Starting /dee2/code/volunteer_pipeline.sh SRR5423311 current disk space = 3050341904384 free memory = 1349257376 SRR5423311 SRAfilesize b99f3ff863eaa90691264b1023c38144 SRR5423311.sra SRR5423311.sra file validated SRR5423311 is single end SRR5423311 is conventional basespace SRR5423311 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423311_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.52475 34.0 31.0 34.0 31.0 34.0 2 32.6035 34.0 31.0 34.0 31.0 34.0 3 32.693 34.0 31.0 34.0 31.0 34.0 4 36.10125 37.0 37.0 37.0 35.0 37.0 5 36.1345 37.0 35.0 37.0 35.0 37.0 6 36.10625 37.0 36.0 37.0 35.0 37.0 7 36.15075 37.0 35.0 37.0 35.0 37.0 8 36.10475 37.0 36.0 37.0 35.0 37.0 9 37.8425 39.0 38.0 39.0 35.0 39.0 10 37.75 39.0 38.0 39.0 35.0 39.0 11 37.84875 39.0 38.0 39.0 35.0 39.0 12 37.787 39.0 38.0 39.0 35.0 39.0 13 37.8255 39.0 38.0 39.0 35.0 39.0 14 39.21575 41.0 39.0 41.0 36.0 41.0 15 39.20425 41.0 39.0 41.0 36.0 41.0 16 39.1715 40.0 39.0 41.0 36.0 41.0 17 39.20875 40.0 39.0 41.0 36.0 41.0 18 39.036 40.0 38.0 41.0 36.0 41.0 19 39.08025 40.0 39.0 41.0 36.0 41.0 20 39.08425 40.0 39.0 41.0 35.0 41.0 21 39.09 40.0 39.0 41.0 36.0 41.0 22 39.063 40.0 39.0 41.0 36.0 41.0 23 39.072 40.0 39.0 41.0 36.0 41.0 24 39.04625 40.0 39.0 41.0 36.0 41.0 25 38.9285 40.0 39.0 41.0 35.0 41.0 26 38.9255 40.0 39.0 41.0 35.0 41.0 27 38.70275 40.0 38.0 41.0 34.0 41.0 28 38.7205 40.0 38.0 41.0 35.0 41.0 29 38.786 40.0 38.0 41.0 35.0 41.0 30 38.69975 40.0 38.0 41.0 35.0 41.0 31 38.64075 40.0 38.0 41.0 34.0 41.0 32 38.6275 40.0 38.0 41.0 35.0 41.0 33 38.58725 40.0 38.0 41.0 34.0 41.0 34 38.535 40.0 38.0 41.0 34.0 41.0 35 38.32875 40.0 38.0 41.0 34.0 41.0 36 38.34875 40.0 38.0 41.0 34.0 41.0 37 38.1955 40.0 38.0 41.0 34.0 41.0 38 38.1965 40.0 38.0 41.0 33.0 41.0 39 38.11475 40.0 38.0 41.0 33.0 41.0 40 38.0245 40.0 38.0 41.0 33.0 41.0 41 37.8315 40.0 37.0 41.0 33.0 41.0 42 37.90725 40.0 38.0 41.0 33.0 41.0 43 37.8645 40.0 37.0 41.0 33.0 41.0 44 37.784 40.0 37.0 41.0 33.0 41.0 45 37.56725 40.0 37.0 41.0 32.0 41.0 46 37.55325 40.0 37.0 41.0 32.0 41.0 47 37.5265 40.0 37.0 41.0 32.0 41.0 48 37.47075 40.0 37.0 41.0 32.0 41.0 49 37.36975 40.0 36.0 41.0 32.0 41.0 50 37.147 40.0 36.0 41.0 31.0 41.0 51 37.02975 40.0 36.0 41.0 30.0 41.0 52 35.63325 38.0 34.0 40.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1302 1 0.0 1302 2 0.0 1302 3 0.0 1302 4 0.0 1302 5 0.0 1302 6 0.0 1302 7 0.0 1302 8 0.0 1302 9 0.0 1302 10 0.0 1302 11 0.0 1302 12 0.0 1302 13 0.0 1302 14 0.0 1302 15 0.0 1302 16 0.0 1302 17 0.0 1302 18 0.0 1302 19 0.0 1302 20 0.0 1302 21 0.0 1302 22 0.0 1302 23 0.0 1302 24 0.0 1302 25 0.0 1302 26 0.0 1302 27 0.0 1302 28 0.0 1302 29 0.0 1302 30 0.0 1302 31 0.0 1302 32 0.0 1302 33 0.0 1302 34 0.0 1302 35 0.0 1302 36 0.0 1302 37 0.0 1302 38 0.0 1302 39 0.0 1302 40 0.0 1302 41 0.0 1302 42 0.0 1302 43 0.0 1302 44 0.0 1302 45 0.0 1302 46 0.0 1302 47 0.0 1302 48 0.0 1302 49 0.0 1302 50 0.0 1302 51 0.0 1302 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 4.0 22 5.0 23 10.0 24 9.0 25 6.0 26 11.0 27 12.0 28 28.0 29 37.0 30 41.0 31 52.0 32 81.0 33 94.0 34 150.0 35 182.0 36 267.0 37 365.0 38 684.0 39 1952.0 40 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.30360721442886 9.794589178356713 5.485971943887775 45.41583166332666 2 22.6 13.600000000000001 36.375 27.425 3 23.150000000000002 16.325 24.099999999999998 36.425000000000004 4 25.674999999999997 25.224999999999998 21.925 27.175 5 23.3 30.5 24.8 21.4 6 19.325 31.974999999999998 25.974999999999998 22.725 7 15.325 22.975 