Starting /dee2/code/volunteer_pipeline.sh SRR5423310 current disk space = 3050595581952 free memory = 1564633500 SRR5423310 SRAfilesize 062c8128b02d334158b67ace98c273c4 SRR5423310.sra SRR5423310.sra file validated SRR5423310 is single end SRR5423310 is conventional basespace SRR5423310 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423310_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1175 33.0 31.0 34.0 30.0 34.0 2 32.31225 34.0 31.0 34.0 30.0 34.0 3 32.1295 34.0 31.0 34.0 30.0 34.0 4 35.71075 37.0 35.0 37.0 33.0 37.0 5 35.636 37.0 35.0 37.0 33.0 37.0 6 35.711 37.0 35.0 37.0 33.0 37.0 7 35.7495 37.0 35.0 37.0 33.0 37.0 8 35.76775 37.0 35.0 37.0 35.0 37.0 9 37.324 39.0 37.0 39.0 34.0 39.0 10 37.23425 39.0 37.0 39.0 33.0 39.0 11 37.29 39.0 37.0 39.0 34.0 39.0 12 37.17725 39.0 37.0 39.0 33.0 39.0 13 37.28275 39.0 37.0 39.0 34.0 39.0 14 38.66025 40.0 38.0 41.0 34.0 41.0 15 38.48625 40.0 38.0 41.0 33.0 41.0 16 38.239 40.0 38.0 41.0 33.0 41.0 17 38.43525 40.0 38.0 41.0 33.0 41.0 18 38.45975 40.0 38.0 41.0 34.0 41.0 19 38.4465 40.0 38.0 41.0 34.0 41.0 20 38.51425 40.0 38.0 41.0 34.0 41.0 21 38.31175 40.0 38.0 41.0 33.0 41.0 22 38.43025 40.0 38.0 41.0 33.0 41.0 23 38.40075 40.0 38.0 41.0 34.0 41.0 24 38.3475 40.0 38.0 41.0 33.0 41.0 25 38.3005 40.0 38.0 41.0 34.0 41.0 26 38.297 40.0 38.0 41.0 33.0 41.0 27 38.1275 40.0 38.0 41.0 33.0 41.0 28 38.17875 40.0 38.0 41.0 33.0 41.0 29 38.065 40.0 38.0 41.0 33.0 41.0 30 38.1635 40.0 38.0 41.0 33.0 41.0 31 38.15 40.0 38.0 41.0 33.0 41.0 32 38.0525 40.0 38.0 41.0 33.0 41.0 33 38.091 40.0 38.0 41.0 33.0 41.0 34 38.03475 40.0 38.0 41.0 33.0 41.0 35 37.78275 40.0 37.0 41.0 32.0 41.0 36 37.78675 40.0 37.0 41.0 32.0 41.0 37 37.70175 40.0 37.0 41.0 32.0 41.0 38 37.7055 40.0 37.0 41.0 32.0 41.0 39 37.73775 40.0 37.0 41.0 33.0 41.0 40 37.36925 40.0 37.0 41.0 31.0 41.0 41 37.281 40.0 36.0 41.0 31.0 41.0 42 37.4015 40.0 37.0 41.0 31.0 41.0 43 37.098 40.0 36.0 41.0 30.0 41.0 44 37.32075 40.0 36.0 41.0 31.0 41.0 45 37.2215 40.0 36.0 41.0 31.0 41.0 46 36.86225 39.0 35.0 41.0 30.0 41.0 47 36.843 39.0 35.0 41.0 30.0 41.0 48 36.78725 39.0 35.0 41.0 30.0 41.0 49 36.659 39.0 35.0 41.0 30.0 41.0 50 36.5125 39.0 35.0 41.0 29.0 41.0 51 36.6005 39.0 35.0 41.0 30.0 41.0 52 35.5855 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1210 1 0.0 1210 2 0.0 1210 3 0.0 1210 4 0.0 1210 5 0.0 1210 6 0.0 1210 7 0.0 1210 8 0.0 1210 9 0.0 1210 10 0.0 1210 11 0.0 1210 12 0.0 1210 13 0.0 1210 14 0.0 1210 15 0.0 1210 16 0.0 1210 17 0.0 1210 18 0.0 1210 19 0.0 1210 20 0.0 1210 21 0.0 1210 22 0.0 1210 23 0.0 1210 24 0.0 1210 25 0.0 1210 26 0.0 1210 27 0.0 1210 28 0.0 1210 29 0.0 1210 30 0.0 1210 31 0.0 1210 32 0.0 1210 33 0.0 1210 34 0.0 1210 35 0.0 1210 36 0.0 1210 37 0.0 1210 38 0.0 1210 39 0.0 1210 40 0.0 1210 41 0.0 1210 42 0.0 1210 43 0.0 1210 44 0.0 1210 45 0.0 1210 46 0.0 1210 47 0.0 1210 48 0.0 1210 49 0.0 1210 50 0.0 1210 51 0.0 1210 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 3.0 22 2.0 23 8.0 24 11.0 25 12.0 26 18.0 27 36.0 28 38.0 29 47.0 30 64.0 31 79.0 32 117.0 33 127.0 34 169.0 35 259.0 36 299.0 37 437.0 38 683.0 39 1584.0 40 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.05006257822278 10.588235294117647 5.4317897371714645 43.92991239048811 2 24.0 13.8 34.875 27.325 3 21.65 17.424999999999997 24.474999999999998 36.449999999999996 4 25.074999999999996 25.55 21.95 27.425 5 25.3 30.275000000000002 23.575 20.849999999999998 6 19.2 32.4 25.124999999999996 23.275000000000002 7 16.275000000000002 21.85 41.099999999999994 20.775 8 17.849999999999998 22.575 31.724999999999998 27.85 9 18.099999999999998 20.0 34.725 27.175 10 19.475 33.875 