Starting /dee2/code/volunteer_pipeline.sh SRR5423312 current disk space = 3050774573056 free memory = 1466939760 SRR5423312 SRAfilesize c8062c82423acedc5bfcefd926bc6407 SRR5423312.sra SRR5423312.sra file validated SRR5423312 is single end SRR5423312 is conventional basespace SRR5423312 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423312_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.98175 33.0 31.0 34.0 30.0 34.0 2 32.11175 34.0 31.0 34.0 30.0 34.0 3 32.31525 34.0 31.0 34.0 30.0 34.0 4 35.78875 37.0 35.0 37.0 33.0 37.0 5 35.61725 37.0 35.0 37.0 33.0 37.0 6 35.55975 37.0 35.0 37.0 33.0 37.0 7 35.6755 37.0 35.0 37.0 33.0 37.0 8 35.75575 37.0 35.0 37.0 33.0 37.0 9 37.2685 39.0 37.0 39.0 34.0 39.0 10 37.2025 39.0 37.0 39.0 33.0 39.0 11 37.389 39.0 37.0 39.0 34.0 39.0 12 37.3625 39.0 37.0 39.0 34.0 39.0 13 37.06825 39.0 37.0 39.0 33.0 39.0 14 38.56825 40.0 38.0 41.0 34.0 41.0 15 38.478 40.0 38.0 41.0 34.0 41.0 16 38.4705 40.0 38.0 41.0 34.0 41.0 17 38.54525 40.0 38.0 41.0 34.0 41.0 18 38.28 40.0 38.0 41.0 33.0 41.0 19 38.35825 40.0 38.0 41.0 34.0 41.0 20 38.4185 40.0 38.0 41.0 34.0 41.0 21 38.23325 40.0 38.0 41.0 33.0 41.0 22 38.2375 40.0 38.0 41.0 33.0 41.0 23 38.401 40.0 38.0 41.0 34.0 41.0 24 38.583 40.0 38.0 41.0 34.0 41.0 25 38.43525 40.0 38.0 41.0 34.0 41.0 26 38.30425 40.0 38.0 41.0 34.0 41.0 27 38.179 40.0 38.0 41.0 33.0 41.0 28 38.16075 40.0 38.0 41.0 33.0 41.0 29 38.1685 40.0 38.0 41.0 33.0 41.0 30 38.14275 40.0 38.0 41.0 33.0 41.0 31 37.90825 40.0 37.0 41.0 33.0 41.0 32 37.897 40.0 37.0 41.0 33.0 41.0 33 37.96 40.0 37.0 41.0 33.0 41.0 34 37.77025 40.0 37.0 41.0 33.0 41.0 35 37.6035 40.0 37.0 41.0 31.0 41.0 36 37.8095 40.0 37.0 41.0 33.0 41.0 37 37.6045 40.0 37.0 41.0 31.0 41.0 38 37.82175 40.0 37.0 41.0 33.0 41.0 39 37.77725 40.0 37.0 41.0 33.0 41.0 40 37.58875 40.0 37.0 41.0 32.0 41.0 41 37.62775 40.0 37.0 41.0 32.0 41.0 42 37.48525 40.0 37.0 41.0 31.0 41.0 43 37.259 39.0 36.0 41.0 31.0 41.0 44 37.23325 39.0 36.0 41.0 31.0 41.0 45 37.308 40.0 36.0 41.0 31.0 41.0 46 36.9395 39.0 35.0 41.0 30.0 41.0 47 36.842 39.0 35.0 41.0 31.0 41.0 48 37.06525 39.0 35.0 41.0 31.0 41.0 49 36.71575 39.0 35.0 41.0 30.0 41.0 50 36.645 39.0 35.0 41.0 30.0 41.0 51 36.772 39.0 35.0 41.0 30.0 41.0 52 35.323 38.0 33.0 40.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1310 1 0.0 1310 2 0.0 1310 3 0.0 1310 4 0.0 1310 5 0.0 1310 6 0.0 1310 7 0.0 1310 8 0.0 1310 9 0.0 1310 10 0.0 1310 11 0.0 1310 12 0.0 1310 13 0.0 1310 14 0.0 1310 15 0.0 1310 16 0.0 1310 17 0.0 1310 18 0.0 1310 19 0.0 1310 20 0.0 1310 21 0.0 1310 22 0.0 1310 23 0.0 1310 24 0.0 1310 25 0.0 1310 26 0.0 1310 27 0.0 1310 28 0.0 1310 29 0.0 1310 30 0.0 1310 31 0.0 1310 32 0.0 1310 33 0.0 1310 34 0.0 1310 35 0.0 1310 36 0.0 1310 37 0.0 1310 38 0.0 1310 39 0.0 1310 40 0.0 1310 41 0.0 1310 42 0.0 1310 43 0.0 1310 44 0.0 1310 45 0.0 1310 46 0.0 1310 47 0.0 1310 48 0.0 1310 49 0.0 1310 50 0.0 1310 51 0.0 1310 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 3.0 22 1.0 23 4.0 24 10.0 25 13.0 26 16.0 27 23.0 28 26.0 29 67.0 30 57.0 31 91.0 32 120.0 33 134.0 34 169.0 35 259.0 36 317.0 37 447.0 38 783.0 39 1451.0 40 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.414414414414416 10.885885885885886 6.081081081081082 43.61861861861862 2 24.575 13.725000000000001 34.849999999999994 26.85 3 22.525000000000002 16.650000000000002 24.4 36.425000000000004 4 26.3 25.45 20.25 28.000000000000004 5 24.125 30.95 23.674999999999997 21.25 6 19.35 32.65 25.775 22.225 7 16.175 23.175 41.699999999999996 18.95 