41.675000000000004 20.025000000000002 8 18.2 22.400000000000002 30.099999999999998 29.299999999999997 9 18.85 19.950000000000003 34.449999999999996 26.75 10 18.6 35.55 25.8 20.05 11 23.45 26.6 22.925 27.025 12 21.675 24.224999999999998 25.474999999999998 28.625 13 19.925 26.375 29.2 24.5 14 20.375 27.375 26.900000000000002 25.35 15 21.9 26.924999999999997 26.3 24.875 16 20.0 25.85 26.875 27.275 17 20.974999999999998 25.3 27.925 25.8 18 20.525 27.425 25.974999999999998 26.075 19 21.825 26.125 25.624999999999996 26.424999999999997 20 20.674999999999997 27.425 27.025 24.875 21 21.575 24.474999999999998 26.200000000000003 27.750000000000004 22 20.7 27.875 25.45 25.974999999999998 23 21.375 26.3 25.124999999999996 27.200000000000003 24 22.275 25.25 26.900000000000002 25.575 25 20.724999999999998 25.575 26.224999999999998 27.474999999999998 26 21.3 25.6 27.200000000000003 25.900000000000002 27 22.400000000000002 25.874999999999996 27.0 24.725 28 22.2 24.725 27.900000000000002 25.174999999999997 29 21.575 25.724999999999998 27.825 24.875 30 20.05 25.2 27.200000000000003 27.55 31 22.3 25.775 24.65 27.275 32 21.975 26.325 26.25 25.45 33 22.125 24.9 26.400000000000002 26.575 34 21.175 25.724999999999998 26.075 27.025 35 22.25 26.375 25.1 26.275 36 21.975 25.224999999999998 25.6 27.200000000000003 37 20.275000000000002 26.200000000000003 26.325 27.200000000000003 38 22.625 25.85 25.724999999999998 25.8 39 21.45 25.2 25.95 27.400000000000002 40 21.425 25.674999999999997 26.575 26.325 41 22.075 26.375 25.174999999999997 26.375 42 20.925 25.900000000000002 25.825 27.35 43 21.6 25.974999999999998 26.0 26.424999999999997 44 21.75 26.85 25.724999999999998 25.674999999999997 45 22.325 25.7 25.95 26.025 46 22.650000000000002 25.0 25.025 27.325 47 22.675 27.275 24.4 25.650000000000002 48 23.325000000000003 26.174999999999997 24.9 25.6 49 21.55 25.75 25.35 27.35 50 22.775000000000002 24.825 24.8 27.6 51 21.625 25.324999999999996 26.125 26.924999999999997 52 24.3 25.650000000000002 24.425 25.624999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 2.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 2.0 15 3.0 16 1.5 17 0.0 18 1.0 19 2.0 20 5.0 21 8.0 22 7.5 23 7.0 24 9.0 25 11.0 26 14.5 27 18.0 28 30.0 29 42.0 30 43.0 31 44.0 32 53.5 33 63.0 34 88.0 35 113.0 36 120.5 37 128.0 38 159.5 39 212.5 40 234.0 41 251.5 42 269.0 43 281.5 44 294.0 45 304.5 46 315.0 47 323.0 48 331.0 49 337.0 50 343.0 51 329.0 52 315.0 53 313.5 54 312.0 55 275.0 56 238.0 57 222.0 58 206.0 59 174.0 60 142.0 61 145.5 62 149.0 63 105.5 64 58.5 65 55.0 66 48.0 67 41.0 68 30.0 69 19.0 70 15.0 71 11.0 72 14.5 73 18.0 74 11.0 75 4.0 76 4.0 77 4.0 78 3.0 79 2.0 80 2.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.5 #Duplication Level Percentage of deduplicated Percentage of total 1 96.24338624338624 90.95 2 2.433862433862434 4.6 3 0.8994708994708994 2.55 4 0.2380952380952381 0.8999999999999999 5 0.07936507936507936 0.375 6 0.07936507936507936 0.44999999999999996 7 0.026455026455026457 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTAAGCTACATAAGCAATAAATTGATTTTCTTCTCCAGCAACGGGCTCGA 7 0.17500000000000002 No Hit GTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAGTTCCT 6 0.15 No Hit GTCCCTTATAACGATCAAGACTGGTAAGCCCGTCGGTCCACACAGTTGTCCA 6 0.15 No Hit CCGTAATCCTTCCACTGCCAGGAGCGGGAGGTGATCGCTGCTCTGTGAGACC 6 0.15 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 5 0.125 No Hit GCCAACTTGATCCTCTTCCCCAGGGATCCCAGATGAGGGAACCCTAGGAGAG 5 0.125 No Hit GCCCCATCTATCCTCCTGAGGAGAAGTTTGGTTTCAAACCCCGGTTCGAACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra Read 200000 spots for SRR5423311.sra Written 200000 spots for SRR5423311.sra SRR ids: ['SRR5423311.