25.15 21.5 11 24.349999999999998 25.7 21.525 28.425 12 22.925 24.0 25.6 27.474999999999998 13 20.549999999999997 26.825 28.95 23.674999999999997 14 21.15 25.95 27.725 25.174999999999997 15 21.95 25.775 26.950000000000003 25.324999999999996 16 21.125 26.75 26.075 26.05 17 22.15 25.95 26.424999999999997 25.474999999999998 18 20.65 26.0 25.5 27.85 19 22.45 26.400000000000002 25.15 26.0 20 21.175 26.650000000000002 25.7 26.474999999999998 21 21.6 24.425 27.150000000000002 26.825 22 22.25 25.474999999999998 26.150000000000002 26.125 23 22.900000000000002 25.374999999999996 25.575 26.150000000000002 24 22.175 26.575 24.8 26.450000000000003 25 23.025000000000002 26.775 25.05 25.15 26 22.475 25.35 27.075 25.1 27 21.475 24.875 27.650000000000002 26.0 28 22.725 25.575 26.275 25.424999999999997 29 21.925 26.474999999999998 25.924999999999997 25.674999999999997 30 21.349999999999998 25.324999999999996 26.400000000000002 26.924999999999997 31 21.55 26.5 26.375 25.575 32 21.425 26.0 26.75 25.825 33 22.05 26.1 25.8 26.05 34 22.0 25.8 24.975 27.224999999999998 35 21.375 25.525 26.200000000000003 26.900000000000002 36 21.325 26.200000000000003 25.525 26.950000000000003 37 21.875 24.875 26.450000000000003 26.8 38 22.675 26.224999999999998 25.1 26.0 39 22.125 25.724999999999998 25.75 26.400000000000002 40 22.275 25.025 26.1 26.6 41 21.575 26.3 26.575 25.55 42 22.400000000000002 24.525 24.95 28.125 43 22.975 25.025 26.3 25.7 44 22.925 25.924999999999997 25.374999999999996 25.775 45 22.2 24.625 26.674999999999997 26.5 46 23.91793845384038 24.143107330497873 25.31898924193145 26.619964973730298 47 24.15 25.4 25.374999999999996 25.074999999999996 48 22.725 25.474999999999998 25.75 26.05 49 22.066549912434326 26.019514635976982 25.91943957968476 25.99449587190393 50 22.736368184092047 25.887943971985994 25.812906453226613 25.56278139069535 51 21.52152152152152 25.425425425425423 25.425425425425423 27.627627627627625 52 22.625 24.775 26.900000000000002 25.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 1.5 15 3.0 16 3.0 17 3.0 18 4.0 19 5.0 20 3.5 21 2.0 22 4.5 23 7.0 24 11.0 25 15.0 26 18.0 27 21.0 28 29.0 29 37.0 30 43.5 31 50.0 32 70.0 33 90.0 34 89.5 35 89.0 36 104.5 37 120.0 38 148.5 39 192.5 40 208.0 41 242.0 42 276.0 43 277.5 44 279.0 45 290.5 46 302.0 47 328.0 48 354.0 49 337.0 50 320.0 51 317.0 52 314.0 53 305.5 54 297.0 55 277.5 56 258.0 57 232.0 58 206.0 59 192.0 60 178.0 61 157.5 62 137.0 63 109.0 64 74.0 65 67.0 66 48.0 67 29.0 68 25.0 69 21.0 70 18.0 71 15.0 72 14.5 73 14.0 74 9.5 75 5.0 76 8.0 77 11.0 78 8.5 79 6.0 80 3.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.075 47 0.0 48 0.0 49 0.075 50 0.05 51 0.1 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.525 #Duplication Level Percentage of deduplicated Percentage of total 1 96.35017191219254 91.07499999999999 2 2.644802962179318 5.0 3 0.449616503570484 1.275 4 0.26448029621793173 1.0 5 0.13224014810896587 0.625 6 0.052896059243586355 0.3 7 0.07934408886537953 0.525 8 0.026448029621793177 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCG 8 0.2 No Hit CCCACTTTTTGGTCTTAAGAATGCTGGTTTTAAGAATGAGTGATTGCCCTTC 7 0.17500000000000002 No Hit CTCCAGCAACGGGCTCGATGTCGTAGCATCGTCCCTTATAACGATCAAGACT 7 0.17500000000000002 No Hit CCGCATTTCGCTAAAGGGTTGAAGGAGGATAGTGCATCAAGCTGTTCGCAAG 7 0.17500000000000002 No Hit CCGTAATCCTTCCACTGCCAGGAGCGGGAGGTGATCGCTGCTCTGTGAGACC 6 0.15 No Hit CCGTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGA 6 0.15 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 5 0.125 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 5 0.125 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 5 0.125 No Hit CCCGTCGGTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACT 5 0.125 No Hit GTCCACACAGTTGTCCATGTACCAGTAGAAGATTCAGCAGCTACTGCGGCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra Read 200000 spots for SRR5423310.sra Written 200000 spots for SRR5423310.sra SRR ids: ['SRR5423310.