Starting /dee2/code/volunteer_pipeline.sh SRR5423309 current disk space = 3050647056384 free memory = 1571938616 SRR5423309 SRAfilesize 169df192d774360f87558996d06766c6 SRR5423309.sra SRR5423309.sra file validated SRR5423309 is single end SRR5423309 is conventional basespace SRR5423309 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423309_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6025 34.0 31.0 34.0 31.0 34.0 2 32.618 34.0 31.0 34.0 31.0 34.0 3 32.81 34.0 31.0 34.0 31.0 34.0 4 36.13575 37.0 37.0 37.0 35.0 37.0 5 36.14975 37.0 37.0 37.0 35.0 37.0 6 36.14425 37.0 36.0 37.0 35.0 37.0 7 36.178 37.0 36.0 37.0 35.0 37.0 8 36.20075 37.0 36.0 37.0 35.0 37.0 9 37.99375 39.0 38.0 39.0 35.0 39.0 10 37.937 39.0 38.0 39.0 35.0 39.0 11 37.93925 39.0 38.0 39.0 35.0 39.0 12 37.89025 39.0 38.0 39.0 35.0 39.0 13 37.757 39.0 38.0 39.0 35.0 39.0 14 39.22275 40.0 39.0 41.0 36.0 41.0 15 39.26 40.0 39.0 41.0 36.0 41.0 16 39.138 40.0 39.0 41.0 36.0 41.0 17 39.07675 40.0 38.0 41.0 36.0 41.0 18 39.029 40.0 38.0 41.0 36.0 41.0 19 39.0845 40.0 39.0 41.0 36.0 41.0 20 39.01375 40.0 39.0 41.0 36.0 41.0 21 39.03925 40.0 39.0 41.0 36.0 41.0 22 39.058 40.0 39.0 41.0 36.0 41.0 23 39.08075 40.0 39.0 41.0 36.0 41.0 24 38.9235 40.0 38.0 41.0 35.0 41.0 25 38.7425 40.0 38.0 41.0 35.0 41.0 26 38.6135 40.0 38.0 41.0 34.0 41.0 27 38.6945 40.0 38.0 41.0 35.0 41.0 28 38.745 40.0 38.0 41.0 35.0 41.0 29 38.67575 40.0 38.0 41.0 35.0 41.0 30 38.46 40.0 38.0 41.0 34.0 41.0 31 38.382 40.0 38.0 41.0 34.0 41.0 32 38.49925 40.0 38.0 41.0 34.0 41.0 33 38.31 40.0 38.0 41.0 34.0 41.0 34 38.32425 40.0 38.0 41.0 34.0 41.0 35 38.21025 40.0 38.0 41.0 34.0 41.0 36 38.15675 40.0 38.0 41.0 33.0 41.0 37 37.95125 40.0 38.0 41.0 33.0 41.0 38 38.035 40.0 38.0 41.0 33.0 41.0 39 38.0405 40.0 38.0 41.0 33.0 41.0 40 37.755 40.0 38.0 41.0 33.0 41.0 41 37.529 40.0 38.0 41.0 32.0 41.0 42 37.3675 40.0 37.0 41.0 31.0 41.0 43 37.3895 40.0 37.0 41.0 31.0 41.0 44 37.29825 40.0 37.0 41.0 31.0 41.0 45 37.23525 40.0 37.0 41.0 31.0 41.0 46 37.17225 40.0 36.0 41.0 31.0 41.0 47 37.03275 40.0 37.0 41.0 31.0 41.0 48 36.91075 40.0 36.0 41.0 30.0 41.0 49 36.7635 40.0 36.0 41.0 30.0 41.0 50 36.43375 39.0 35.0 41.0 29.0 41.0 51 36.44925 39.0 35.0 41.0 29.0 41.0 52 34.62475 38.0 33.0 40.0 24.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1202 1 0.0 1202 2 0.0 1202 3 0.0 1202 4 0.0 1202 5 0.0 1202 6 0.0 1202 7 0.0 1202 8 0.0 1202 9 0.0 1202 10 0.0 1202 11 0.0 1202 12 0.0 1202 13 0.0 1202 14 0.0 1202 15 0.0 1202 16 0.0 1202 17 0.0 1202 18 0.0 1202 19 0.0 1202 20 0.0 1202 21 0.0 1202 22 0.0 1202 23 0.0 1202 24 0.0 1202 25 0.0 1202 26 0.0 1202 27 0.0 1202 28 0.0 1202 29 0.0 1202 30 0.0 1202 31 0.0 1202 32 0.0 1202 33 0.0 1202 34 0.0 1202 35 0.0 1202 36 0.0 1202 37 0.0 1202 38 0.0 1202 39 0.0 1202 40 0.0 1202 41 0.0 1202 42 0.0 1202 43 0.0 1202 44 0.0 1202 45 0.0 1202 46 0.0 1202 47 0.0 1202 48 0.0 1202 49 0.0 1202 50 0.0 1202 51 0.0 1202 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 2.0 20 2.0 21 5.0 22 4.0 23 3.0 24 17.0 25 11.0 26 20.0 27 24.0 28 32.0 29 33.0 30 59.0 31 45.0 32 79.0 33 94.0 34 127.0 35 198.0 36 286.0 37 393.0 38 738.0 39 1818.0 40 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.89306286000501 10.443275732531932 6.686701728024041 43.97695967943902 2 24.5 13.525 35.375 26.6 3 21.325 17.150000000000002 25.025 36.5 4 24.775 26.0 21.0 28.225 5 25.4 30.325000000000003 24.325 19.950000000000003 6 19.825 32.35 23.9 23.925 7 15.024999999999999 22.825 43.05 19.1 8 18.224999999999998 21.75 30.875000000000004 29.15 9 19.0 20.525 33.35 