Starting /dee2/code/volunteer_pipeline.sh SRR5423308 current disk space = 3050934603776 free memory = 1472031700 SRR5423308 SRAfilesize 9ab0fad79ca5b08cf9108fad412b6056 SRR5423308.sra SRR5423308.sra file validated SRR5423308 is single end SRR5423308 is conventional basespace SRR5423308 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423308_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.88875 33.0 31.0 34.0 30.0 34.0 2 32.028 34.0 31.0 34.0 30.0 34.0 3 32.1855 34.0 31.0 34.0 30.0 34.0 4 35.23525 37.0 35.0 37.0 32.0 37.0 5 35.46725 37.0 35.0 37.0 33.0 37.0 6 35.538 37.0 35.0 37.0 33.0 37.0 7 35.739 37.0 35.0 37.0 35.0 37.0 8 35.63925 37.0 35.0 37.0 33.0 37.0 9 37.3655 39.0 37.0 39.0 34.0 39.0 10 37.28775 39.0 37.0 39.0 34.0 39.0 11 37.1125 39.0 37.0 39.0 33.0 39.0 12 36.99475 39.0 37.0 39.0 33.0 39.0 13 37.0665 39.0 37.0 39.0 33.0 39.0 14 38.47175 40.0 38.0 41.0 34.0 41.0 15 38.36175 40.0 38.0 41.0 33.0 41.0 16 38.3275 40.0 38.0 41.0 33.0 41.0 17 38.34225 40.0 38.0 41.0 33.0 41.0 18 38.35075 40.0 38.0 41.0 33.0 41.0 19 38.22 40.0 38.0 41.0 33.0 41.0 20 38.20475 40.0 38.0 41.0 33.0 41.0 21 38.284 40.0 38.0 41.0 33.0 41.0 22 38.19275 40.0 38.0 41.0 33.0 41.0 23 38.3165 40.0 38.0 41.0 33.0 41.0 24 38.19825 40.0 38.0 41.0 33.0 41.0 25 38.255 40.0 38.0 41.0 33.0 41.0 26 38.14275 40.0 38.0 41.0 33.0 41.0 27 38.0225 40.0 37.0 41.0 33.0 41.0 28 38.05175 40.0 38.0 41.0 33.0 41.0 29 38.0665 40.0 38.0 41.0 33.0 41.0 30 38.13175 40.0 38.0 41.0 33.0 41.0 31 37.983 40.0 38.0 41.0 33.0 41.0 32 37.819 40.0 37.0 41.0 32.0 41.0 33 37.9635 40.0 38.0 41.0 33.0 41.0 34 37.88025 40.0 37.0 41.0 33.0 41.0 35 37.60475 40.0 37.0 41.0 32.0 41.0 36 37.82925 40.0 37.0 41.0 33.0 41.0 37 37.7605 40.0 37.0 41.0 32.0 41.0 38 37.708 40.0 37.0 41.0 32.0 41.0 39 37.6125 40.0 37.0 41.0 31.0 41.0 40 37.521 40.0 37.0 41.0 31.0 41.0 41 37.38975 40.0 37.0 41.0 31.0 41.0 42 37.18325 39.0 36.0 41.0 31.0 41.0 43 36.9885 39.0 36.0 41.0 30.0 41.0 44 36.97275 39.0 36.0 41.0 30.0 41.0 45 36.998 39.0 35.0 41.0 31.0 41.0 46 36.739 39.0 35.0 41.0 30.0 41.0 47 36.88825 39.0 35.0 41.0 30.0 41.0 48 36.76825 39.0 35.0 41.0 30.0 41.0 49 36.5495 39.0 35.0 41.0 30.0 41.0 50 36.65825 39.0 35.0 41.0 30.0 41.0 51 36.6305 39.0 35.0 41.0 30.0 41.0 52 35.30125 38.0 33.0 40.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1109 1 0.0 1109 2 0.0 1109 3 0.0 1109 4 0.0 1109 5 0.0 1109 6 0.0 1109 7 0.0 1109 8 0.0 1109 9 0.0 1109 10 0.0 1109 11 0.0 1109 12 0.0 1109 13 0.0 1109 14 0.0 1109 15 0.0 1109 16 0.0 1109 17 0.0 1109 18 0.0 1109 19 0.0 1109 20 0.0 1109 21 0.0 1109 22 0.0 1109 23 0.0 1109 24 0.0 1109 25 0.0 1109 26 0.0 1109 27 0.0 1109 28 0.0 1109 29 0.0 1109 30 0.0 1109 31 0.0 1109 32 0.0 1109 33 0.0 1109 34 0.0 1109 35 0.0 1109 36 0.0 1109 37 0.0 1109 38 0.0 1109 39 0.0 1109 40 0.0 1109 41 0.0 1109 42 0.0 1109 43 0.0 1109 44 0.0 1109 45 0.0 1109 46 0.0 1109 47 0.0 1109 48 0.0 1109 49 0.0 1109 50 0.0 1109 51 0.0 1109 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 2.0 22 2.0 23 3.0 24 7.0 25 13.0 26 24.0 27 39.0 28 40.0 29 58.0 30 56.0 31 92.0 32 125.0 33 136.0 34 175.0 35 254.0 36 332.0 37 461.0 38 721.0 39 1454.