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nqfaszbc SRR5423311.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423311 file size 703979 SRR5423311 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423311 SRR5423311_1.fastq Input file: SRR5423311_1.fastq trimmed: SRR5423311-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 06:20:33 2025 >> started Wed Feb 12 06:20:34 2025 >> done (1.656s) 4000000 reads processed; of these: 142 ( 0.00%) short reads filtered out after trimming by size control 67 ( 0.00%) empty reads filtered out after trimming by size control 3999791 (99.99%) reads available; of these: 76801 ( 1.92%) trimmed reads available after processing 3922990 (98.08%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 5 0.00% 20 5 0.00% 21 1 0.00% 22 0 0.00% 23 3 0.00% 24 2 0.00% 25 8 0.00% 26 8 0.00% 27 12 0.00% 28 7 0.00% 29 8 0.00% 30 10 0.00% 31 20 0.00% 32 22 0.00% 33 36 0.00% 34 45 0.00% 35 39 0.00% 36 52 0.00% 37 57 0.00% 38 75 0.00% 39 107 0.00% 40 139 0.00% 41 164 0.00% 42 219 0.01% 43 217 0.01% 44 454 0.01% 45 561 0.01% 46 753 0.02% 47 990 0.02% 48 1705 0.04% 49 3882 0.10% 50 9086 0.23% 51 58097 1.45% 52 3922990 98.08% 3999791 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.26 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=24.21 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.7 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGC Started job on | Feb 12 06:20:45 Started mapping on | Feb 12 06:20:45 Finished on | Feb 12 06:20:50 Mapping speed, Million of reads per hour | 2879.85 Number of input reads | 3999791 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3304915 Uniquely mapped reads % | 82.63% Average mapped length | 51.78 Number of splices: Total | 317523 Number of splices: Annotated (sjdb) | 313285 Number of splices: GT/AG | 310192 Number of splices: GC/AG | 5825 Number of splices: AT/AC | 523 Number of splices: Non-canonical | 983 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 2.45 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 460891 % of reads mapped to multiple loci | 11.52% Number of reads mapped to too many loci | 127883 % of reads mapped to too many loci | 3.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.64% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 233985 233985 233985 N_multimapping 460891 460891 460891 N_noFeature 620116 3232775 680508 N_ambiguous 24825 193 12899 UnstrandedReadsAssigned:2659974 PositiveStrandReadsAssigned:71947 NegativeStrandReadsAssigned:2611508 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423311 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423311-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,791 reads, 2,975,997 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,041 rounds 52401 SRR5423311.ke.tsv 34699 SRR5423311.se.tsv 87100 total ==> SRR5423311.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 91 16.3143 Potri.005G024800.1.v4.1 1035 936 2 0.735118 Potri.004G059700.1.v4.1 961 862 1 0.399113 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 68.8763 8.33188 Potri.016G087400.1.v4.1 270 171 26 52.3094 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 30 11.7552 ==> SRR5423311.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 37 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423311 completed mapping pipeline successfully