27.125 10 18.925 36.7 25.724999999999998 18.65 11 24.224999999999998 26.200000000000003 21.9 27.675 12 22.875 22.15 27.625 27.35 13 20.575 26.55 28.375 24.5 14 21.025 26.625 27.400000000000002 24.95 15 22.675 25.35 26.724999999999998 25.25 16 20.3 27.175 26.775 25.75 17 21.7 25.7 26.650000000000002 25.95 18 21.075 26.3 26.025 26.6 19 21.45 27.450000000000003 25.6 25.5 20 21.575 25.974999999999998 26.575 25.874999999999996 21 21.15 26.424999999999997 26.25 26.174999999999997 22 20.8 26.875 26.325 26.0 23 22.875 25.55 25.25 26.325 24 22.35 25.35 25.124999999999996 27.175 25 21.725 25.1 26.200000000000003 26.974999999999998 26 22.125 26.375 26.775 24.725 27 22.1 25.05 26.325 26.525 28 21.65 25.3 27.474999999999998 25.575 29 21.925 24.825 26.875 26.375 30 21.45 24.55 26.174999999999997 27.825 31 22.075 25.825 27.025 25.074999999999996 32 21.275 26.950000000000003 26.125 25.650000000000002 33 21.8 24.8 26.674999999999997 26.724999999999998 34 22.275 26.775 26.55 24.4 35 23.125 24.85 24.525 27.500000000000004 36 21.025 24.825 26.1 28.050000000000004 37 22.025 25.674999999999997 25.575 26.724999999999998 38 22.45 25.124999999999996 25.75 26.674999999999997 39 22.5 25.95 25.224999999999998 26.325 40 22.275 26.35 26.625 24.75 41 22.275 25.224999999999998 25.525 26.974999999999998 42 22.325 25.650000000000002 25.275 26.75 43 23.150000000000002 25.6 25.324999999999996 25.924999999999997 44 22.825 24.625 26.200000000000003 26.35 45 22.475 24.6 25.525 27.400000000000002 46 22.255563890972745 25.30632658164541 25.23130782695674 27.206801700425103 47 23.1 24.675 25.85 26.375 48 22.630657664416105 24.256064016004 25.331332833208304 27.781945486371594 49 23.01726294721041 24.96872654490868 24.768576432324245 27.24543407555667 50 21.75543885971493 26.30657664416104 25.18129532383096 26.756689172293076 51 21.766324743557668 24.768576432324245 24.59344508381286 28.87165374030523 52 21.8304576144036 26.506626656664167 24.8062015503876 26.85671417854464 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 1.0 9 0.5 10 0.0 11 1.5 12 3.0 13 2.5 14 1.0 15 0.0 16 0.0 17 0.0 18 3.5 19 7.0 20 5.0 21 3.0 22 5.5 23 8.0 24 11.5 25 15.0 26 16.5 27 18.0 28 25.5 29 33.0 30 44.5 31 56.0 32 72.0 33 88.0 34 85.5 35 83.0 36 100.5 37 118.0 38 150.5 39 192.0 40 201.0 41 232.5 42 264.0 43 281.0 44 298.0 45 305.0 46 312.0 47 318.5 48 325.0 49 334.5 50 344.0 51 336.5 52 329.0 53 312.5 54 296.0 55 282.0 56 268.0 57 235.5 58 203.0 59 176.0 60 149.0 61 139.5 62 130.0 63 105.0 64 71.0 65 62.0 66 51.0 67 40.0 68 30.5 69 21.0 70 20.5 71 20.0 72 19.0 73 18.0 74 12.0 75 6.0 76 5.5 77 5.0 78 5.0 79 5.0 80 3.0 81 1.0 82 1.0 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.0 48 0.025 49 0.075 50 0.025 51 0.075 52 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.375 #Duplication Level Percentage of deduplicated Percentage of total 1 97.01179554390563 92.525 2 1.9134993446920052 3.65 3 0.655307994757536 1.875 4 0.15727391874180865 0.6 5 0.15727391874180865 0.75 6 0.10484927916120576 0.6 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 6 0.15 No Hit GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCG 6 0.15 No Hit GGGCGATCTCGTAGTTCCTACGGGGTGGAGACGATGGGGTCGGTCCATGGAT 6 0.15 No Hit CGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGC 6 0.15 No Hit GGGTAAACCACCGCCTCTCGGGCCCCCGACTGATTCTACCATAGAGGCCGAC 5 0.125 No Hit ATGAGATGTAAGCCCCGTTCTGTTAGCCCACAGTGTTGGTGGACTTGAGTGA 5 0.125 No Hit GCTGGTTTTAAGAATGAGTGATTGCCCTTCTCCGACCCTTACTGCCCAACCT 5 0.125 No Hit CCCACTTTTTGGTCTTAAGAATGCTGGTTTTAAGAATGAGTGATTGCCCTTC 5 0.125 No Hit GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 5 0.125 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra Read 200000 spots for SRR5423309.sra Written 200000 spots for SRR5423309.sra SRR ids: ['SRR5423309.