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.92365456821027 11.11389236545682 6.107634543178974 43.854818523153945 2 23.400000000000002 14.299999999999999 36.1 26.200000000000003 3 22.525000000000002 17.150000000000002 24.6 35.725 4 26.55 25.674999999999997 20.825 26.950000000000003 5 25.525 30.45 23.799999999999997 20.225 6 20.5 32.125 24.75 22.625 7 15.525 22.400000000000002 42.95 19.125 8 17.549999999999997 20.8 32.025 29.625 9 19.35 20.349999999999998 34.699999999999996 25.6 10 18.7 36.9 25.324999999999996 19.075 11 24.375 25.424999999999997 21.05 29.15 12 21.975 23.225 25.95 28.849999999999998 13 20.349999999999998 26.85 27.224999999999998 25.575 14 21.425 26.424999999999997 26.75 25.4 15 21.175 25.15 26.900000000000002 26.775 16 21.425 26.150000000000002 26.25 26.174999999999997 17 21.925 25.874999999999996 26.5 25.7 18 21.275 27.474999999999998 25.124999999999996 26.125 19 21.075 26.85 25.45 26.625 20 23.3 25.575 26.8 24.325 21 22.375 25.374999999999996 26.3 25.95 22 20.95 27.650000000000002 25.924999999999997 25.474999999999998 23 21.025 26.525 26.25 26.200000000000003 24 21.15 26.150000000000002 26.674999999999997 26.025 25 22.475 26.35 26.474999999999998 24.7 26 22.175 26.150000000000002 25.624999999999996 26.05 27 20.974999999999998 25.974999999999998 26.6 26.450000000000003 28 22.05 25.974999999999998 25.8 26.174999999999997 29 20.625 25.374999999999996 27.525 26.474999999999998 30 22.275 25.25 26.200000000000003 26.275 31 22.125 26.150000000000002 25.724999999999998 26.0 32 21.15 26.450000000000003 26.875 25.525 33 22.925 25.074999999999996 26.3 25.7 34 21.7 25.7 26.724999999999998 25.874999999999996 35 21.675 26.450000000000003 25.55 26.325 36 22.25 25.674999999999997 25.900000000000002 26.174999999999997 37 21.725 25.924999999999997 25.624999999999996 26.724999999999998 38 23.0 26.3 25.3 25.4 39 23.150000000000002 24.75 25.7 26.400000000000002 40 22.8 25.825 25.1 26.275 41 21.825 26.474999999999998 26.075 25.624999999999996 42 22.275 24.7 25.35 27.675 43 22.95 25.15 25.1 26.8 44 22.425 25.55 27.0 25.025 45 22.7 26.025 25.1 26.174999999999997 46 23.65 25.624999999999996 24.4 26.325 47 23.200000000000003 26.474999999999998 24.4 25.924999999999997 48 22.425 25.275 25.825 26.474999999999998 49 23.275000000000002 26.150000000000002 24.375 26.200000000000003 50 21.775 27.55 24.875 25.8 51 22.0 23.849999999999998 25.674999999999997 28.475 52 21.15 27.650000000000002 26.125 25.074999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 1.0 13 1.5 14 1.0 15 0.0 16 1.5 17 3.0 18 2.0 19 1.0 20 3.5 21 6.0 22 8.5 23 11.0 24 12.0 25 13.0 26 19.0 27 25.0 28 35.5 29 46.0 30 48.5 31 51.0 32 59.0 33 67.0 34 84.0 35 101.0 36 112.0 37 123.0 38 153.5 39 204.5 40 225.0 41 241.5 42 258.0 43 273.5 44 289.0 45 294.0 46 299.0 47 312.5 48 326.0 49 336.5 50 347.0 51 348.0 52 349.0 53 316.0 54 283.0 55 258.5 56 234.0 57 232.0 58 230.0 59 192.0 60 154.0 61 139.0 62 124.0 63 106.5 64 75.5 65 62.0 66 50.0 67 38.0 68 26.0 69 14.0 70 11.0 71 8.0 72 9.5 73 11.0 74 11.0 75 11.0 76 11.0 77 11.0 78 5.5 79 0.0 80 1.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.825 #Duplication Level Percentage of deduplicated Percentage of total 1 96.46717637753757 91.475 2 2.451885051410493 4.65 3 0.6854732401792776 1.95 4 0.15818613234906406 0.6 5 0.1318217769575534 0.625 6 0.02636435539151068 0.15 7 0.05272871078302136 0.35000000000000003 8 0.02636435539151068 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATGAGATGTAAGCCCCGTTCTGTTAGCCCACAGTGTTGGTGGACTTGAGTGA 8 0.2 No Hit CCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACT 7 0.17500000000000002 No Hit CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 7 0.17500000000000002 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 6 0.15 No Hit GTTCTATGGTCGGTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGAT 5 0.125 No Hit GGAGACGATGGGGTCGGTCCATGGATTTTCCTTCCTTTTTCCGCATTTCGCT 5 0.125 No Hit GCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACTGCCCAACCT 5 0.125 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 5 0.125 No Hit GCCCCATCTATCCTCCTGAGGAGAAGTTTGGTTTCAAACCCCGGTTCGAACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra Read 200000 spots for SRR5423308.sra Written 200000 spots for SRR5423308.sra SRR ids: ['SRR5423308.