8 19.55 20.75 30.925000000000004 28.775000000000002 9 18.05 20.05 34.925 26.974999999999998 10 19.05 36.55 24.8 19.6 11 24.375 26.400000000000002 20.375 28.849999999999998 12 22.1 23.974999999999998 26.700000000000003 27.224999999999998 13 20.125 26.25 28.925 24.7 14 21.55 26.224999999999998 28.499999999999996 23.724999999999998 15 22.75 25.2 27.400000000000002 24.65 16 21.75 26.900000000000002 24.95 26.400000000000002 17 20.8 26.650000000000002 27.575 24.975 18 21.85 25.2 27.224999999999998 25.724999999999998 19 20.075000000000003 27.275 26.25 26.400000000000002 20 21.9 25.8 27.450000000000003 24.85 21 22.3 25.825 25.724999999999998 26.150000000000002 22 21.45 27.250000000000004 24.8 26.5 23 21.575 27.05 25.825 25.55 24 21.45 25.424999999999997 26.525 26.6 25 21.275 27.6 25.3 25.825 26 22.425 26.200000000000003 24.9 26.474999999999998 27 21.775 25.75 25.95 26.525 28 21.9 25.95 27.750000000000004 24.4 29 21.6 26.474999999999998 26.950000000000003 24.975 30 21.775 25.124999999999996 26.525 26.575 31 23.075000000000003 26.1 25.874999999999996 24.95 32 22.7 26.775 25.974999999999998 24.55 33 21.15 24.175 27.625 27.05 34 22.05 25.650000000000002 26.875 25.424999999999997 35 22.5 25.174999999999997 25.974999999999998 26.35 36 21.725 24.5 26.5 27.275 37 21.85 24.349999999999998 27.0 26.8 38 23.849999999999998 25.6 24.2 26.35 39 22.525000000000002 25.775 25.775 25.924999999999997 40 22.8 25.95 25.85 25.4 41 21.3 25.8 25.35 27.55 42 21.275 26.224999999999998 25.7 26.8 43 23.3 25.7 25.424999999999997 25.575 44 22.75 25.474999999999998 24.85 26.924999999999997 45 22.325 24.224999999999998 26.174999999999997 27.275 46 22.475 24.95 26.224999999999998 26.35 47 22.325 24.9 25.825 26.950000000000003 48 21.8 26.075 25.25 26.875 49 21.525 25.900000000000002 26.1 26.474999999999998 50 22.400000000000002 25.8 24.675 27.125 51 21.5 25.6 26.924999999999997 25.974999999999998 52 22.75 25.724999999999998 25.374999999999996 26.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 2.0 19 3.0 20 3.0 21 3.0 22 6.0 23 9.0 24 10.5 25 12.0 26 21.0 27 30.0 28 37.5 29 45.0 30 47.0 31 49.0 32 67.0 33 85.0 34 91.5 35 98.0 36 122.0 37 146.0 38 172.5 39 207.0 40 215.0 41 236.5 42 258.0 43 284.5 44 311.0 45 312.5 46 314.0 47 316.5 48 319.0 49 306.0 50 293.0 51 307.0 52 321.0 53 304.5 54 288.0 55 250.0 56 212.0 57 215.5 58 219.0 59 202.5 60 186.0 61 158.5 62 131.0 63 100.5 64 68.5 65 67.0 66 49.0 67 31.0 68 27.0 69 23.0 70 20.0 71 17.0 72 16.0 73 15.0 74 10.5 75 6.0 76 9.0 77 12.0 78 8.0 79 4.0 80 2.5 81 1.0 82 2.5 83 4.0 84 2.0 85 0.0 86 0.0 87 0.0 88 0.0 89 1.0 90 2.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.275 #Duplication Level Percentage of deduplicated Percentage of total 1 96.5625819994752 92.0 2 2.4140645499868802 4.6 3 0.6822356336919444 1.95 4 0.20991865652059827 0.8 5 0.10495932826029913 0.5 6 0.026239832065074783 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGCTGAGTTGGAATCCCATTCTAACTAAGGATTCTTGTGGTTCCGGAGGAT 6 0.15 No Hit GTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAGTTCCT 5 0.125 No Hit CACAAATTTTGACGTAGGCTCTCCCTCTTGGGGAGACCTTAGACCAGCACCC 5 0.125 No Hit GGTCGGTCCGCGACCCCTGGATGCCGAAGGCGTCCTTGGGGCGATCTCGTAG 5 0.125 No Hit CTCCAGCAACGGGCTCGATGTCGTAGCATCGTCCCTTATAACGATCAAGACT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra Read 200000 spots for SRR5423312.sra Written 200000 spots for SRR5423312.sra SRR ids: ['SRR5423312.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9swp6zjo SRR5423312.