Number of reads mapped to too many loci | 123060 % of reads mapped to too many loci | 3.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.69% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 231422 231422 231422 N_multimapping 462885 462885 462885 N_noFeature 618601 3233614 678562 N_ambiguous 25000 200 12877 UnstrandedReadsAssigned:2661909 PositiveStrandReadsAssigned:71696 NegativeStrandReadsAssigned:2614071 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423307 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423307-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,817 reads, 2,972,189 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52401 SRR5423307.ke.tsv 34699 SRR5423307.se.tsv 87100 total ==> SRR5423307.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 83 14.9321 Potri.005G024800.1.v4.1 1035 936 6.00825 2.2161 Potri.004G059700.1.v4.1 961 862 6 2.40304 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 55.5484 6.74308 Potri.016G087400.1.v4.1 270 171 18.4692 37.2879 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.206234 Potri.012G127500.1.v4.1 977 878 28 11.0098 ==> SRR5423307.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 33 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423307 completed mapping pipeline successfully