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s8qc7zja SRR5423308.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423308 file size 704087 SRR5423308 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423308 SRR5423308_1.fastq Input file: SRR5423308_1.fastq trimmed: SRR5423308-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 21:08:18 2025 >> started Wed Feb 12 21:08:20 2025 >> done (1.851s) 4000000 reads processed; of these: 153 ( 0.00%) short reads filtered out after trimming by size control 94 ( 0.00%) empty reads filtered out after trimming by size control 3999753 (99.99%) reads available; of these: 86103 ( 2.15%) trimmed reads available after processing 3913650 (97.85%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 3 0.00% 20 0 0.00% 21 2 0.00% 22 1 0.00% 23 0 0.00% 24 8 0.00% 25 7 0.00% 26 2 0.00% 27 5 0.00% 28 6 0.00% 29 4 0.00% 30 14 0.00% 31 14 0.00% 32 25 0.00% 33 24 0.00% 34 26 0.00% 35 28 0.00% 36 37 0.00% 37 46 0.00% 38 52 0.00% 39 68 0.00% 40 78 0.00% 41 85 0.00% 42 125 0.00% 43 171 0.00% 44 276 0.01% 45 361 0.01% 46 494 0.01% 47 822 0.02% 48 1601 0.04% 49 3663 0.09% 50 10424 0.26% 51 67623 1.69% 52 3913650 97.85% 3999753 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=27 prefix-density=0.25 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=25.86 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.7 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGCCTTT Started job on | Feb 12 21:08:34 Started mapping on | Feb 12 21:08:34 Finished on | Feb 12 21:08:42 Mapping speed, Million of reads per hour | 1799.89 Number of input reads | 3999753 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3304915 Uniquely mapped reads % | 82.63% Average mapped length | 51.78 Number of splices: Total | 317993 Number of splices: Annotated (sjdb) | 313628 Number of splices: GT/AG | 310693 Number of splices: GC/AG | 5787 Number of splices: AT/AC | 513 Number of splices: Non-canonical | 1000 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 460424 % of reads mapped to multiple loci | 11.51% Number of reads mapped to too many loci | 128495 % of reads mapped to too many loci | 3.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.63% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 234414 234414 234414 N_multimapping 460424 460424 460424 N_noFeature 620733 3233564 680101 N_ambiguous 25298 196 13134 UnstrandedReadsAssigned:2658884 PositiveStrandReadsAssigned:71155 NegativeStrandReadsAssigned:2611680 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423308 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423308-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,753 reads, 2,948,239 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR5423308.ke.tsv 34699 SRR5423308.se.tsv 87100 total ==> SRR5423308.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 114 20.7382 Potri.005G024800.1.v4.1 1035 936 2.00572 0.748057 Potri.004G059700.1.v4.1 961 862 5 2.0249 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 60.5618 7.4338 Potri.016G087400.1.v4.1 270 171 26 53.0785 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.208538 Potri.012G127500.1.v4.1 977 878 26 10.3376 ==> SRR5423308.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 52 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423308 completed mapping pipeline successfully