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423312 file size 703957 SRR5423312 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423312 SRR5423312_1.fastq Input file: SRR5423312_1.fastq trimmed: SRR5423312-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 21:22:03 2025 >> started Wed Feb 12 21:22:04 2025 >> done (1.664s) 4000000 reads processed; of these: 152 ( 0.00%) short reads filtered out after trimming by size control 68 ( 0.00%) empty reads filtered out after trimming by size control 3999780 (99.99%) reads available; of these: 77620 ( 1.94%) trimmed reads available after processing 3922160 (98.06%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 4 0.00% 21 1 0.00% 22 1 0.00% 23 5 0.00% 24 4 0.00% 25 2 0.00% 26 1 0.00% 27 13 0.00% 28 7 0.00% 29 8 0.00% 30 9 0.00% 31 8 0.00% 32 14 0.00% 33 12 0.00% 34 16 0.00% 35 36 0.00% 36 31 0.00% 37 35 0.00% 38 40 0.00% 39 52 0.00% 40 71 0.00% 41 86 0.00% 42 116 0.00% 43 185 0.00% 44 219 0.01% 45 368 0.01% 46 544 0.01% 47 805 0.02% 48 1316 0.03% 49 3155 0.08% 50 9385 0.23% 51 61058 1.53% 52 3922160 98.06% 3999780 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=29 prefix-density=0.25 prefix-fanout=2.0 sequence=GGCACACAGTAGCCCACGTGATCCCGATCAATCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=28.95 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.4 sequence=TCTTTTTCTTCAAAACCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCTCGGTTGATTTCCCTTCCTTTAGCTAGTCAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCCAAAGAGCGCAGACTCGCCACGGAGCTTGGAGACGGTTTCCCGATCGGAGATCCATGGATCACAGACGGTATCTCCCCATGGCCTTT Started job on | Feb 12 21:22:18 Started mapping on | Feb 12 21:22:18 Finished on | Feb 12 21:22:25 Mapping speed, Million of reads per hour | 2057.03 Number of input reads | 3999780 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3302751 Uniquely mapped reads % | 82.57% Average mapped length | 51.78 Number of splices: Total | 317251 Number of splices: Annotated (sjdb) | 312891 Number of splices: GT/AG | 309873 Number of splices: GC/AG | 5800 Number of splices: AT/AC | 587 Number of splices: Non-canonical | 991 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.43 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 461273 % of reads mapped to multiple loci | 11.53% Number of reads mapped to too many loci | 130405 % of reads mapped to too many loci | 3.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.61% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 235756 235756 235756 N_multimapping 461273 461273 461273 N_noFeature 620108 3231749 679247 N_ambiguous 25133 199 13084 UnstrandedReadsAssigned:2657510 PositiveStrandReadsAssigned:70803 NegativeStrandReadsAssigned:2610420 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423312 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423312-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,780 reads, 2,970,341 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,031 rounds 52401 SRR5423312.ke.tsv 34699 SRR5423312.se.tsv 87100 total ==> SRR5423312.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 98 17.6655 Potri.005G024800.1.v4.1 1035 936 2 0.739145 Potri.004G059700.1.v4.1 961 862 2 0.802598 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 54.3869 6.61516 Potri.016G087400.1.v4.1 270 171 28 56.6418 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.206643 Potri.012G127500.1.v4.1 977 878 30 11.8196 ==> SRR5423312.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 54 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423312 completed mapping pipeline successfully