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ncbfel5 SRR5423309.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423309 file size 703953 SRR5423309 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423309 SRR5423309_1.fastq Input file: SRR5423309_1.fastq trimmed: SRR5423309-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 21:37:44 2025 >> started Wed Feb 12 21:37:45 2025 >> done (1.551s) 4000000 reads processed; of these: 139 ( 0.00%) short reads filtered out after trimming by size control 69 ( 0.00%) empty reads filtered out after trimming by size control 3999792 (99.99%) reads available; of these: 98954 ( 2.47%) trimmed reads available after processing 3900838 (97.53%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 8 0.00% 21 2 0.00% 22 2 0.00% 23 4 0.00% 24 9 0.00% 25 8 0.00% 26 9 0.00% 27 10 0.00% 28 15 0.00% 29 15 0.00% 30 15 0.00% 31 16 0.00% 32 27 0.00% 33 38 0.00% 34 47 0.00% 35 62 0.00% 36 67 0.00% 37 94 0.00% 38 108 0.00% 39 124 0.00% 40 155 0.00% 41 218 0.01% 42 263 0.01% 43 349 0.01% 44 703 0.02% 45 739 0.02% 46 981 0.02% 47 1578 0.04% 48 2434 0.06% 49 5042 0.13% 50 12469 0.31% 51 73330 1.83% 52 3900838 97.53% 3999792 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=28 prefix-density=0.26 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=24.11 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.8 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 21:37:56 Started mapping on | Feb 12 21:37:56 Finished on | Feb 12 21:38:02 Mapping speed, Million of reads per hour | 2399.88 Number of input reads | 3999792 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3305712 Uniquely mapped reads % | 82.65% Average mapped length | 51.77 Number of splices: Total | 318883 Number of splices: Annotated (sjdb) | 314601 Number of splices: GT/AG | 311428 Number of splices: GC/AG | 5929 Number of splices: AT/AC | 520 Number of splices: Non-canonical | 1006 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.01% Deletion average length | 2.44 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 462144 % of reads mapped to multiple loci | 11.55% Number of reads mapped to too many loci | 124367 % of reads mapped to too many loci | 3.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.67% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 231936 231936 231936 N_multimapping 462144 462144 462144 N_noFeature 618473 3233997 678307 N_ambiguous 24811 181 12766 UnstrandedReadsAssigned:2662428 PositiveStrandReadsAssigned:71534 NegativeStrandReadsAssigned:2614639 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423309 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423309-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,792 reads, 2,975,363 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52401 SRR5423309.ke.tsv 34699 SRR5423309.se.tsv 87100 total ==> SRR5423309.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 102 18.3496 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 5 2.00246 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 54.5056 6.61625 Potri.016G087400.1.v4.1 270 171 25 50.4713 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 23 9.04344 ==> SRR5423309.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 48 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423309 completed mapping pipeline successfully