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mp2bnn3d SRR5423310.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423310 file size 703959 SRR5423310 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423310 SRR5423310_1.fastq Input file: SRR5423310_1.fastq trimmed: SRR5423310-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 21:43:21 2025 >> started Wed Feb 12 21:43:23 2025 >> done (1.985s) 4000000 reads processed; of these: 132 ( 0.00%) short reads filtered out after trimming by size control 63 ( 0.00%) empty reads filtered out after trimming by size control 3999805 (100.00%) reads available; of these: 77274 ( 1.93%) trimmed reads available after processing 3922531 (98.07%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 0 0.00% 20 5 0.00% 21 2 0.00% 22 1 0.00% 23 2 0.00% 24 3 0.00% 25 2 0.00% 26 4 0.00% 27 2 0.00% 28 6 0.00% 29 5 0.00% 30 3 0.00% 31 7 0.00% 32 10 0.00% 33 9 0.00% 34 21 0.00% 35 24 0.00% 36 24 0.00% 37 21 0.00% 38 48 0.00% 39 60 0.00% 40 62 0.00% 41 89 0.00% 42 122 0.00% 43 140 0.00% 44 256 0.01% 45 343 0.01% 46 509 0.01% 47 826 0.02% 48 1492 0.04% 49 3094 0.08% 50 9074 0.23% 51 61002 1.53% 52 3922531 98.07% 3999805 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.25 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=23.59 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.7 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 21:43:37 Started mapping on | Feb 12 21:43:37 Finished on | Feb 12 21:43:43 Mapping speed, Million of reads per hour | 2399.88 Number of input reads | 3999805 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3303035 Uniquely mapped reads % | 82.58% Average mapped length | 51.78 Number of splices: Total | 317137 Number of splices: Annotated (sjdb) | 312904 Number of splices: GT/AG | 309873 Number of splices: GC/AG | 5697 Number of splices: AT/AC | 511 Number of splices: Non-canonical | 1056 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 2.44 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 461301 % of reads mapped to multiple loci | 11.53% Number of reads mapped to too many loci | 130101 % of reads mapped to too many loci | 3.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.61% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 235469 235469 235469 N_multimapping 461301 461301 461301 N_noFeature 620391 3231697 679888 N_ambiguous 25009 187 12999 UnstrandedReadsAssigned:2657635 PositiveStrandReadsAssigned:71151 NegativeStrandReadsAssigned:2610148 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423310 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423310-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,805 reads, 2,969,905 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,025 rounds 52401 SRR5423310.ke.tsv 34699 SRR5423310.se.tsv 87100 total ==> SRR5423310.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 88 15.8836 Potri.005G024800.1.v4.1 1035 936 1 0.370054 Potri.004G059700.1.v4.1 961 862 6 2.41093 Potri.007G009000.2.v4.1 1416 1317 1 0.263 Potri.003G141000.2.v4.1 2943 2844 51.3108 6.24914 Potri.016G087400.1.v4.1 270 171 28 56.7156 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 27 10.6515 ==> SRR5423310.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 41 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423310 completed mapping pipeline successfully